Literature DB >> 25487617

The negative regulators of Wnt pathway-DACH1, DKK1, and WIF1 are methylated in oral and oropharyngeal cancer and WIF1 methylation predicts shorter survival.

Jarosław Paluszczak1, Joanna Sarbak, Magdalena Kostrzewska-Poczekaj, Katarzyna Kiwerska, Małgorzata Jarmuż-Szymczak, Reidar Grenman, Daniela Mielcarek-Kuchta, Wanda Baer-Dubowska.   

Abstract

The deregulation of Wnt signaling has recently emerged as one of the drivers of head and neck cancers. This is frequently related to the methylation of several antagonists of this pathway. This study aimed at the assessment of the profile of methylation of Wnt pathway antagonists and the determination of the prognostic value of the methylation of selected genes in oral carcinomas. The methylation of DACH1, DKK1, LKB1, PPP2R2B, RUNX3, SFRP2, and WIF-1 was analyzed in 16 oral squamous cell carcinoma cell lines using the methylation-specific polymerase chain reaction. The methylation of selected genes was further analyzed in tumor sections from 43 primary oral carcinoma patients. The analysis of oral carcinoma cell lines showed very frequent methylation of SFRP2 and WIF-1 and also a less frequent methylation of DACH1 and DKK1. On the other hand, RUNX3 was methylated only in one cell line, while LKB1 and PPP2R2B were not methylated in any of the cell lines. The biallelic methylation of DKK1 correlated with the low level of expression of this gene. Further evaluation of the methylation of DACH1, DKK1, and WIF1 in a clinical patient group confirmed the frequent methylation of WIF1 and intermediate or low frequency of methylation of DACH1 or DKK1, respectively. Importantly, the methylation of WIF-1 correlated with shorter survival in oral cancer patients. Overall, the methylation of the antagonists of Wnt pathway is frequently detected in oral squamous cell carcinomas. The methylation of WIF1 may be considered a prognostic marker in oral cancers.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25487617      PMCID: PMC4428535          DOI: 10.1007/s13277-014-2913-x

Source DB:  PubMed          Journal:  Tumour Biol        ISSN: 1010-4283


Introduction

Oral and oropharyngeal squamous cell carcinoma (OSCC) is a common cancer of the head and neck region, and it ranks as the eighth most prevalent cancer among males in the USA [1]. The overall 5-year survival rates are around 50–60 %, and despite the growing understanding of the molecular pathogenesis of head and neck squamous cell carcinomas (HNSCC), therapy outcomes remain unaltered what is explained by a relatively frequent rate of tumor relapse or the appearance of metastases [2]. The improvement of treatment outcomes may be facilitated by the discovery of new diagnostic markers. Among molecular markers, epigenetic biomarkers based on the analysis of DNA methylation profiles have already proven to be useful in both the detection and the prognostication of cancer [3]. The Wnt/β-catenin signaling pathway serves for the regulation of cell proliferation, migration, and apoptosis. When the pathway is in the resting state, the chief protein that serves for signal transduction–β-catenin is phosphorylated by an inhibitory complex which comprises of glycogen synthase kinase 3β (GSK-3β), casein kinase 1α, adenomatous polyposis coli (APC), and Axin. Phosphorylated β-catenin is immediately degraded via the ubiquitin-proteasome pathway, and thus, the cytoplasmic pool of β-catenin is kept at a very low level. During pathway activation, the binding of Wnt ligands to Frizzled receptors activates Dishevelled, which inhibits the activity of GSK-3β and blocks the degradation of β-catenin. This enables the accumulation of β-catenin in the cytoplasm and its subsequent translocation to the nucleus where it binds the TCF/LEF family of transcription factors and stimulates the expression of genes which enhance cell cycle and cell migration, such as CCND1, MYC, MMP-7, or survivin [4]. Mutations in the genes coding for proteins in the Wnt pathway are rare in HNSCC, and thus, this pathway was not believed to be significant for the pathogenesis of head and neck carcinomas [5-8]. However, recent investigations indicate that the hyperactivation of the pathway may result from a different mechanism which is based on the aberrant hypermethylation of the negative regulators of Wnt pathway. The genes which encode the extracellular antagonists of Wnt ligands or Frizzled/LRP receptors, such as SFRP1-5, WIF1, or DKK1-3, are frequently silenced in HNSCC cells through the methylation of their promoter regions. Also, the function of the intracellular negative Wnt regulators such as DACH1, PPP2R2B, or RUNX3 may be lost due to the hypermethylation of their gene promoters [7, 9–11]. It has been also reported that the expression of Wnt ligands, Frizzled receptors, and Dishevelled as well as β-catenin is increased in head and neck (HN) carcinoma cells [7, 12–15]. Moreover, the appearance of nuclear β-catenin and the enhancement of the expression of β-catenin target genes, such as MYC, CCND1, MMP-7, or survivin are often observed in HNSCC cancer cells. Importantly, such changes seem to be cancer-specific since nuclear β-catenin was not detected in normal oral mucosa in contrast to oral leukoplakia. Additionally, dysplastic leukoplakia showed stronger nuclear accumulation of β-catenin than non-dysplastic leukoplakia [16]. Another study showed that the upregulated proliferation of basaloid cells in oral epithelial dysplasia may be caused by enhanced Wnt signaling [17]. Accumulating evidence suggests that the activation of Wnt signaling escalates with the progression of head and neck cancers. Elevated expression of β-catenin correlated with shorter survival of patients with oral carcinomas [13]. In line with this observation, the knockdown of β-catenin reduced the growth of HN cancer cells and tumors [18, 19]. Moreover, the expression of β-catenin was higher in poorly differentiated tumors than in moderate and well-differentiated tumors. Indeed, β-catenin may inhibit the differentiation of keratinocytes through the upregulation of Myc [13]. Another study showed that the hyperactivation of β-catenin affects cell morphology and cell adhesion leading to the higher capacity of cells for invasion and migration driven i.a. by β-catenin-induced activation of MMP-7 expression [20]. This indicates that the cytoplasmic and nuclear accumulation of β-catenin contributes to epithelial to mesenchymal transition in HN carcinoma cells and, thus, may be significantly associated with local recurrence and lymph node metastasis. All these facts underscore the biological importance of the aberrations in Wnt signaling in the pathogenesis of HNSCC and indicate the possible prognostic significance of changes in Wnt pathway activity in disease diagnostics. The aim of the present study was to assess the frequency of gene promoter methylation of Wnt pathway antagonists (DACH1, DKK1, LKB1, PPP2R2B, RUNX3, SFRP2, and WIF-1) in oropharyngeal squamous cell carcinoma cell lines and establish the diagnostic potential of the most promising genes in respect to correlation with important clinicopathologic data such as tumor recurrence or disease-free survival in a group of oropharyngeal cancer patients. We indicate that the analysis of the methylation of the promoter region of WIF-1 constitutes the most promising prognostic biomarker in OSCC patients.

Materials and methods

Oral cancer cell lines

Sixteen cell lines derived from oral squamous cell carcinoma patients at the University of Turku, Finland were used in this study. Table 1 presents the characteristics of the original material taken to establish each of the cell lines.
Table 1

The characteristics of the patients and tumors that were taken to establish the analyzed laryngeal squamous cell carcinoma cell lines

Cell lineSexAge (years)Primary tumor locationTNM classificationSpecimen siteType of lesionHistological grade
UT-SCC-10M62SCC linguaeT1N0M0 TonguepriG2
UT-SCC-16AF77SCC linguaeT3N0M0 TonguepriG3
UT-SCC-16BF77SCC linguaeT3N0M0 NeckmetG3
UT-SCC-20AF58Floor of mouthT1N0M0 Floor of mouthpri (per)G2
UT-SCC-20BF58Floor of mouthFloor of mouthresidG2
UT-SCC-24AM41SCC linguaeT2N0M0 TonguepriG2
UT-SCC-24BM41SCC linguaeNeckmet (per)G2
UT-SCC-28F58Floor of mouthT2N0M0 Floor of mouthpri (per)G1
UT-SCC-36M46Floor of mouthT4N1M0 Floor of mouthpriG3
UT-SCC-45M76Floor of mouthT3N1M0 Floor of mouthpriG3
UT-SCC-47M78Floor of mouthT2N0M0 Floor of mouthpriG3
UT-SCC-56M62Floor of mouthTxN2M0 Floor of mouthrecG2-G3
UT-SCC-85M55SCC marginum linguaeT3N0M0 Tongue-floor of mouthrecG2
UT-SCC-90M35SCC linguaeT1N0M0 Floor of mouthrec/metG2
UT-SCC-100M70SCC gingiva mandibularisrT3 Mucosae bucchaerecG3
UT-SCC-104M80SCC plicae ventricularisT1N2AM0 NeckmetG2

M male, F female, SCC squamous cell carcinoma, pri primary tumor, per persistent, met metastasis, rec recurrent tumor

The characteristics of the patients and tumors that were taken to establish the analyzed laryngeal squamous cell carcinoma cell lines M male, F female, SCC squamous cell carcinoma, pri primary tumor, per persistent, met metastasis, rec recurrent tumor

Patients

Forty-three patients with primary oral squamous cell carcinoma who were primarily treated surgically at the Department of Otolaryngology and Clinical Oncology, Poznań University of Medical Sciences between 2008 and 2012 were enrolled for the study. Clinical data are collected in Table 2. All the samples underwent histopathological examination and were verified to contain at least 80 % of cancer cells. The follow-up observation in most cases covered at least 3 years following surgery. Thirteen patients died of cancer during follow-up. Seven patients were lost from ongoing observation after 3 years of follow-up. Moreover, only incomplete observations were available for another six patients whose follow-up observation lasted for less than 3 years (2–24 months). Follow-up information was lacking in the case of two patients. The study was approved by the Poznan University of Medical Sciences ethics committee (approval no. 1199/08).
Table 2

Patient and tumor characteristics

Age (years)Range29–85
Mean58
Sexmale40
female3
T classificationT14
T219
T310
T410
N classificationN019
N113
N210
N31
Histological gradeG16
G233
G34
Tumor localizationTonsils13
Tongue7
Tongue and floor of the mouth14
Palate2
Lips1
Base of the tongue and tonsils6
Patient and tumor characteristics

Methylation-specific PCR

DNA was extracted from samples using a standard phenol/chloroform protocol. The methylation status of DACH1, DKK1, LKB1, PPP2R2B, RUNX3, SFRP2, and WIF-1 was assessed using the methylation-specific polymerase chain reaction (MSP) [21], as previously described [9]. The primers and reaction conditions for MSP were chosen based on previously published data [7, 22–25]. All the primers were obtained from Oligo.pl (Warsaw, Poland). DNA extracted from the lymphocytes of healthy blood donors and a completely methylated human DNA (Fermentas, Burlington, Canada) were used as the negative and positive MSP control, respectively. Genomic DNA samples derived from early passage primary culture of human tracheal epithelial cells and human oral keratinocytes (ScienCell Research Laboratories, Carlsbad, CA, USA) were used as normal controls for comparison. Amplification products were resolved on 2 % agarose gels and visualized under UV light illumination.

Quantitative PCR

Total RNA was extracted by standard phenol/guanidine thiocyanate extraction and subjected to reverse transcription using the RevertAid Kit (Fermentas). Quantitative real-time PCR was performed using the HOT FIREPol Eva Green qPCR Mix (Solis BioDyne, Tartu, Estonia) and a Chromo4 thermal cycler (BioRad Laboratories, Hercules, CA, USA). The amplification protocol started with a 15-min enzyme activation at 95 °C, followed by 40 cycles of 95 °C for 20 s, 56 °C for 20 s, and 72 °C for 40 s and the final elongation at 72 °C for 5 min. The melting curve analysis was used for the verification of the lack of non-specific products. Measurements were normalized for the expression of TATA box binding protein (TBP). Primer sequences are listed in Table 3.
Table 3

The sequence of starters used in real-time PCR reactions

PrimerSequenceProduct size
TBP forward5′GGCACCACTCCACTGTATC183 bp
TBP reverse5′GGGATTATATTCGGCGTTTCG
DACH1 forward5′CAAGTGTCGGACTGGAAC172 bp
DACH1 reverse5′GATGTCTCAACTCTGGATGG
DKK1 forward5′GGAAACCATCACTGAAAGC154 bp
DKK1 reverse5′AGCACAACACAATCCTGAG
WIF1 forward5′ATTCCTGTCAATATCCATTCC163 bp
WIF1 reverse5′CAACTGATGCCTTGTGAG
The sequence of starters used in real-time PCR reactions

Statistical analysis

The correlation between clinicopathologic features and gene methylation was assessed with chi-square or Fisher’s exact test and F-Cox test (p ≤ 0.05) using STATISTICA 10.

Results

In the first stage, 16 oral squamous cell carcinoma cell lines were screened for the methylation of DACH1, DKK1, LKB1, PPP2R2B, RUNX3, SFRP2, and WIF-1 using methylation-specific PCR. We detected very frequent methylation of WIF1 (93.7 %) and SFRP2 (81.2 %) and moderately frequent methylation of DKK1 (37.5 %) and DACH1 (31.2 %). RUNX3 was found methylated in only one cell line (6.25 %), and the other genes (LKB1 and PPP2R2B) were not methylated in any of the cell lines. In order to assess whether the observed profile of methylation changes is specific for cancer cells, we analyzed the status of methylation of all the genes in normal cells of the upper aero-digestive tract—tracheal epithelial cells and oral keratinocytes. None of the genes was methylated in the genomic DNA derived from normal cells, except for SFRP2, which showed partial methylation in tracheal epithelial cells. Therefore, SFRP2 was excluded from further analysis. Next, we analyzed whether there is any association between the status of methylation of gene promoters of DACH1, DKK1, and WIF-1 and their level of expression in the cell lines (Fig. 1). In the case of DACH1, we found similar levels of the transcript in all the cell lines, irrespective of gene methylation status. This was however not surprising since, when present, usually partial (probably monoallelic) methylation was observed for this gene. On the other hand, complete gene silencing (methylation of both alleles) was usually observed in the cell lines positive for DKK1 methylation. This biallelic methylation of DKK1 was accompanied by low transcript level when compared with cell lines showing the lack of methylation of this gene. As expected, the expression of WIF1 was almost undetectable in the analyzed cell lines due to heavy methylation of the gene promoter.
Fig. 1

The relationship between the promoter methylation of DACH1 and DKK1 and normalized gene expression (transcript level). Normalized level of transcript is expressed as the ratio calculated from the formula: Ratio (reference gene/target gene) = 2 Ct (reference) − Ct (target), where TBP is the reference gene and either DACH1 or DKK1 is the target gene. Each bar represents the range of results obtained for all the samples in the respective groups with the mean value marked with the rectangle. M gene promoter methylation, U complete lack of gene promoter methylation

The relationship between the promoter methylation of DACH1 and DKK1 and normalized gene expression (transcript level). Normalized level of transcript is expressed as the ratio calculated from the formula: Ratio (reference gene/target gene) = 2 Ct (reference) − Ct (target), where TBP is the reference gene and either DACH1 or DKK1 is the target gene. Each bar represents the range of results obtained for all the samples in the respective groups with the mean value marked with the rectangle. M gene promoter methylation, U complete lack of gene promoter methylation Based on these results, we identified DACH1, DKK1, and WIF-1 as potential epimarkers in OSCC and further analyzed their methylation in a group of oral squamous cell carcinoma patients. We detected frequent methylation of WIF-1 (63.9 %) and moderately frequent methylation of DACH1 (35.9 %). On the other hand, only rare cases of methylation of DKK1 (7.1 %) were observed. One fifth of the patients did not show the methylation of any of the tested genes. Usually, only one of the genes was methylated in the patient’s tumor DNA sample. Another one fifth of the patients showed the methylation of two genes (mostly the co-methylation of DACH1 and WIF1). Only one patient showed the methylation of all three genes. The methylation of the analyzed genes did not correlate with either tumor stage (T), nodal involvement (N), tumor localization, or local recurrence. The methylation of WIF1 significantly correlated (p = 0.036) with shorter survival (Fig. 2). Also, the methylation of DKK1 correlated with histological grade (p = 0.002). However, both observations should be interpreted with caution because of the relatively low number of subjects enrolled in the study.
Fig. 2

Disease-free survival estimated by WIF-1 methylation in primary oropharyngeal tumor patients. M patients showing WIF-1 methylation, U patients showing lack of WIF1 methylation

Disease-free survival estimated by WIF-1 methylation in primary oropharyngeal tumor patients. M patients showing WIF-1 methylation, U patients showing lack of WIF1 methylation

Discussion

The number of new cases and the effectiveness of therapy of head and neck squamous cell carcinomas has remained relatively unaltered over the last decade. Mean 5-year survival rates around 60 % can be reached when surgery and/or radiotherapy are applied as standard treatment options [1]. The effectiveness is higher in patients with low-grade tumor and dramatically decreases in advanced cancer. Despite the growing understanding of the molecular changes that take place at different stages of the disease, there are still no definite markers which could be used to identify patients with increased risk of disease progression. So far, there are no approved markers of the risk of local relapse or other prognostic tests. The detection of such markers would allow the identification of patients showing worse prognosis and a higher risk of relapse and inform the necessity of application of more aggressive treatment. On the other hand, treatment options for such patients are still lacking and this gap needs to be filled in order to improve therapy outcomes in this group of patients. The molecular aberrations in the Wnt signaling pathway have recently emerged as important drivers of HNSCC [6, 16, 17, 20]. This insight can be utilized in both the diagnostics and treatment of this group of patients. It has been reported that the activation of this pathway increases with tumor progression and, indeed, the nuclear accumulation of β-catenin correlated with shorter survival of patients with oral carcinomas [13]. Since mutations of genes in this pathway are rare in HNSCC, epigenetic changes seem to be the leading mechanism for the induction of the hyperactivation of this signaling cascade. In this regard, frequent hypermethylation of the negative regulators of this pathway (DKK-3, RUNX3, SFRP1, SFRP2, SFRP4, SFRP5, and WIF1) was observed in oral and oropharyngeal cancers [7, 10, 11, 26–28]. However, the diagnostic significance of these alterations remains to be elucidated. The aim of the current study was to assess the profile of methylation changes of a broader set of Wnt pathway antagonists and analyze the diagnostic significance of these potential epimarkers. In the first stage, cell lines derived from OSCC were screened for the presence of methylation of DACH1, DKK-1, LKB1, PPP2R2B, RUNX3, SFRP2, and WIF1. Genes which were frequently methylated in the cell lines and showed the lack of methylation in DNA samples from normal control cells were further analyzed in a group of primary OSCC patients. The methylation of LKB1 was not present in any of the tested cell lines. We have previously shown that this gene does not undergo methylation in laryngeal carcinomas [9]. This is in agreement with the findings that the downregulation of LKB1 in head and neck cancers is independent of promoter methylation [29]. Similarly, PPP2R2B was not methylated in any of the cell lines. This differentiates oral carcinomas from laryngeal carcinomas where this gene is very frequently hypermethylated and shows prognostic significance [9]. It indicates that other mechanisms are responsible for the decrease in the activity of PP2A protein phosphatase complex which is observed in oral cancers [30]. In the case of RUNX3, we observed its methylation in only one cell line and thus did not analyze its methylation in primary carcinoma patients. A similar result was observed in laryngeal carcinomas [9]. Similarly, the gene was shown to be hypomethylated in tongue squamous cell carcinoma [31]. In contrast, others reported the hypermethylation of RUNX3 in 17.8 % OSCC [28]. Moreover, it was detected in 25 % of tongue carcinomas where it correlated with tumor stage and lymph node involvement [26]. Another study showed that RUNX3 was hypermethylated in 70 % OSCC and that the downregulation of RUNX3 protein correlated with poor differentiation [32]. Additionally, another study showed that RUNX3 was methylated in 60 % of cases of oral dysplasia and 100 % cases of OSCC [11]. There is discrepancy concerning the actual role of RUNX3 in HNSCC, and some authors suggest an oncogenic function for this gene [33]. This needs to be addressed in further functional studies. Of all the antagonists of Wnt pathway, the methylation of genes encoding SFRP proteins was most frequently reported in oral carcinomas. The rate of methylation of SFRP2 widely ranged (35–90 %) among various studies [7, 10, 11, 27]. We also detected frequent methylation (81.2 %) of this gene in OSCC cell lines. However, we observed that this was not fully cancer-specific. Similarly, the methylation of SFRP1/2/4/5 was also present in normal control samples, although SFRP2 showed the highest cancer specificity among the SFRP genes [10]. These observations suggest that although SFRPs are often methylated in OSCC, they might not present good diagnostic performance due to unsatisfactory specificity. We report, for the first time, that DACH1 undergoes methylation in oral squamous cell carcinomas. So far, the methylation of this gene was detected in colorectal carcinomas where it correlated with late tumor stage, poor differentiation, and lymph node metastasis [23]. Recently, DACH1 emerged as an important tumor suppressor gene [34] and its frequent methylation in OSCC underscores the potential anti-cancer effects of epigenetic therapies via suppression of Wnt signaling. Indeed, it has been shown that the inhibition of Wnt pathway blocks tumor growth in head and neck cancers [18, 19]. Although the methylation of DKK1 was infrequent in primary OSCC, it strongly correlated with histological grade. To our knowledge, the methylation of this gene was not analyzed in oral cancers although the methylation of another member of the dickkopf family of genes—DKK3—was previously reported [10]. However, it was found that the expression of DKK1 correlated significantly with a low risk of regional lymph node metastasis and that its knockdown increased the cellular migration and invasiveness in oral cancer cells [35]. This suggests a potential prognostic significance of the methylation of this gene in oral carcinomas. Although no evidence in favor of this hypothesis was found in our study, this may be attributed to a relatively small cohort of patients regarding the low frequency of methylation in the group of primary OSCC patients. In our study, WIF1 was the most frequently methylated gene in oral carcinomas. It was previously reported to be methylated in 18 % OSCC [10] and 35 % of tongue carcinoma patients [26]. Moreover, the methylation of this gene can be considered as a marker of progression of carcinogenesis since its methylation was observed to be twice more frequent in OSCC (80 %) than in oral dysplasia (40 %) [11]. Importantly, we observed that the methylation of the gene correlated with shorter overall survival of the patients. Although such a correlation was not observed in tongue carcinomas [26], others reported a similar observation in the case of non-small cell lung cancer [36]. The results presented in this study corroborate that the epigenetic abnormalities may frequently affect Wnt signaling in oral carcinomas. Roughly, 80 % of the patients showed the methylation of at least one gene. It indicates that this pathway should be considered a possible therapeutic target in OSCC apart from the fact that the analysis of promoter methylation of genes in this cascade presents promising diagnostic possibilities. In summary, our current study showed that DACH1, DKK1, and WIF-1 are methylated in oral and oropharyngeal squamous cell carcinomas. Moreover, oral cancers are differentiated from laryngeal carcinomas by the lack of methylation of PPP2R2B. The possible prognostic significance of the methylation of DKK1 and WIF1 needs to be further evaluated in prospective studies.
  35 in total

1.  Hypermethylation of RUNX3 but not WIF1 gene and its association with stage and nodal status of tongue cancers.

Authors:  G Supic; R Kozomara; N Jovic; K Zeljic; Z Magic
Journal:  Oral Dis       Date:  2011-08-08       Impact factor: 3.511

2.  Dickkopf-1 in human oral cancer.

Authors:  Kenji Ogoshi; Atsushi Kasamatsu; Manabu Iyoda; Kentaro Sakuma; Masanobu Yamatoji; Yosuke Sakamoto; Katsunori Ogawara; Masashi Shiiba; Hideki Tanzawa; Katsuhiro Uzawa
Journal:  Int J Oncol       Date:  2011-05-20       Impact factor: 5.650

3.  Lentivirus-mediated gene silencing of beta-catenin inhibits growth of human tongue cancer cells.

Authors:  Ying Duan; Mingwen Fan
Journal:  J Oral Pathol Med       Date:  2011-02-24       Impact factor: 4.253

4.  Promoter hypermethylation in primary squamous cell carcinoma of the oral cavity and oropharynx: a study of a Brazilian cohort.

Authors:  Melissa de Freitas Cordeiro-Silva; Elaine Stur; Lidiane Pignaton Agostini; José Roberto Vasconcelos de Podestá; José Carlos de Oliveira; Mariana Silveira Soares; Elismauro Francisco Mendonça; Sônia Alves Gouvea; Sandra Ventorin Von Zeidler; Iúri Drumond Louro
Journal:  Mol Biol Rep       Date:  2012-08-31       Impact factor: 2.316

Review 5.  Epigenetic diagnostics of cancer--the application of DNA methylation markers.

Authors:  Jaroslaw Paluszczak; Wanda Baer-Dubowska
Journal:  J Appl Genet       Date:  2006       Impact factor: 3.240

Review 6.  The way Wnt works: components and mechanism.

Authors:  Kenyi Saito-Diaz; Tony W Chen; Xiaoxi Wang; Curtis A Thorne; Heather A Wallace; Andrea Page-McCaw; Ethan Lee
Journal:  Growth Factors       Date:  2012-12-21       Impact factor: 2.511

7.  Knockdown of β-catenin controls both apoptotic and autophagic cell death through LKB1/AMPK signaling in head and neck squamous cell carcinoma cell lines.

Authors:  Hyo Won Chang; Yoon Se Lee; Hae Yun Nam; Myoung Wol Han; Hyo Jung Kim; So Young Moon; Hyesung Jeon; Jung Je Park; Thomas E Carey; Sung Eun Chang; Seong Who Kim; Sang Yoon Kim
Journal:  Cell Signal       Date:  2012-12-30       Impact factor: 4.315

8.  Epigenetic inactivation of SFRP genes in oral squamous cell carcinoma.

Authors:  Yohei Sogabe; Hiromu Suzuki; Minoru Toyota; Kazuhiro Ogi; Takashi Imai; Masanori Nojima; Yasushi Sasaki; Hiroyoshi Hiratsuka; Takashi Tokino
Journal:  Int J Oncol       Date:  2008-06       Impact factor: 5.650

9.  Epigenetic regulation of DACH1, a novel Wnt signaling component in colorectal cancer.

Authors:  Wenji Yan; Kongming Wu; James G Herman; Malcolm V Brock; François Fuks; Lili Yang; Hongbin Zhu; Yazhuo Li; Yunsheng Yang; Mingzhou Guo
Journal:  Epigenetics       Date:  2013-10-22       Impact factor: 4.528

10.  Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands.

Authors:  J G Herman; J R Graff; S Myöhänen; B D Nelkin; S B Baylin
Journal:  Proc Natl Acad Sci U S A       Date:  1996-09-03       Impact factor: 11.205

View more
  19 in total

Review 1.  Wnt Signaling in Cancer Stem Cell Biology.

Authors:  Felipe de Sousa E Melo; Louis Vermeulen
Journal:  Cancers (Basel)       Date:  2016-06-27       Impact factor: 6.639

2.  β-Catenin Expression Negatively Correlates with WIF1 and Predicts Poor Clinical Outcomes in Patients with Cervical Cancer.

Authors:  Jinxiao Liang; Hui Zhou; Yongpai Peng; Xiaofei Xie; Ruixin Li; Yunyun Liu; Qingsheng Xie; Zhongqiu Lin
Journal:  Biomed Res Int       Date:  2016-10-24       Impact factor: 3.411

Review 3.  TRAIL, Wnt, Sonic Hedgehog, TGFβ, and miRNA Signalings Are Potential Targets for Oral Cancer Therapy.

Authors:  Ammad Ahmad Farooqi; Chih-Wen Shu; Hurng-Wern Huang; Hui-Ru Wang; Yung-Ting Chang; Sundas Fayyaz; Shyng-Shiou F Yuan; Jen-Yang Tang; Hsueh-Wei Chang
Journal:  Int J Mol Sci       Date:  2017-07-14       Impact factor: 5.923

4.  The anti-apoptotic PON2 protein is Wnt/β-catenin-regulated and correlates with radiotherapy resistance in OSCC patients.

Authors:  Maximilian Krüger; Julianna Amort; Petra Wilgenbus; Johanna P Helmstädter; Irina Grechowa; Julia Ebert; Stefan Tenzer; Maximilian Moergel; Ines Witte; Sven Horke
Journal:  Oncotarget       Date:  2016-08-09

5.  Prognostic significance of the methylation of Wnt pathway antagonists-CXXC4, DACT2, and the inhibitors of sonic hedgehog signaling-ZIC1, ZIC4, and HHIP in head and neck squamous cell carcinomas.

Authors:  Jarosław Paluszczak; Dorota Wiśniewska; Magdalena Kostrzewska-Poczekaj; Katarzyna Kiwerska; Reidar Grénman; Daniela Mielcarek-Kuchta; Małgorzata Jarmuż-Szymczak
Journal:  Clin Oral Investig       Date:  2016-08-23       Impact factor: 3.573

6.  Pentazocine Protects SN4741 Cells Against MPP+-Induced Cell Damage via Up-Regulation of the Canonical Wnt/β-Catenin Signaling Pathway.

Authors:  Jiancai Wang; Jintao Gu; Hao Wu; Gang Zhu; Dayun Feng; Yuqian Li; Wei Guo; Keyong Tian; Guodong Gao; Li Gao
Journal:  Front Aging Neurosci       Date:  2017-06-14       Impact factor: 5.750

7.  Expression profile analysis of head and neck squamous cell carcinomas using data from The Cancer Genome Atlas.

Authors:  Li Yan; Cheng Zhan; Jihong Wu; Shengzi Wang
Journal:  Mol Med Rep       Date:  2016-03-28       Impact factor: 2.952

8.  Wnt pathway antagonists, SFRP1, SFRP2, SOX17, and PPP2R2B, are methylated in gliomas and SFRP1 methylation predicts shorter survival.

Authors:  Aleksandra Majchrzak-Celińska; Marta Słocińska; Anna-Maria Barciszewska; Stanisław Nowak; Wanda Baer-Dubowska
Journal:  J Appl Genet       Date:  2015-09-04       Impact factor: 3.240

9.  CpG island methylation profile in non-invasive oral rinse samples is predictive of oral and pharyngeal carcinoma.

Authors:  Scott M Langevin; Melissa Eliot; Rondi A Butler; Agnes Cheong; Xiang Zhang; Michael D McClean; Devin C Koestler; Karl T Kelsey
Journal:  Clin Epigenetics       Date:  2015-12-03       Impact factor: 6.551

10.  The genetic association of RUNX3 with ankylosing spondylitis can be explained by allele-specific effects on IRF4 recruitment that alter gene expression.

Authors:  Matteo Vecellio; Amity R Roberts; Carla J Cohen; Adrian Cortes; Julian C Knight; Paul Bowness; B Paul Wordsworth
Journal:  Ann Rheum Dis       Date:  2015-10-09       Impact factor: 19.103

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.