| Literature DB >> 25538701 |
Zhan Yang1, Wei Liu1, Qian Cui2, Wenkai Niu3, Huan Li1, Xiangna Zhao1, Xiao Wei1, Xuesong Wang1, Simo Huang1, Derong Dong1, Sijing Lu4, Changqing Bai3, Yan Li3, Liuyu Huang1, Jing Yuan1.
Abstract
Intrinsic β-lactam resistance in Stenotrophomonas maltophilia is caused by bla L1 and/or bla L2, a kind of metallo-β-lactamase with a broad substrate spectrum including carbapenems. A rapid and sensitive molecular method for the detection of bla L1 in clinical samples is needed to guide therapeutic treatment. In present study, we first described a loop-mediated isothermal amplification (LAMP) method for the rapid detection of bla L1 in clinical samples by using two methods including a chromogenic method using calcein/Mn(2+) complex and the real-time turbidity monitoring to assess the reaction. Then dissemination of L1-producing S. maltophilia was investigated from ICU patients in three top hospital in Beijing, China. The results showed that both methods detected the target DNA within 60 min under isothermal conditions (65°C). The detection limit of LAMP was 3.79 pg/μl DNA, and its sensitivity 100-fold greater than that of conventional PCR. All 21 test strains except for S. maltophilia were negative for bla L1, indicative of the high-specificity of the primers for the bla L1. A total of 22 L1-positive isolates were identified for LAMP-based surveillance of bla L1 from 105 ICU patients with clinically suspected multi-resistant infections. The sequences of these bla L1 genes were conservative with only a few sites mutated, and the strains had highly resistant to β-lactam antibiotics. The MLST recovered that 22 strains belonged to seven different S. maltophilia sequence types (STs). Furthermore, co-occurrence of bla L1 and bla L2 genes were detected in all of isolates. Strikingly, S. maltophilia DCPS-01 was recovered to contain bla L1, bla L2, and bla NDM-1 genes, possessing an ability to hydrolyse all β-lactams antibiotics. Our data showed the diversity types of S. maltophilia carrying bla L1 and co-occurrence of many resistant genes in the clinical strains signal an ongoing and fast evolution of S. maltophilia resulting from their wide spread in the respiratory infections, and therefore will be difficult to control.Entities:
Keywords: L1 metallo-β-lactamase; LAMP; S. maltophilia; prevalence; rapid diagnosis
Year: 2014 PMID: 25538701 PMCID: PMC4260517 DOI: 10.3389/fmicb.2014.00692
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Bacterial strains used in the current study.
| Species | Source |
|---|---|
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Clinical isolate | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Beta hemolytic | Our microorganism center |
| Our microorganism center | |
| Clinical isolate | |
| Our microorganism center | |
| Enterotoxigenic | Our microorganism center |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center | |
| Our microorganism center |
Primers used for the amplification of bla.
| Primer | Type | Sequence (5’–3’) |
|---|---|---|
| L1-23F3 | Forward outer | CGGCATGCCACAGATGG |
| L1-23B3 | Backward outer | GCAGCACCGCCGTTTCT |
| L1-23FIP | Forward inner | TCAATCGCAGGTCCTGCGGTTTTCGGTCACCTGCTGGACAAC |
| L1-23BIP | Backward inner | CTY(C/T)AGCCATGCGCAY(T/C)GCS(C/G)GATTTTGCATTGGCCGCCACATG |
| L1-23LB | Loop backward | TCGCCGAGCTCAAGCGT |