The Notch pathway is integrated into numerous developmental processes and therefore is fine-tuned on many levels, including receptor production, endocytosis, and degradation. Notch is further characterized by a twofold relationship with its Delta-Serrate (DSL) ligands, as ligands from opposing cells (trans-ligands) activate Notch, whereas ligands expressed in the same cell (cis-ligands) inhibit signaling. We show that cells without both cis- and trans-ligands can mediate Notch-dependent developmental events during Drosophila oogenesis, indicating ligand-independent Notch activity occurs when the receptor is free of cis- and trans-ligands. Furthermore, cis-ligands can reduce Notch activity in endogenous and genetically induced situations of elevated trans-ligand-independent Notch signaling. We conclude that cis-expressed ligands exert their repressive effect on Notch signaling in cases of trans-ligand-independent activation, and propose a new function of cis-inhibition which buffers cells against accidental Notch activity.
The Notch pathway is integrated into numerous developmental processes and therefore is fine-tuned on many levels, including receptor production, endocytosis, and degradation. Notch is further characterized by a twofold relationship with its Delta-Serrate (DSL) ligands, as ligands from opposing cells (trans-ligands) activate Notch, whereas ligands expressed in the same cell (cis-ligands) inhibit signaling. We show that cells without both cis- and trans-ligands can mediate Notch-dependent developmental events during Drosophila oogenesis, indicating ligand-independent Notch activity occurs when the receptor is free of cis- and trans-ligands. Furthermore, cis-ligands can reduce Notch activity in endogenous and genetically induced situations of elevated trans-ligand-independent Notch signaling. We conclude that cis-expressed ligands exert their repressive effect on Notch signaling in cases of trans-ligand-independent activation, and propose a new function of cis-inhibition which buffers cells against accidental Notch activity.
Entities:
Keywords:
D. melanogaster; Notch pathway; cell biology; developmental biology; oogenesis; signal transduction; stem cells
Canonical Notch signaling begins when the Notch receptor receives a stimulus from a DSL-type ligand (Delta [Dl] or Serrate [Ser] in Drosophila) in an adjacent cell, which leads to γ-secretase-dependent cleavage of Notch, and translocation of the intracellular domain—NICD— into the nucleus to act as a transcriptional co-activator (de Celis, 2013). Notch may also be activated in a non-canonical, DSL-ligand independent manner (Hori et al., 2012). DSL ligands can cis-inhibit ligand-dependent Notch activation when expressed in the same cell as the receptor (Micchelli et al., 1997; Del Álamo et al., 2011). However, the possibility of a relationship between DSL-ligand independent Notch activation and cis-expressed ligands has not been explored.The developing Drosophila egg chamber is a convenient model for dissecting the effects of Notch ligands in cis and in trans, as Dl is the sole signaling source and the signal sending and receiving cells can be easily distinguished (Deng et al., 2001; López-Schier and St Johnston, 2001). (Figure 1—figure supplement 1 provides a brief schematic depiction of the stages of early oogenesis.) At oogenesis stage 7, Notch signaling is activated in the somatic follicle cells by a robust germline Dl upregulation, which leads to the expression of Hindsight (Hnt), downregulation of Cut, and the polyploidization of the follicle cells (Deng et al., 2001; López-Schier and St Johnston, 2001; Sun and Deng, 2005, 2007) (Figure 1A). When Dl germline mutant clones were generated (i.e., trans-activation was removed), the follicle cells failed to downregulate Cut expression, which persisted past stage 7, indicative of a failure to activate Notch (Figure 1B). In contrast, Dl follicle cell mutant clones show precocious Cut downregulation at stage 6 attributable to the relief of cis-inhibition (Poulton et al., 2011) (Figure 1C). Surprisingly, Dl mutant clones in the follicle cells bordering Dl mutant clones in the germline (i.e., a germline with no signaling source, herein referred to as Dl-/Dl- cells) show correct Hnt and Cut expression from stage 7 (Figure 1D,E, Figure 1—figure supplement 2A,B). These Dl-/Dl- clones also correctly transit into the endocycle, as their nuclear volumes are similar to wild-type follicle cells in the later stages of oogenesis after polyploidization (Figure 1F,G), whereas cells neighboring Dl-/Dl- follicle cell clones (retaining a cis-ligand but without a trans-ligand) are comparable to wild-type cells before entry to endocycle (Figure 1F,G). Removal of both cis- and trans-Dl through knockdown of Dl by RNA interference (RNAi) simultaneously in the germline and soma confirmed this finding (Figure 2—figure supplement 1A,B). Together, these observations provide evidence that follicle cells without both cis- and trans-ligand sources can still enter the endocycle stages of oogenesis. This back-up route to the endocycle is not a co-option of Ser in place of Dl, as DlSer double clones recapitulated the Dl-/Dl- phenotype (Figure 1E, Figure 1—figure supplement 2A).
Figure 1—figure supplement 1.
A schematic depiction of the early stages of Drosophila oogenesis.
Oogenesis begins in the germarium, where germline stem cells divide four times, producing a 16-cell germline cyst which is encapsulated by somatic follicle cells (FCs). When the FCs complete encapsulation and bud from the germarium, this is termed a stage 1 egg chamber. The egg chamber then grows and the FCs undergo mitosis until stage 6, and during these stages Cut is expressed and cells remain diploid. At stage 5, Dl is strongly upregulated in the germline. The transition from stage 6 to stage 7 is defined by activation of Notch, upregulation of Hnt, repression of Cut, and the endocycling of the FCs.
DOI:
http://dx.doi.org/10.7554/eLife.04415.004
Figure 1.
Follicle cells without DSL ligand bordering germline cells without DSL ligand show proper Notch activation and downstream differentiation.
Illustrations legend: active Notch = white cytoplasm, inactive Notch = red cytoplasm, WT cell = grey nuclei, mutant clone = white nuclei. (A–E). Follicle cells downregulate Cut at stage 7 of oogenesis (A). Dl mutant germline cells cause late Cut expression in follicle cells (B). Dl mutant follicle cells downregulate Cut early (C). Dl follicle cell clones bordering Dl germline clones show proper Cut downregulation (D). DlSer mutant follicle cell clones bordering DlSer germline clones also show proper Hnt (E). See Figure 1—figure supplement 2 for a z-series image for 1D and 1E. These germline/follicle cell clones (D and E) show increased nuclear size comparable to wild-type (WT) follicle cells which have entered the endocycle (n = 8 for each stage/genotype) (F and G). For (G), Welch t-tests were done to assess significance between each condition. The only comparisons that were not significant were between WT stage 10B and Dl-/Dl- clones and between WT stage 6 and Dl germline clones, indicating nuclear size in germline clones alone is similar to that of cells before the endocycle, whereas Dl-/Dl- clonal nuclei are more similar in size to cells that have entered the endocycle. Scale bars represent 20 μm, except in F, where the scale bar represents 5 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.003
Oogenesis begins in the germarium, where germline stem cells divide four times, producing a 16-cell germline cyst which is encapsulated by somatic follicle cells (FCs). When the FCs complete encapsulation and bud from the germarium, this is termed a stage 1 egg chamber. The egg chamber then grows and the FCs undergo mitosis until stage 6, and during these stages Cut is expressed and cells remain diploid. At stage 5, Dl is strongly upregulated in the germline. The transition from stage 6 to stage 7 is defined by activation of Notch, upregulation of Hnt, repression of Cut, and the endocycling of the FCs.
DOI:
http://dx.doi.org/10.7554/eLife.04415.004
Z series confocal images of DlSer (A) or Dl (B) germline/follicle cell clones from Figure 1D,E stained for Hnt (A) or Cut (B). Notice Hnt staining in the anterior end of (A) is owing to the formation of a partial germline clone containing both wild-type (WT; anterior, left) and DlSer (posterior, right) nurse cells, and therefore the anterior-most WT follicle cells have a ligand source to induce normal Hnt expression. Quantification of Cut expression in Dl-/Dl- clones induced by RNAi or by Dl homozygous mutant cells, and the effect of loss of Notch or Su(H) (C) (n = 30 for Dl-/Dl- MARCM, n = 25 for Dl-/Dl- RNAi, n = 38 for Dl-/Dl- MARCM + N RNAi, and n = 24 for Dl-/Dl- RNAi + Su(H)47 MARCM).
DOI:
http://dx.doi.org/10.7554/eLife.04415.005
Figure 1—figure supplement 2.
Z-stacked images of Dl-/Dl- clones and quantification of Cut staining in egg chamber clones.
Z series confocal images of DlSer (A) or Dl (B) germline/follicle cell clones from Figure 1D,E stained for Hnt (A) or Cut (B). Notice Hnt staining in the anterior end of (A) is owing to the formation of a partial germline clone containing both wild-type (WT; anterior, left) and DlSer (posterior, right) nurse cells, and therefore the anterior-most WT follicle cells have a ligand source to induce normal Hnt expression. Quantification of Cut expression in Dl-/Dl- clones induced by RNAi or by Dl homozygous mutant cells, and the effect of loss of Notch or Su(H) (C) (n = 30 for Dl-/Dl- MARCM, n = 25 for Dl-/Dl- RNAi, n = 38 for Dl-/Dl- MARCM + N RNAi, and n = 24 for Dl-/Dl- RNAi + Su(H)47 MARCM).
DOI:
http://dx.doi.org/10.7554/eLife.04415.005
Figure 2—figure supplement 1.
Control experiments relating to Figure 2.
The Dl-/Dl- phenotype can also be recapitulated using Dl, which knocks down Dl in both the germline and soma using the FLP-out method (A and B). See the arrowhead in (B) for wild-type (WT) Dl staining. Again, germline clones are evidenced by aberrant Cut expression in WT follicle cells. MARCM-induced clones expressing only Notch show late Cut expression (C). Su(H) mutant clones created using the MARCM system also show late Cut staining and smaller nuclei (D). Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.007
Follicle cells without DSL ligand bordering germline cells without DSL ligand show proper Notch activation and downstream differentiation.
Illustrations legend: active Notch = white cytoplasm, inactive Notch = red cytoplasm, WT cell = grey nuclei, mutant clone = white nuclei. (A–E). Follicle cells downregulate Cut at stage 7 of oogenesis (A). Dl mutant germline cells cause late Cut expression in follicle cells (B). Dl mutant follicle cells downregulate Cut early (C). Dl follicle cell clones bordering Dl germline clones show proper Cut downregulation (D). DlSer mutant follicle cell clones bordering DlSer germline clones also show proper Hnt (E). See Figure 1—figure supplement 2 for a z-series image for 1D and 1E. These germline/follicle cell clones (D and E) show increased nuclear size comparable to wild-type (WT) follicle cells which have entered the endocycle (n = 8 for each stage/genotype) (F and G). For (G), Welch t-tests were done to assess significance between each condition. The only comparisons that were not significant were between WT stage 10B and Dl-/Dl- clones and between WT stage 6 and Dl germline clones, indicating nuclear size in germline clones alone is similar to that of cells before the endocycle, whereas Dl-/Dl- clonal nuclei are more similar in size to cells that have entered the endocycle. Scale bars represent 20 μm, except in F, where the scale bar represents 5 μm.DOI:
http://dx.doi.org/10.7554/eLife.04415.003
A schematic depiction of the early stages of Drosophila oogenesis.
Oogenesis begins in the germarium, where germline stem cells divide four times, producing a 16-cell germline cyst which is encapsulated by somatic follicle cells (FCs). When the FCs complete encapsulation and bud from the germarium, this is termed a stage 1 egg chamber. The egg chamber then grows and the FCs undergo mitosis until stage 6, and during these stages Cut is expressed and cells remain diploid. At stage 5, Dl is strongly upregulated in the germline. The transition from stage 6 to stage 7 is defined by activation of Notch, upregulation of Hnt, repression of Cut, and the endocycling of the FCs.DOI:
http://dx.doi.org/10.7554/eLife.04415.004
Z-stacked images of Dl-/Dl- clones and quantification of Cut staining in egg chamber clones.
Z series confocal images of DlSer (A) or Dl (B) germline/follicle cell clones from Figure 1D,E stained for Hnt (A) or Cut (B). Notice Hnt staining in the anterior end of (A) is owing to the formation of a partial germline clone containing both wild-type (WT; anterior, left) and DlSer (posterior, right) nurse cells, and therefore the anterior-most WT follicle cells have a ligand source to induce normal Hnt expression. Quantification of Cut expression in Dl-/Dl- clones induced by RNAi or by Dl homozygous mutant cells, and the effect of loss of Notch or Su(H) (C) (n = 30 for Dl-/Dl- MARCM, n = 25 for Dl-/Dl- RNAi, n = 38 for Dl-/Dl- MARCM + N RNAi, and n = 24 for Dl-/Dl- RNAi + Su(H)47 MARCM).DOI:
http://dx.doi.org/10.7554/eLife.04415.005To determine whether the entry into the endocycle in Dl-/Dl- follicle cells still requires the function of Notch, we implemented the mosaic analysis with a repressible cell marker (MARCM) system (Lee and Luo, 2001). The MARCM system enables us to create mutant clones while driving expression of a UAS transgene specifically in those clonal cells. Dl-/Dl- clones driving expression of Notch show a significantly higher proportion (p < 0.0001) of late Cut-expressing cells than the Dl-/Dl- clones alone, indicating that Notch is still required for the mitotic-to-endocycle switch (Figures 1D and 2A, Figure 1—figure supplement 2C, Figure 2—figure supplement 1C, Supplementary file 1). Likewise, MARCM clones for the null allele of Suppressor of Hairless (DrosophilaNotch transcriptional effector), Su(H), in RNAi-induced Dl-/Dl- clones also show late Cut expression (p < 0.0001) (Figure 2B, Figure 1—figure supplement 2C, Supplementary file 1) in comparison with RNAi-induced Dl/Dl- clone controls (Figure 2—figure supplement 1A,D). A Notch activity reporter, Notch Responsive Element (NRE)-green fluorescent protein (GFP) (Stempfle et al., 2010) was also upregulated in Dl-/Dl- clones as early as stage 2, and this expression persisted beyond stage 6 (Figure 2C,D), suggesting that NRE-GFP is probably more sensitive to Notch activation than Hnt in follicle cells. Together, these results suggest that Notch activity occurs independently of canonical ligands when both cis- and trans-ligands are removed, resulting in normal downstream developmental events in the follicle cells. Consistently, DlSer double mutant clones in the wing and eye discs show a slight cell-autonomous upregulation of NRE-GFP in the clone center, which would only occur if cis-inhibition blocked a DSL-independent mode of Notch activity, as interior cells have no access to trans-ligand (Figure 2E,F). This NRE-GFP upregulation was spatially variable in the wing disc, having the highest prevalence in the notum region (25% incidence), a low incidence in the dorsal pouch (8%), whereas in the ventral pouch region it was never seen (n = 80) (Supplementary file 1), perhaps owing to the differential regulation of Notch degradation throughout the wing disc (Hori et al., 2011). As reported previously, most wing disc clones showed a higher NRE-GFP upregulation in the clone boundary where there is access to trans-ligand, indicating that the ligand-independent Notch activity observed occurs at a rather low level.
Figure 2.
Cis-ligand represses ligand-independent Notch activity in the follicle cells and imaginal discs.
Dl mutant MARCM germline/follicle cell clones co-expressing Notch show prolonged Cut expression (A). Su(H) MARCM mutant germline/follicle cell clones co-expressing Dl show failure to enter the endocycle (B). Germline clones are shown by late Cut expression in wild-type follicle cells (A, B, see arrowheads). See Figure 2—figure supplement 1A for control Dl-induced germline follicle cell clones. Notch Responsive Element-green fluorescent protein (NRE-GFP) is upregulated beginning from stage 2 (C) and through later stages (D) in Dl germline and follicle cell clones. NRE-GFP is also upregulated cell-autonomously in DlSer mutant clones in eye (E) and wing (F) imaginal discs. Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.006
The Dl-/Dl- phenotype can also be recapitulated using Dl, which knocks down Dl in both the germline and soma using the FLP-out method (A and B). See the arrowhead in (B) for wild-type (WT) Dl staining. Again, germline clones are evidenced by aberrant Cut expression in WT follicle cells. MARCM-induced clones expressing only Notch show late Cut expression (C). Su(H) mutant clones created using the MARCM system also show late Cut staining and smaller nuclei (D). Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.007
Cis-ligand represses ligand-independent Notch activity in the follicle cells and imaginal discs.
Dl mutant MARCM germline/follicle cell clones co-expressing Notch show prolonged Cut expression (A). Su(H) MARCM mutant germline/follicle cell clones co-expressing Dl show failure to enter the endocycle (B). Germline clones are shown by late Cut expression in wild-type follicle cells (A, B, see arrowheads). See Figure 2—figure supplement 1A for control Dl-induced germline follicle cell clones. Notch Responsive Element-green fluorescent protein (NRE-GFP) is upregulated beginning from stage 2 (C) and through later stages (D) in Dl germline and follicle cell clones. NRE-GFP is also upregulated cell-autonomously in DlSer mutant clones in eye (E) and wing (F) imaginal discs. Scale bars represent 20 μm.DOI:
http://dx.doi.org/10.7554/eLife.04415.006
Control experiments relating to Figure 2.
The Dl-/Dl- phenotype can also be recapitulated using Dl, which knocks down Dl in both the germline and soma using the FLP-out method (A and B). See the arrowhead in (B) for wild-type (WT) Dl staining. Again, germline clones are evidenced by aberrant Cut expression in WT follicle cells. MARCM-induced clones expressing only Notch show late Cut expression (C). Su(H) mutant clones created using the MARCM system also show late Cut staining and smaller nuclei (D). Scale bars represent 20 μm.DOI:
http://dx.doi.org/10.7554/eLife.04415.007DrosophilaS2 cells are reported to have no Dl expression and a very low level of Ser expression, which had no effect on Notch signaling (Fehon et al., 1990; Graveley et al., 2011) (Figure 3—figure supplement 1), and have been used as a model to study ligand-independent Notch activity (Hori et al., 2011). Upon transfection with pMT-N, a CuSO4-inducible full-length Notch construct, Notch activation was increased by a factor of 5.13 compared with the control cells, as indicated by a NRE-firefly luciferase reporter gene (p < 0.0001) (Figure 3C). Notch activation in S2 cells is at least partially dependent on endosomal trafficking, as double-stranded (ds) RNA against early endosome component, Rab5, or multivesicular body sorting protein, hrs, reduced the levels of Notch activation (Figure 3A,B). This is consistent with the in vivo studies indicating that ligand-independent Notch activation relies heavily on receptor trafficking (Hori et al., 2012) (Rab5 p = 0.00623, hrs p = 0.0159), and our observation that Notch accumulates in Dl-/Dl- clones (Figure 3—figure supplement 2). A requirement for trafficking is consistent with the results of others who have demonstrated aberrant Notch activation in follicle cell mutants for trafficking components (Wilkin et al., 2004; Vaccari et al., 2008; Schneider et al., 2013), such as tsg101 mutant clones, which show early Notch activation in the follicle cells (Figure 3—figure supplement 3). Furthermore, co-transfecting pMT-N with pMT-GAL4 and pUASt-Ser, a form of Ser that cannot activate Notch, but only cis-inhibit, (Fleming et al., 2013) almost entirely abolished the Notch activation detected when NFL was transfected alone (p = 0.0048) (Figure 3C). These results suggest that if Notch is expressed in a cell free of cis- and trans-ligands, DSL ligand-independent activity will occur and that cis-inhibition is extremely efficient in preventing this ‘accidental’ Notch activity as it travels through the endosomal pathway en route to degradation.
Figure 3—figure supplement 1.
Addition of Ser dsRNA had no effect on the Notch activation in S2 cells in comparison with cells treated with control green fluorescent protein (GFP) dsRNA, indicating that the small amount of Ser expression is either not translated or does not significantly contribute to Notch activation upon transfection with pMT-N.
This validates our assumption that the Notch activation which occurs in S2 cells is by a DSL-ligand-independent mechanism. Dl was not tested, as studies have already shown a lack of Dl mRNA and protein in S2 cells (Fehon et al., 1990; Graveley et al., 2011). Again, experiments were carried out with two technical replicates and three biological replicates, with means of the technical replicates used for a paired t-test to assess significance. Error bars represent SD.
DOI:
http://dx.doi.org/10.7554/eLife.04415.009
Figure 3.
DSL-ligand-independent Notch activity in S2 cells is buffered by cis-ligand.
Trafficking is important for Notch activation in S2 cells, as treatment with Rab5 dsRNA (A) or hrs dsRNA (B) significantly decreases the amount of Notch activated in S2 cells as shown by Notch-responsive luciferase activity (NRE-firefly) in relative light units (RLU). Transfecting only pMT-Notch into S2 cells causes a 5.13-fold increase in Notch activation, which is almost entirely reduced (1.34-fold from the negative control) by co-transfection of pMT-GAL4 and pUASt-Ser (C). Each experiment was carried out with two technical replicates and three biological replicates. Means of the technical replicates were used to carry out a paired t-test (n = 3) for each comparison. Error bars represent standard deviation (SD).
DOI:
http://dx.doi.org/10.7554/eLife.04415.008
This validates our assumption that the Notch activation which occurs in S2 cells is by a DSL-ligand-independent mechanism. Dl was not tested, as studies have already shown a lack of Dl mRNA and protein in S2 cells (Fehon et al., 1990; Graveley et al., 2011). Again, experiments were carried out with two technical replicates and three biological replicates, with means of the technical replicates used for a paired t-test to assess significance. Error bars represent SD.
DOI:
http://dx.doi.org/10.7554/eLife.04415.009
Staining either Notch extracellular domain (A) or intracellular domain (B) showed increased Notch levels in Dl mutant germline/follicle cell clones. This could be seen as early as stage 2 where Notch protein seemed membrane localized (A), but by stage 5 it no longer localized to the membrane and appeared as a somewhat cloudy cytoplasmic accumulation (B). Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.010
tsg101 clones show early Cut downregulation.
DOI:
http://dx.doi.org/10.7554/eLife.04415.011
Figure 3—figure supplement 2.
Notch accumulates in Dl-/Dl- clones.
Staining either Notch extracellular domain (A) or intracellular domain (B) showed increased Notch levels in Dl mutant germline/follicle cell clones. This could be seen as early as stage 2 where Notch protein seemed membrane localized (A), but by stage 5 it no longer localized to the membrane and appeared as a somewhat cloudy cytoplasmic accumulation (B). Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.010
Figure 3—figure supplement 3.
Follicle cells mutant for ESCRT component tsg101 show early Notch activity in the follicle cells (Vaccari et al., 2008).
tsg101 clones show early Cut downregulation.
DOI:
http://dx.doi.org/10.7554/eLife.04415.011
DSL-ligand-independent Notch activity in S2 cells is buffered by cis-ligand.
Trafficking is important for Notch activation in S2 cells, as treatment with Rab5 dsRNA (A) or hrs dsRNA (B) significantly decreases the amount of Notch activated in S2 cells as shown by Notch-responsive luciferase activity (NRE-firefly) in relative light units (RLU). Transfecting only pMT-Notch into S2 cells causes a 5.13-fold increase in Notch activation, which is almost entirely reduced (1.34-fold from the negative control) by co-transfection of pMT-GAL4 and pUASt-Ser (C). Each experiment was carried out with two technical replicates and three biological replicates. Means of the technical replicates were used to carry out a paired t-test (n = 3) for each comparison. Error bars represent standard deviation (SD).DOI:
http://dx.doi.org/10.7554/eLife.04415.008
Addition of Ser dsRNA had no effect on the Notch activation in S2 cells in comparison with cells treated with control green fluorescent protein (GFP) dsRNA, indicating that the small amount of Ser expression is either not translated or does not significantly contribute to Notch activation upon transfection with pMT-N.
This validates our assumption that the Notch activation which occurs in S2 cells is by a DSL-ligand-independent mechanism. Dl was not tested, as studies have already shown a lack of Dl mRNA and protein in S2 cells (Fehon et al., 1990; Graveley et al., 2011). Again, experiments were carried out with two technical replicates and three biological replicates, with means of the technical replicates used for a paired t-test to assess significance. Error bars represent SD.DOI:
http://dx.doi.org/10.7554/eLife.04415.009
Notch accumulates in Dl-/Dl- clones.
Staining either Notch extracellular domain (A) or intracellular domain (B) showed increased Notch levels in Dl mutant germline/follicle cell clones. This could be seen as early as stage 2 where Notch protein seemed membrane localized (A), but by stage 5 it no longer localized to the membrane and appeared as a somewhat cloudy cytoplasmic accumulation (B). Scale bars represent 20 μm.DOI:
http://dx.doi.org/10.7554/eLife.04415.010
Follicle cells mutant for ESCRT component tsg101 show early Notch activity in the follicle cells (Vaccari et al., 2008).
tsg101 clones show early Cut downregulation.DOI:
http://dx.doi.org/10.7554/eLife.04415.011We next explored whether cis-inhibition can also block ligand-independent Notch activity induced in aberrant genetic backgrounds. The Notch target, Wingless (Wg) is normally expressed along the dorsoventral boundary of the wing disc (Figure 4A). Lethal giant disc (lgd) homozygous mutant (lgd) larvae display overgrown imaginal discs and ubiquitous ligand-independent Notch activation in the wing pouch region, as shown by upregulation of Wg (Figure 4B). Notch activation in lgd mutant cells is caused by a defect in Notch trafficking and degradation, as the receptor is aberrantly transported to the limiting membrane of the lysosome which facilitates production of NICD (Childress et al., 2006; Gallagher and Knoblich, 2006; Jaekel and Klein, 2006; Schneider et al., 2013). Using dpp-GAL4 to misexpress UAS-Dl along the anterior–posterior axis of the wing disc in lgd homozygous larvae, Wg expression was considerably reduced along the dpp expression domain, indicating that cis-inhibition can block the ligand-independent Notch activity observed in this situation (Figure 4C). Overexpression of Deltex (Dx), an E3 ubiquitin ligase that stimulates Notch monoubiquitination and promotes its trafficking to the lysosomal limiting membrane, has also been shown to induce ligand-independent Notch activation specifically in the ventral wing pouch region (Matsuno et al., 2002; Hori et al., 2004; Wilkin et al., 2008; Schneider et al., 2013) (Figure 4D). We used patched (ptc)-GAL4 to drive expression of UAS-Dx with either UAS-Dl or UAS-Ser, whose ectopic expression leads to a reduction of Wg staining along the dorsoventral boundary (Micchelli et al., 1997; Fleming et al., 2013) (controls in Figure 4—figure supplement 1A,E). Co-expression of Dx and Dl led to a decrease in Wg expression in the ventral ptc domain as compared with expression of Dx alone (Figure 4E). When UAS-Dx and UAS-Ser were co-expressed, there was a small but noticeable, albeit variable, decrease in Dx-induced Notch activation (Figure 4—figure supplement 1B–D). This incomplete reduction was probably due to the previously noted, slightly compromised, cis-inhibitory potential of UAS-Ser (Fleming et al., 2013) (Figure 4—figure supplement 1A). Taken together, these results provide evidence that cis-ligand has a negative effect on the raised levels of DSL-ligand independent Notch activation incurred in genetically abnormal cells.
Figure 4.
Notch ligand buffers against genetically induced DSL-independent activation.
Wing discs were stained with Wg antibody and illustrations are colored red where Wg is expressed (A–E). A wing disc with regions of interest is labeled and WT Wg staining shown (A). lgd/lgd wing discs show ubiquitous Wg expression in the wing pouch as a result of DSL-ligand-independent Notch activity (B). Misexpression of UAS-Dl in lgd/lgd discs causes a reduction in Wg staining along the anteroposterior boundary of the pouch (C). ptcGAL4 drives UAS-Dx causing ectopic Notch activity in the ventral wing pouch (D). Co-expression of Dx with Dl reduces Wg staining in the ptc domain (E), although, as in lgd/lgd discs, the reduction is not complete towards the dorsoventral boundary. Cis-ligand also decreases Notch activation caused by genetic defects in S2 cells (F–H). Co-transfection with pMT-N and pMT-Dx caused a significant increase in Notch luciferase reporter expression, and adding Ser significantly reduced this Dx-induced activation (F). Cells treated with lgd dsRNA (G) or ESCRT-III component, shrub, dsRNA (H) also caused significant increases in Notch reporter activity, either of which could be blocked by addition of Ser. For each of the S2 cell experiments, means were taken for technical duplicates and used for a paired t-test for three biological replicates. Error bars represent SD. Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.012
Wing discs were stained with Wg antibody (A–E). Illustrations show Wg staining in red, with lower intensities of Wg presence being shown in pink (A–E). ptcGAL4 driving green fluorescent protein (GFP) and UAS-Ser along the anteroposterior (AP) boundary (A). This caused an incomplete reduction in Wg staining along the dorsoventral (DV) boundary. The slight increase in the red channel along the AP boundary is because the UAS-Ser construct is tagged with tomato and bleeds into our ‘red’ secondary antibody confocal channel. For the rest a different channel was used. Coexpression of UAS-Ser with UAS-Dx showed a variable effect on the Dx-induced aberrant Notch activity (B–D). Sometimes Dx-induced Notch activity was completely abolished (B), sometimes only partially reduced (C), and sometimes remained unchanged (D). All UAS-Ser/UAS-Dx discs are from the same round of antibody staining and taken with the same scale and settings on confocal microscopy. ptcGAL4 driving UAS-Dl caused a complete reduction of Wg at the DV boundary and elicited aberrant Wg expression on the boundary of the ptc domain. (E) Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.013
Lz-GAL4-driven green fluorescent protein (GFP) expression is an efficient marker of crystal cells which show a low incidence of bursting (A and E). Misexpressing UAS-Ser increased the frequency of witnessing bursting crystal cells (see arrowheads in B) (B and E). Lymph glands were counted for each genotype (n = 14 for lz > GFP, n = 12 for lz > GFP; UAS-Notch, and n = 14 for lz > GFP; UAS-Ser). Welch's t-test was used to assess significance between wild-type (WT) lymph glands and each of the experimental groups (p = 0.043 and p = 0.029, respectively). To determine whether Ser-misexpression induced ‘bursting’ was caused by the cis-inhibitory effect of Ser on ligand-independent Notch activation, we used the Notch activity reporter E(spl):mβ-CD2. We focused our analysis on larger crystal cells, which enter the endocycle as part of their differentiation (Terriente-Felix et al., 2013), and therefore are the ones most probably undergoing ligand-independent Notch activation. For illustrations, all GFP-positive cells were outlined and were filled in with differing shades of red corresponding to Notch reporter staining intensity. E(spl)mβ:CD2 is expressed in 55% of crystal cells and 77.4% of mature crystal cells (C and F). Misexpression of UAS-Ser significantly (p < 0.0001 for mature crystal cells, p = 0.0457 if all crystal cells were taken into account) reduced the fraction of crystal cells which show E(spl)mβ:CD2 expression, with 34.4% of all cells showing expression and 20.7% of mature cells showing CD2 expression (D and F). For this analysis, the total number of lz > GFP cells were counted, taking into account their size, lz > GFP intensity, and E(spl)CD2 intensity. Mature crystal cells were defined as cells that were both large and had intense lz > GFP. We then took the proportion of either all cells, or mature cells which had E(spl)CD2 staining for each lymph gland (n = 12 for lz > GFP, n = 13 for lz > GFP;UAS-Ser). Grubbs' outlier test was used, which removed one data point (p < 0.05) from the control, which had an unusually small number of crystal cells. Then Welch's t-test was used to assess significance between the mean proportions of crystal cells which showed Notch activity. All error bars represent SD. These observations indicate that increased ligand expression in crystal cells decreases cell survival by blocking Notch ligand-independent activation, and therefore the buffering role of cis-expressed ligand can be extended to endogenous cases of DSL-independent Notch activity. Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.014
Normal Hnt expression in crystal cells expressing green fluorescent protein (GFP) driven by lz-GAL4 (A) and in lz-GAL4 driving expression of UAS-Ser (B). There was no noticeable effect on the proportion of cells expressing Hnt when UAS-Ser was misexpressed. Illustrations show outlines of crystal cells with either no Hnt expression (white filling) or Hnt expression (red filling). Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.015
Figure 4—figure supplement 1.
Co-expression of UAS-Dx and UAS-Ser has a variable effect on DSL-independent Notch activation.
Wing discs were stained with Wg antibody (A–E). Illustrations show Wg staining in red, with lower intensities of Wg presence being shown in pink (A–E). ptcGAL4 driving green fluorescent protein (GFP) and UAS-Ser along the anteroposterior (AP) boundary (A). This caused an incomplete reduction in Wg staining along the dorsoventral (DV) boundary. The slight increase in the red channel along the AP boundary is because the UAS-Ser construct is tagged with tomato and bleeds into our ‘red’ secondary antibody confocal channel. For the rest a different channel was used. Coexpression of UAS-Ser with UAS-Dx showed a variable effect on the Dx-induced aberrant Notch activity (B–D). Sometimes Dx-induced Notch activity was completely abolished (B), sometimes only partially reduced (C), and sometimes remained unchanged (D). All UAS-Ser/UAS-Dx discs are from the same round of antibody staining and taken with the same scale and settings on confocal microscopy. ptcGAL4 driving UAS-Dl caused a complete reduction of Wg at the DV boundary and elicited aberrant Wg expression on the boundary of the ptc domain. (E) Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.013
Notch ligand buffers against genetically induced DSL-independent activation.
Wing discs were stained with Wg antibody and illustrations are colored red where Wg is expressed (A–E). A wing disc with regions of interest is labeled and WT Wg staining shown (A). lgd/lgd wing discs show ubiquitous Wg expression in the wing pouch as a result of DSL-ligand-independent Notch activity (B). Misexpression of UAS-Dl in lgd/lgd discs causes a reduction in Wg staining along the anteroposterior boundary of the pouch (C). ptcGAL4 drives UAS-Dx causing ectopic Notch activity in the ventral wing pouch (D). Co-expression of Dx with Dl reduces Wg staining in the ptc domain (E), although, as in lgd/lgd discs, the reduction is not complete towards the dorsoventral boundary. Cis-ligand also decreases Notch activation caused by genetic defects in S2 cells (F–H). Co-transfection with pMT-N and pMT-Dx caused a significant increase in Notch luciferase reporter expression, and adding Ser significantly reduced this Dx-induced activation (F). Cells treated with lgd dsRNA (G) or ESCRT-III component, shrub, dsRNA (H) also caused significant increases in Notch reporter activity, either of which could be blocked by addition of Ser. For each of the S2 cell experiments, means were taken for technical duplicates and used for a paired t-test for three biological replicates. Error bars represent SD. Scale bars represent 20 μm.DOI:
http://dx.doi.org/10.7554/eLife.04415.012
Co-expression of UAS-Dx and UAS-Ser has a variable effect on DSL-independent Notch activation.
Wing discs were stained with Wg antibody (A–E). Illustrations show Wg staining in red, with lower intensities of Wg presence being shown in pink (A–E). ptcGAL4 driving green fluorescent protein (GFP) and UAS-Ser along the anteroposterior (AP) boundary (A). This caused an incomplete reduction in Wg staining along the dorsoventral (DV) boundary. The slight increase in the red channel along the AP boundary is because the UAS-Ser construct is tagged with tomato and bleeds into our ‘red’ secondary antibody confocal channel. For the rest a different channel was used. Coexpression of UAS-Ser with UAS-Dx showed a variable effect on the Dx-induced aberrant Notch activity (B–D). Sometimes Dx-induced Notch activity was completely abolished (B), sometimes only partially reduced (C), and sometimes remained unchanged (D). All UAS-Ser/UAS-Dx discs are from the same round of antibody staining and taken with the same scale and settings on confocal microscopy. ptcGAL4 driving UAS-Dl caused a complete reduction of Wg at the DV boundary and elicited aberrant Wg expression on the boundary of the ptc domain. (E) Scale bars represent 20 μm.DOI:
http://dx.doi.org/10.7554/eLife.04415.013
Endogenous DSL-independent Notch activity in crystal cells is reduced by cis-inhibition.
Lz-GAL4-driven green fluorescent protein (GFP) expression is an efficient marker of crystal cells which show a low incidence of bursting (A and E). Misexpressing UAS-Ser increased the frequency of witnessing bursting crystal cells (see arrowheads in B) (B and E). Lymph glands were counted for each genotype (n = 14 for lz > GFP, n = 12 for lz > GFP; UAS-Notch, and n = 14 for lz > GFP; UAS-Ser). Welch's t-test was used to assess significance between wild-type (WT) lymph glands and each of the experimental groups (p = 0.043 and p = 0.029, respectively). To determine whether Ser-misexpression induced ‘bursting’ was caused by the cis-inhibitory effect of Ser on ligand-independent Notch activation, we used the Notch activity reporter E(spl):mβ-CD2. We focused our analysis on larger crystal cells, which enter the endocycle as part of their differentiation (Terriente-Felix et al., 2013), and therefore are the ones most probably undergoing ligand-independent Notch activation. For illustrations, all GFP-positive cells were outlined and were filled in with differing shades of red corresponding to Notch reporter staining intensity. E(spl)mβ:CD2 is expressed in 55% of crystal cells and 77.4% of mature crystal cells (C and F). Misexpression of UAS-Ser significantly (p < 0.0001 for mature crystal cells, p = 0.0457 if all crystal cells were taken into account) reduced the fraction of crystal cells which show E(spl)mβ:CD2 expression, with 34.4% of all cells showing expression and 20.7% of mature cells showing CD2 expression (D and F). For this analysis, the total number of lz > GFP cells were counted, taking into account their size, lz > GFP intensity, and E(spl)CD2 intensity. Mature crystal cells were defined as cells that were both large and had intense lz > GFP. We then took the proportion of either all cells, or mature cells which had E(spl)CD2 staining for each lymph gland (n = 12 for lz > GFP, n = 13 for lz > GFP;UAS-Ser). Grubbs' outlier test was used, which removed one data point (p < 0.05) from the control, which had an unusually small number of crystal cells. Then Welch's t-test was used to assess significance between the mean proportions of crystal cells which showed Notch activity. All error bars represent SD. These observations indicate that increased ligand expression in crystal cells decreases cell survival by blocking Notch ligand-independent activation, and therefore the buffering role of cis-expressed ligand can be extended to endogenous cases of DSL-independent Notch activity. Scale bars represent 20 μm.DOI:
http://dx.doi.org/10.7554/eLife.04415.014
Reduced Notch reporter activity in crystal cells was not caused by indirect effects on early ligand-dependent Notch signaling in prohaemocytes.
Normal Hnt expression in crystal cells expressing green fluorescent protein (GFP) driven by lz-GAL4 (A) and in lz-GAL4 driving expression of UAS-Ser (B). There was no noticeable effect on the proportion of cells expressing Hnt when UAS-Ser was misexpressed. Illustrations show outlines of crystal cells with either no Hnt expression (white filling) or Hnt expression (red filling). Scale bars represent 20 μm.DOI:
http://dx.doi.org/10.7554/eLife.04415.015To quantify this effect, we co-transfected pMT-Dx with pMT-N, causing an increase by a factor of 4.21 (p = 0.0021) in the Notch activation compared with transfecting pMT-N alone (Figure 4F). Transfection of pMT-N, pMT-Dx, pMT-GAL4, and pUASt-Ser significantly (p = 0.0194) reduced the level of Notch activation (Figure 4F). We next treated cells with dsRNA for either lgd or shrub (a component of the ESCRT-III complex). Lgd dsRNA induced an increase in Notch activation by a factor of 1.73 compared with GFP dsRNA-treated cells (p = 0.00286) (Figure 4G). Likewise, shrub dsRNA caused a 3.93-fold increase (p < 0.0001) in Notch activation in S2 cells (Figure 4H) (Thompson et al., 2005). Expression of Ser in both situations led to a significant decrease in the amount of Notch activated in comparison with Notch-expressing cells treated with control dsRNA (lgd p = 0.0093, shrub p = 0.0257) (Figure 4G,H).To explore whether cis-acting ligands might block endogenous raised levels of ligand-independent Notch activation, in addition to the raised levels induced by genetic defects, we examined the effect of increased ligand expression in crystal cells in the larval lymph gland, which have recently been shown to have ligand-independent Notch activation (Mukherjee et al., 2011). Notch activity in crystal cells promotes cell survival, and decreased Notch activity leads to a ‘bursting’ phenotype (Mukherjee et al., 2011) (Figure 4—figure supplement 2B,E). Evidence for this bursting phenotype is provided by the disorganization of membrane-associated GFP (Mukherjee et al., 2011). Using Lozenge (Lz)-GAL4, a crystal cell lineage-specific driver (Terriente-Felix et al., 2013) to misexpress UAS-Notch or UAS-Ser led to a significantly higher proportion of cells showed the ‘bursting’ phenotype than wild-type crystal cells (Notch p = 0.0434, Ser p = 0.0286) (Figure 4—figure supplement 2A,B,E). Furthermore, overexpression of UAS-Ser led to a significant decrease of the Notch reporter E(spl):mβ-CD2expression in mature crystal cells (Figure 4—figure supplement 2C,D,F). Reduced Notch reporter activity was not caused by indirect effects on early ligand-dependent Notch signaling in prohaemocytes, as Hnt, a Notch target in differentiating crystal cells, (Terriente-Felix et al., 2013) was unaffected by ligand misexpression (Figure 4—figure supplement 3A,B). These observations indicate that increased ligand expression in crystal cells decreases cell survival by blocking Notch ligand-independent activation, and therefore the buffering role of cis-expressed ligand can be extended to endogenous cases of DSL-independent Notch activity.
Figure 4—figure supplement 2.
Endogenous DSL-independent Notch activity in crystal cells is reduced by cis-inhibition.
Lz-GAL4-driven green fluorescent protein (GFP) expression is an efficient marker of crystal cells which show a low incidence of bursting (A and E). Misexpressing UAS-Ser increased the frequency of witnessing bursting crystal cells (see arrowheads in B) (B and E). Lymph glands were counted for each genotype (n = 14 for lz > GFP, n = 12 for lz > GFP; UAS-Notch, and n = 14 for lz > GFP; UAS-Ser). Welch's t-test was used to assess significance between wild-type (WT) lymph glands and each of the experimental groups (p = 0.043 and p = 0.029, respectively). To determine whether Ser-misexpression induced ‘bursting’ was caused by the cis-inhibitory effect of Ser on ligand-independent Notch activation, we used the Notch activity reporter E(spl):mβ-CD2. We focused our analysis on larger crystal cells, which enter the endocycle as part of their differentiation (Terriente-Felix et al., 2013), and therefore are the ones most probably undergoing ligand-independent Notch activation. For illustrations, all GFP-positive cells were outlined and were filled in with differing shades of red corresponding to Notch reporter staining intensity. E(spl)mβ:CD2 is expressed in 55% of crystal cells and 77.4% of mature crystal cells (C and F). Misexpression of UAS-Ser significantly (p < 0.0001 for mature crystal cells, p = 0.0457 if all crystal cells were taken into account) reduced the fraction of crystal cells which show E(spl)mβ:CD2 expression, with 34.4% of all cells showing expression and 20.7% of mature cells showing CD2 expression (D and F). For this analysis, the total number of lz > GFP cells were counted, taking into account their size, lz > GFP intensity, and E(spl)CD2 intensity. Mature crystal cells were defined as cells that were both large and had intense lz > GFP. We then took the proportion of either all cells, or mature cells which had E(spl)CD2 staining for each lymph gland (n = 12 for lz > GFP, n = 13 for lz > GFP;UAS-Ser). Grubbs' outlier test was used, which removed one data point (p < 0.05) from the control, which had an unusually small number of crystal cells. Then Welch's t-test was used to assess significance between the mean proportions of crystal cells which showed Notch activity. All error bars represent SD. These observations indicate that increased ligand expression in crystal cells decreases cell survival by blocking Notch ligand-independent activation, and therefore the buffering role of cis-expressed ligand can be extended to endogenous cases of DSL-independent Notch activity. Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.014
Figure 4—figure supplement 3.
Reduced Notch reporter activity in crystal cells was not caused by indirect effects on early ligand-dependent Notch signaling in prohaemocytes.
Normal Hnt expression in crystal cells expressing green fluorescent protein (GFP) driven by lz-GAL4 (A) and in lz-GAL4 driving expression of UAS-Ser (B). There was no noticeable effect on the proportion of cells expressing Hnt when UAS-Ser was misexpressed. Illustrations show outlines of crystal cells with either no Hnt expression (white filling) or Hnt expression (red filling). Scale bars represent 20 μm.
DOI:
http://dx.doi.org/10.7554/eLife.04415.015
In this study, we show that cells devoid of DSL ligands activate Notch sufficiently to stimulate reporter activity, and in the ovarian follicle cells the level of activation is above the threshold required to mediate normal Notch-induced downstream developmental events. During development, this type of noncanonical Notch activity is normally prevented by cis-expressed DSL ligands in numerous tissues. Cis-inhibition can also attenuate DSL-ligand independent Notch activity both in endogenous and genetically induced situations. Mechanistically, this could be explained if DSL ligands sequestered Notch at the membrane, made Notch more sensitive to degradation, or increased the stability of the heterodimer as it travels through the endosomal pathway. As we and others (Fiuza et al., 2010) have shown that increasing or decreasing ligand has variable effects on receptor distribution among tissues, and given that we observe a consistent effect among tissues on Notch activation upon cis-ligand removal, we prefer the stability hypothesis. Fiuza et al. (2010) show that ligand affects Notch stability during Notch activation by EDTA, giving support to the stability hypothesis as the most parsimonious explanation (Fiuza et al., 2010). It is suggested that retaining a pool of translated Notch receptor keeps the pathway in a condition capable of almost instant activation (Sprinzak et al., 2010). Therefore, we propose that a role of cis-ligands might be to keep the Notch pathway in a state of readiness by buffering against unintentional stochastic Notch activity resulting from normal processing through the endosomes. Endogenously, this may aid the ability of a cell to mediate future Notch-dependent developmental events that have strict temporal regulation.
Materials and methods
Drosophila stocks and generation of clones
The following fly stocks were used for Drosophila crosses. hs-flp122;;FRT82B RFP (Poulton et al., 2011), FRT82B DlRevF10 (Haenlin et al., 1990), FRT82B DlRevF10SerRx82 (BDSC #6300), hs-FLP122; act-GAL4 UAS-GFP;FRT82B Gal80, UAS-NotchRNAi (VDRC #1112—no expression in germline cells), UAS-DeltaRNAi (BDSC #34322—able to express in germline cells); hsFLP GFPstau; act > y+ > GAL4, UAS-GFP, hs-flp122; Gal80 FRT40A; tubGAL4 UASGFP, Su(H)47FRT40A (Morel and Schweisguth, 2000), NRE-EGFP (BDSC #30727; Stempfle et al., 2010), ubx-FLP;;FRT82B RFP, patched-GAL4 UAS-GFP (Hinz et al., 1994), UAS-DlMyc (a gift from Marc Muskavitch), tsg101111019 from Kyoto stock center, UAS-SerWT (BDSC #5815), UAS-Serdel3−tom (a gift from Robert J Fleming) (Graveley et al., 2011), UAS-Deltex (a gift from Martin Baron), lgdd740A (BDSC #25087), dppGAL4 (BDSC #7007), lz-GAL4 UAS-GFP (BDSC #6314). To create FRT82B, DlRevF10 germline/follicle cell clones by the FLP/FRT or MARCM methods (Golic and Lindquist, 1989; Lee and Luo, 2001) (e.g., Figures 1B,D–F, 2A,C–D, Figure 1—figure supplement 2A–B), crossed flies were subjected to a 2 hr heat shock at 37°C for two consecutive days while in the mid-pupal to late-pupal stages. Flies were sorted three days after eclosion, and then kept for an extra three days at 25° before an additional 1-hr heat shock and incubation at 29°C with yeast paste for two more days before dissection. FLP-out-induced DlRNAi germline/follicle cell clones (e.g., Figure 2B, Figure 2—figure supplement 1A,B) were produced by two consecutive 50-min heat shocks, followed by incubation at 25°C for a week and then transfer to yeasted vials in the 29°C incubator for dissection two days later. Evidence for MARCM and FLP-out-induced germline clones was provided by small nuclei and late Cut expression, as the UASt-GFP transgene does not reliably express in the germline. Follicle cell clones alone were produced by two 50-min heat shocks, followed by two days’ incubation at 29°C (e.g., Figure 1C and Figure 2—figure supplement 1C–D). Imaginal disc FLP-FRT-induced mutant clones were produced either by a ubx-FLP or a 1-hr heat shock with hs-FLP122 two days after egg laying. All other crosses were kept at 25°C unless otherwise noted. In lymph gland studies, Grubbs' test was used to identify significant (p < 0.05) outliers, which were omitted from further analyses.
Immunostaining
Ovaries, imaginal discs, or lymph glands were dissected in phosphate-buffered saline (PBS), fixed in 10% formaldehyde, washed three times in PBS + Triton-X (PBT), and then blocked for at least 1 hr in PBT with goat serum. Tissues were then either stained overnight with mouse anti-Cut (DSHB 2B10, 1:30), mouse anti-Hindsight (DSHB 1G9, 1:15), mouse anti-NICD (DSHB C179C6, 1:15), mouse anti-NECD (DSHB C4582H, 1:15), mouse anti-Wingless (DSHB 4D4, 1:20), mouse anti-Dl (DSHB C594.9B, 1:15), rabbit anti-βGal (MP Biomedical, Santa Ana, CA. SKU #08559761), or rabbit anti-GFP (abcam, Cambridge, UK. ab290—NRE-GFP was co-stained with this antibody to increase reporter sensitivity) primary antibodies. Tissues were mounted on slides after PBT washes and secondary antibody incubation. 4',6-Diamidino-2-phenylindole (DAPI) was used to stain nuclei. Samples were then analyzed with a Zeiss 510 or Leica SP2 confocal microscope and after analysis with the Image J software. Nuclear volume quantification was done with the Volumest plug-in for ImageJ.
S2 cell transfection and RNA interference
S2 cells were grown under standard conditions and passaged once every three days in serum-free Gibco media (Invitrogen, Waltham, MA) supplemented with antibiotics. In preparation for transfection 106 cells per milliliter were seeded into either 24-well plates or 96-well plates for experiments with or without dsRNA treatment, respectively. Transfections were carried out with Qiagen Effectene (Qiagen, Netherlands) transfection reagent according to the manufacturer's instruction. Plasmids used for transfection were pMT-NotchFL (a gift from Renjie Jiao), pMT-GAL4 (DGRC #1042), pUASt-Serdel3 (a gift from Robert J Fleming), pMT-Deltex (a gift from Spyros Artavanis-Tsakonas), NRE-firefly luciferase (a gift from Sarah Bray), or Renilla luciferase (a gift from Sarah Bray). Aliquots (75 ng for 24-well plates or 50 ng for 96-well plates) of each non-luciferase plasmid were added and, where applicable, 10 ng of each luciferase plasmid. DNA concentration between transfections was kept constant with an empty vector. For experiments without dsRNA treatment, CuSO4 was added to a concentration of 500 µM 24 hr after transfection, and cells were assayed 24 hr later. dsRNA was transcribed in vitro using the RiboMAX large-scale RNA production system-T7 kit (Promega, Madison, WI). The following primers were used to amplify genomic DNA taken from a single male fly from the NRE-GFP stock:
Forward: GAATTAATACGACTCACTATAGGGAGCTGGACGGCGACGTAAACReverse: GAATTAATACGACTCACTATAGGGATGGGGGTGTTCTGCTGGTAGCells were treated with dsRNA at a concentration of 50 nM, and then transfected shortly after. CuSO4 was added to a concentration of 500 µM later that day. Cells were incubatedfor five days, with an additional treatment of dsRNA on the fourth day.
Luciferase assay
Cells were transfected with plasmids of interest together with an NRE-driving firefly luciferase expression and a constitutively activated Renilla luciferase to control for transfection efficiency. Luciferase measures were inspected with the Dual-Luciferase Assay Kit (Promega) in 96-well luminometer plates. Each transfection was performed in duplicate and repeated several times. Student's t test was used to test for statistical significance.eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.Thank you for sending your work entitled “Cis-interactions between Notch and its ligands block ligand-independent Notch activity” for consideration at eLife. Your article has been favorably evaluated by Diethard Tautz (Senior editor), a Reviewing editor, and 3 reviewers.The Reviewing editor and the reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.In general, all reviewers agreed that this is an imaginative paper that addresses an important issue. We would like to see this paper published if the authors address the issues raised by the reviewers.1) Repeatedly, in post review discussions, it came up that the paper was written in a confusing form in many places. To make this paper more understandable by the broad readership of eLife, it is essential that it is copyedited and simplified by the authors and perhaps in consultation with a non-Drosophila colleague. Also, many of the figures need to be improved.2) In the Abstract, the authors state that the paper is about the ligand-independent N activity in the ovary; however, the suggested mechanism of DSL-independent N activation (endosomal-dependent N regulation) is shown only in the wing disk. If this mechanism is to be extrapolated to explain how ligand-independent N signaling acts in the ovarian soma, the authors should at least show that “endosomal pathway mutant” follicle cells also have precocious N activation.3) Mosaic analyses in follicle cells provide evidence that these cells without both cis and trans ligand sources are still able to activate Notch through what is presumed to be a non-canonical pathway. It is not shown what the receptor does in these cells even though the consequences of its activation are well documented. I would have liked to see where the Notch receptor is under those conditions and presume that an immunocytological following of the Notch receptor could be informative. The conclusion that “Therefore, ligands expressed in the same cell as the Notch receptor have an endogenous role in buffering against DSL-independent Notch auto-activation” is too general and too strong and while this is possible it is certainly not conclusive. There are other roles that cis inhibition serves or indeed can serve.1) Repeatedly, in post review discussions, it came up that the paper was written in a confusing form in many places. To make this paper more understandable by the broad readership of eLife, it is essential that it is copyedited and simplified by the authors and perhaps in consultation with a non-Drosophila colleague. Also, many of the figures need to be improved.We have made substantial changes in the revision to clarify points that may have been a source of confusion before, especially for Figure 1 and the related writing, as it contains inherently complicated data (two cell types with a phenotype conditional on the clonal state of another). In order to increase the readability by non-Drosophila biologists, we have gone through the manuscript with non-specialists who have helped us to locate areas which may not be clear, and have attempted to clarify these points. For example, we added a figure to show the schematic drawing of oogenesis, which shows where the follicle cells and germline cells are located. We also include a WT wing disc stained with Wg for comparison and label regions of interest on this disc (i.e., Notum region, hinge region, DV boundary, wing pouch) which we refer to in the text.2) In the Abstract, the authors state that the paper is about the ligand-independent N activity in the ovary; however, the suggested mechanism of DSL-independent N activation (endosomal-dependent N regulation) is shown only in the wing disk. If this mechanism is to be extrapolated to explain how ligand-independent N signaling acts in the ovarian soma, the authors should at least show that “endosomal pathway mutant” follicle cells also have precocious N activation.Several earlier studies have reported that different trafficking mutants such as Su(Dx) (Wilkin et al, 2004), tsg101 (Vaccari et al, 2008), and lgd (Schneider et al, 2013) show precocious Notch activation in the follicle cells. We have added a sentence that makes these past results of others more explicit, and also added an example figure showing early Notch activity in tsg101 mutant follicle cells.3) Mosaic analyses in follicle cells provide evidence that these cells without both cis and trans ligand sources are still able to activate Notch through what is presumed to be a non-canonical pathway. It is not shown what the receptor does in these cells even though the consequences of its activation are well documented. I would have liked to see where the Notch receptor is under those conditions and presume that an immunocytological following of the Notch receptor could be informative. The conclusion that “Therefore, ligands expressed in the same cell as the Notch receptor have an endogenous role in buffering against DSL-independent Notch auto-activation” is too general and too strong and while this is possible it is certainly not conclusive. There are other roles that cis inhibition serves or indeed can serve.We have included figures of Notch distribution in different stages of oogenesis in Dl-/Dl- clones, and noted that we did observe Notch accumulation, consistent with other cases of ligand-independent Notch activation. From the comments, we are not sure whether “an immunocytological following” also refer to a pulse-chase experiment (i.e. pulse with NECD antibody then chase for varying amounts of time before fixation and secondary antibody wash), this technique, although it works in the imaginal disc, has not been successful in the follicle cells, which was noted in Yan et al, 2009, Dev Cell 17. We agree with the reviewer that the conclusion we made on cis-inhibition might be too general and too strong. We therefore have reworded this to the following: “Therefore, we propose that a role of cis-ligands could be to keep the Notch pathway in a state of readiness by buffering against unintentional stochastic Notch activity resulting from normal processing through the endosomes.”
Authors: Brenton R Graveley; Angela N Brooks; Joseph W Carlson; Michael O Duff; Jane M Landolin; Li Yang; Carlo G Artieri; Marijke J van Baren; Nathan Boley; Benjamin W Booth; James B Brown; Lucy Cherbas; Carrie A Davis; Alex Dobin; Renhua Li; Wei Lin; John H Malone; Nicolas R Mattiuzzo; David Miller; David Sturgill; Brian B Tuch; Chris Zaleski; Dayu Zhang; Marco Blanchette; Sandrine Dudoit; Brian Eads; Richard E Green; Ann Hammonds; Lichun Jiang; Phil Kapranov; Laura Langton; Norbert Perrimon; Jeremy E Sandler; Kenneth H Wan; Aarron Willingham; Yu Zhang; Yi Zou; Justen Andrews; Peter J Bickel; Steven E Brenner; Michael R Brent; Peter Cherbas; Thomas R Gingeras; Roger A Hoskins; Thomas C Kaufman; Brian Oliver; Susan E Celniker Journal: Nature Date: 2010-12-22 Impact factor: 49.962
Authors: Clémence Bonnet; Sheyla González; JoAnn S Roberts; Sarah Y T Robertson; Maxime Ruiz; Jie Zheng; Sophie X Deng Journal: Prog Retin Eye Res Date: 2021-03-04 Impact factor: 21.198