Literature DB >> 25477930

Enterobacteria identification and detection of diarrheagenic Escherichia coli in a Port Complex.

Clarissa Frota Macatrão Costa1, Valério Monteiro Neto2, Bruno Rafael de Carvalho Santos3, Bruno Rafael Rabelo Costa1, Alexandre Azevedo4, Josilene Lima Serra5, Hermínio Benítez Rabello Mendes6, Adenilde Ribeiro Nascimento7, Mariana Bonfim Pinto Mendes3, Oliver Kuppinger8.   

Abstract

The Port Complex of Maranhão (PCM) is the second largest port complex in Brazil, receiving ships with large volumes of ballast water. To evaluate the microbiological quality of its waters, physicochemical parameters (pH and salinity), the number of coliforms (thermotolerants and totals), and the presence of enterobacterias and diarrheagenic Escherichia coli strains were analyzed. In order to identify the presence of E. coli virulence genes target regions of the stx, elt, est, aggR, CVD432, ipaH and eae nucleotide sequences were studied. The presence of totals and thermotolerants coliforms were positive. Analyzing the salinity parameter, a significant increase in total coliforms was observed during the rainy season. We identified the species Escherichia coli, Proteus mirabilis, Citrobacter freundii, Proteus vulgaris, Klebsiella pneumoniae, Klebsiella ozaenae, Morganella morganii, Enterobacter cloacae and Edwardsiella tarda. Out of the 51 E. coli isolated, two were positive for the elt gene and one was positive for the CVD432 sequence, features of enterotoxigenic and enteroaggregative strains, respectively. This study reveals that the PCM is contaminated by enterobacteria and diarrheagenic E.coli thus providing evidence regarding the risk of these bacteria being carried by ships to other countries, and draws attention to the input of fecal bacteria brought by ships in the port waters of Maranhão.

Entities:  

Keywords:  Escherichia coli; ballast water; coliforms; enterobacterias; microbiological analysis

Mesh:

Substances:

Year:  2014        PMID: 25477930      PMCID: PMC4204981          DOI: 10.1590/s1517-83822014000300026

Source DB:  PubMed          Journal:  Braz J Microbiol        ISSN: 1517-8382            Impact factor:   2.476


Introduction

Ballast water discharge in coastal waters is a great global concern. Ships can act as vehicles for the transportation of pathogenic and toxic species, which occurs primarily when there is sewage discharge near the port or coastal area where water is collected. To address this issue, the National Health Surveillance Agency (Agência Nacional de Vigilância Sanitária - ANVISA) completed an exploratory study for the identification and characterization of pathogenic agents in ballast water (ANVISA, 2003). This study examined nine brazilian ports, including the Port of Itaqui, which is part of the Port Complex of Maranhão, the second largest port complex in Brazil. To conduct microbiological analyses of water quality, indicator microorganisms, such as the total and thermotolerant coliforms, E. coli, Enterococci spp., and coliphages, are assayed (Bonilla ). Total coliform concentration is often used to measure water quality for recreational purposes and is correlated with the incidence of diseases among bathers (Bordalo, 2003; Noble ). Thermotolerant coliforms point to the level of faecal contamination and, therefore, suggest the existence of pathogenic bacteria (Bitton, 2005). These pathogenic microorganisms include the enterobacteria, which are responsible for 70% of the urinary infections and 50% of the septicaemias that affect humans (ANVISA, 2004). The most common species, E. coli, inhabits the gastrointestinal tract of humans and other endothermic animals, and although most of its strains are commensal, a portion of these strains are pathogenic, causing intestinal and extra-intestinal diseases, such as diarrhea and urinary infections (Picard ; Albertini, 2009). Previous studies have focused mainly on strains from clinical samples, but notably little is known about the presence of diarrheagenic E. coli in marine environments or, more specifically, in port waters, such as Albertini (2009). The identification of diarrheagenic E. coli using biochemical and serological tests is unreliable (Fialho, 2008). Therefore, several PCR tests have been developed to amplify the target regions present in virulence genes and identify strains of enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC), and enterohaemorrhagic E. coli (EHEC) (Toma ; Vidal ). In their study, ANVISA detected all of the microbiological indicators analysed, and although the vessel masters have declared open water exchange of ballast waters, as suggested by the International Maritime Organization (IMO), no exchange was observed in 86% of the ships (ANVISA, 2003). In light of this problem, the aim of the present study was to evaluate the microbiological quality of the waters of the Port Complex of Maranhão by quantifying the total and thermotolerant coliforms and identifying the enterobacteria and diarrheagenic E. coli. Furthermore, this study intended to determine the effects of salinity and seasonality on the number of total coliforms.

Materials and Methods

Area location and sampling

The Port Complex of Maranhão (PCM) is situated in the Bay of São Marcos, west of São Luís Island, Maranhão, Brazil. We selected three sampling points: Point 1 was near Alumar Port (02°40′42″ S/44°21′18″ W), Point 2 was close to the Vale and Itaqui Ports (02°33′9″ S/44°22′9″ W), and Point 3 was in front of Guia Beach (02°31′S/44°20″W). As a negative control, samples were collected in the Bay of São José (Caúra (P1-CN), Tapari (P2-CN), and Ponta Verde (P3-CN) beaches), east of São Luís Island, at a site opposite the port complex (Figure 1). The samples were collected in sterile flasks, 30 cm from the surface during high tide, at a distance of 100 to 200 m from the coast, between September 2008 and December 2009. We selected four months from the rainy season (February to July) and four months from the dry season (August to January) (Table 2). The samples were analyzed on the same day they were collected.
Figure 1

Location of the study area.

Table 2

Most probable number of total and fecal coliforms per sample (NMP/100 mL) of port water samples.

CollectionsP 1 (ALUMAR Port)P 2 (Vale and Itaqui Ports)P 3 (Guia Beach)



TotalsThermotolerantsTotalsThermotolerantsTotalsThermotolerants
September-08230230150093023036
October-08460-9 1-23-
April-094609311002107543
May-0911002424002902400240
June-0924001100240044240044
July-0924023240150240240
October-0993934604604315
December-092323110021029035
Location of the study area. Most probable number of total and fecal coliforms per sample (NMP/100 mL) of port water samples.

Salinity and pH measurement

To measure the salinity and pH, we used a portable brix refractometer (model 211, Mingda Co. Ltd.) and a Quimis pH meter (model Q 400A).

Determination of total and thermotolerant coliforms

The multiple tube fermentation method was used according to the methodology described in APHA (2005) beginning with 250-mL flasks and using lactose broth for the presumptive test and brilliant green and EC (E. coli) broth for the confirmation tests. The most probable number (MPN) of total and thermotolerant coliforms was calculated using the Hoskins table (APHA, 2005).

Cultivation and bacterial isolation

Coliforms

Aliquots of the positive tubes of brilliant green broth were collected and streaked onto MacConkey (MC) agar. Colonies with different morphotypes were collected and transferred into tubes containing tryptic soy agar (TSA) and incubated at 37 °C for 24 to 48 h for subsequent biochemical identification.

Salmonella

In parallel with coliforms analysis, for each sample point, a second cultivation method, indicated for Salmonella research, was performed according to the methods described in APHA (2005), with modifications. The samples were collected in 1000 mL bottles and aseptically filtered through filter papers, which were then placed in vials with 225 mL of buffered peptone water and incubated at 37 °C for 24 h. One millilitre of each sample was aseptically transferred into a tube containing nine mL of tetrathionate broth and incubated at 37 °C for 24 h. The culture was plated on Hektoen selective media. Next, morphologically different colonies were isolated in TSA for subsequent biochemical identification.

Biochemical identification

For biochemical identification, oxidase-negative bacteria were selected, and the colonies were subjected to 20 biochemical tests using the Bactray I and II Systems according to the manufacturer’s instructions (Laborclin). These results were analysed using the Bactray Software to identify the strains at a specific level.

Identification of diarrheagenic E.coli

For the PCR, the E. coli strains were subcultured on nutrient agar plates and inoculated into 1 mL of sterile water. Multiplex PCR was performed as described by Toma . Hot-start monoplex PCR was performed employing primers that amplified specific sequences of nucleotides in each virulence gene as illustrated in Table 1. The PCR reactions, at a final volume of 50 μL each, contained 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTP, 25 pmol of each primer and 2.5 μL of suspension from each strain. The reaction mixture (45 μL), covered with mineral oil was heated to 95 °C before adding the Taq-Polymerase (2.0 U in 5 μL of water with 1× PCR buffer). The thermocycling conditions included 30 cycles at 95 °C for 40 s, 40 s at the annealing temperature of each specific primer (Table 1), 72 °C for 40 s for the extension, with an initial denaturation at 95 °C for five minutes and a final extension at 72 °C for ten minutes.
Table 1

Description of the primers, markers used, amplicon sizes and annealing temperature.

DesignationSequence (5′-3′)GeneSize of the amplicon (bp)ReferenceAnnealing temperature
SK1CCCGAATTCGGCACAAGCATAAGCeae881Toma et al. 200365 °C
SK2CCCGGATCCGTCTCGCCAGTATTCG
VTcom-uGAGCGAAATAATTTATATGTGStx518Toma et al. 200350 °C
VTcom-dTGATGATGGCAATTCAGTAT
AL65TTAATAGCACCCGGTACAAGCAGGEst147Toma et al. 200356 °C
AL 125CCTGACTCTTCAAAAGAGAAAATTAC
LTLTCTCTATGTGCATACGGAGCElt322Toma et al. 200354 °C
LTRCCATACTGATTGCCGCAAT
IpaIIIGTTCCTTGACCGCCTTTCCGATACCGTCipaH619Toma et al. 200365 °C
IpaIVGCCGGTCAGCCACCCTCTGAGAGTAC
aggRkas1GTATACACAAAAGAAGGAAGCaggR254Toma et al. 200352 °C
aggRkas2ACAGAATCGTCAGCATCAGC
EaggfpAGACTCTGGCGAAAGACTGTATCCVD432194Toma et al. 200362 °C
EaggbfATGGCTGTCTGTAATAGATGAGAAC
Description of the primers, markers used, amplicon sizes and annealing temperature. The 1381-7 (ipaH), EDL 933 (stx), 042 (aggR and CVD432), 0691-3 (elt), 0361-1 (est) and E2348-6 (eae) reference strains, and the C-8 and C-15 (EAEC), and STEC (stx) strains were used as positive controls of E. coli virulence genes. They were provided by the Laboratory of Parasitic Biology of UNICEUMA and were sub cultured, grown and suspended in the same way as the strains of the study. For negative controls, sterile water was used. The PCR products were separated in a 2.0% agarose gel.

Statistical analysis

The relationship between the salinity and the number of total coliforms of port water samples was analysed using a simple linear regression. Using the paired t-test, the mean MPN values of the coliforms collected during the dry season and those collected during the rainy season were compared. The statistical software used was Statistica 7.0.

Results

Microbiological quality

The levels of thermotolerant coliforms in the water samples from the Port Complex of Maranhão were within the quality standards recommended by CONAMA Resolution 274/2000 (CONAMA, 2001), with the exception of one sample (P1, June 2009), which showed values above the limit established by the Brazilian legislation (1000 MNP/100 mL) for bathing waters. The mean value of the total coliforms was approximately four times higher during the rainy season than during the dry season, with mean values of 1287 and 370 MNP/100 mL, respectively (Table 2). This difference was statistically significant (p < 0.05), as illustrated in Figure 2, which also reveals a greater variation in the number of total coliforms during the rainy season.
Figure 2

Mean, standard deviation and standard error of the mean values of coliforms in dry and wet seasons (t = 2.523, p = 0.02, = 11 Gl).

Mean, standard deviation and standard error of the mean values of coliforms in dry and wet seasons (t = 2.523, p = 0.02, = 11 Gl). Samples from the Bay of São José (negative control) revealed no thermotolerant coliforms. In addition, no total coliforms were detected in Caúra (P1-CN), although total coliform values of 100 and 300 MNP/100 mL were observed in Tapari (P2-CN) and Ponta Negra (P3-CN), respectively.

Salinity and pH

The salinity of the Port Complex samples ranged from 14 to 35, with more than 70% of the samples with salinity less than or equal to 30; these values characterise the port waters as brackish (CONAMA, 2005). Regression analysis (Figure 3) revealed a moderately negative correlation (r = −0.63) between the total coliforms and the salinity. In contrast, the samples from the Bay of São José had the highest values of salinity, at 35, characterizing the water as seawater.
Figure 3

Regression between total coliform samples from the Port Complex and salinity (Salinity:Coliforms: r2 = 0.4033; r = −0.6350; p = 0.0110; y = 3490.439 - 101.5888*x).

Regression between total coliform samples from the Port Complex and salinity (Salinity:Coliforms: r2 = 0.4033; r = −0.6350; p = 0.0110; y = 3490.439 - 101.5888*x). The pH analysis showed variations between 6.76 and 8.21 for the port waters, which are within the range recommended by CONAMA Resolution 357/2005 for brackish waters (CONAMA, 2005). The pH analysis of the water samples from the Bay of São José showed values of 8.21.

Characterization of enterobacteria

Among the colonies of bacteria that were isolated, 105 colonies were identified, of which 98 were from the Port Complex and 7 were from the Bay of São José. The most frequently encountered species in the Port Complex of Maranhão was E. coli, which represented 51/98 (52.04%) of the isolates and was present in all of the samples collected, followed by P. mirabilis, with 16/98 (16.32%) of the isolates. Other enterobacteria identified included C. freundii, P. vulgaris, K. pneumoniae, K. ozaenae, M. morganii, E. cloacae, and E. tarda, representing 12, 6, 5, 4, 2, 1, and 1 of the 98 isolates (12.24%, 6.12%, 5.10%, 4.08%, 2.04%, 1.02%, and 1.02%), respectively. The species E. coli, P. mirabilis, C. freundii, P. vulgaris, K. pneumoniae, and K. ozaenae were found at the 3 sampling points (Table 3). Bacteria from the genus Salmonella were not detected.
Table 3

Enterobacteria species identified in samples.

CollectionsP 1 (ALUMAR Port)P 2 (Vale and Itaqui Ports)P 3 (Guia Beach)
September 08E. coliE. coliE. coli
C. freundiiK. ozaenaeC. freundii
P. mirabilisK. ozaenae
P. mirabilis
P. vulgaris
October 08P. mirabilisE. coliE. coli
C. freundii
November 08E. coliC. freundii-
E. tardaP. mirabilis
April 09P. mirabilisP. vulgarisE. coli
May 09E. coliP. vulgarisE. coli
P. mirabilisK. pneumoniaeE. cloacae
P. vulgaris
June 09P. mirabilisE. coli
M. morganiiE. coli
P. mirabilis
K. pneumoniae
July 09E. coliE. coliE. coli
P. mirabilisM. morganii
October 09E. coliP. mirabilisE. coli
K. ozaenaeK. pneumoniaeK. pneumoniae
P. mirabilis
December 09E. coliE. coli
K. pneumoniaeC. freundiiE. coli
Enterobacteria species identified in samples. In the samples from the Bay of São José, K. pneumoniae, E. cloacae, and P. mirabilis were identified. The multiplex PCR of the identification of the virulence genes was efficient in the amplification of target sequences as well as nonspecific fragments. However, performing PCR monoplex with the same primers, but modifying the thermocycling conditions (Table 1, Figure 4) exclusively amplified the specific fragments of the virulence genes.
Figure 4

DNA fragments amplified by PCR for the ipaH, elt, aggR, CVD 432 and est virulence genes. Ladder (1). Positive controls: ipaH (3), elt (5), aggR (6), CVD 432 (7), est (8). Positive strains of this study: 2- 9c (7) and 8–9c (8), positives for the elt gene; 5–6c (9) strain, positive for CVD 432. Ladder (10).

DNA fragments amplified by PCR for the ipaH, elt, aggR, CVD 432 and est virulence genes. Ladder (1). Positive controls: ipaH (3), elt (5), aggR (6), CVD 432 (7), est (8). Positive strains of this study: 2- 9c (7) and 8–9c (8), positives for the elt gene; 5–6c (9) strain, positive for CVD 432. Ladder (10).

PCR for the identification of the virulence genes

Out of the 98 colonies isolated from the samples of the port waters, 51 were specimens of E. coli. Three E. coli strains, representing 5.88% of the strains, tested positive for virulence genes. The target DNA region of the heat-labile toxin gene (elt), characteristic of enterotoxigenic strains, was amplified in two strains (3.92%). The CVD432 fragment was amplified in one other strain (representing 1.96% of colonies), characterized as an EAEC strain. None of the E. coli strains amplified the est, eae, ipaH, aggR and stx target DNA regions present in the enterotoxigenic strains, which produces heat-stable protein (ETEC), in the enteropathogenic (EPEC), enteroinvasive (EIEC), enteroaggregative (EAEC) and enterohaemorrhagic (EHEC) strains.

Discussion

This study is one of the first on the analysis of enterobacterias and pathogenic strains in port waters. The number of supply ships in the Port Complex of Maranhão have grown significantly in recent years. The subsequent increase in ballast water dumped by ships increases the plausibility that pathogenic enterobacterias and E. coli strains have thereby been dumped in the port water and/or are captured and transported by ships to other countries. The levels of coliforms were within the limits recommended by CONAMA Resolution 274/2000 in 98% of the samples (CONAMA, 2001); however, these values confirmed the biological contamination in the Maranhense Port Canal that had already been observed in a previous study (ANVISA, 2003). Although these water samples exhibited levels of coliforms that were below the legal limit, the risks of the microbiological contamination observed in the port canal should not be downplayed, as the sediment and the animals present there can concentrate microorganisms at much higher levels than those found in the water samples, thereby acting as a reservoir for coliforms (La-Liberte and Grimes, 1982). In that context, studies have indicated that much higher concentrations of coliforms are present in sand (Vieira ; Bonilla ) and oysters (Fernandez-Delgado ) in comparison to the seawater at the same beach. This increased concentration increases the risk of epidemic outbreaks that would greatly compromise the local economy and tourism. Remarkably, a sample with levels of thermotolerant coliforms above the limit was collected in June 2009 following floods that affected the state of Maranhão. It is noteworthy that this sample was collected in Alumar Port (P 1) near the Cachorros River, where enterotoxigenic E. coli were also identified. The fact that levels of thermotolerant coliforms exceeded the limits established by the legislation were not found in the Vale and Itaqui Ports (P 2) and at Guia Beach (P 3) in June 2009 may be related to the less isolated nature of these locations and the fact that they are more subject to tidal action. There was also a significant increase in the number of total coliforms in samples collected during the rainy season, possibly because the higher volume of water leads to an increase in the number of nutrients and a decrease in the salinity, favouring the survival of enterobacteria. The superficial drainage of rainwater has also been reported as a main factor responsible for deteriorating the microbiological quality of the water due to the washing off of human and animal excrements, particularly where there is no sewage treatment (Amaral ). Other studies have also shown an increase of bacteria in the water during the rainy season (Vieira ; Da Silva ). However, an improvement in the microbiological quality of the water was observed in relation to an increase in the salinity, similar to results that have been observed at urban beaches in Portugal (Bordalo, 2003). The increased level of coliforms during the rainy season (February to July) suggests that the contamination of the waters of the Port Complex of Maranhão may originate mainly in sewers and storm drains that are discharged into the rivers that empty nearby. Although seawater affects the survival of enterobacteria, the existence of latent forms of these pathogens, which remain viable and potentially virulent for extended periods in seawater (Grimes ), has been reported previously. The ability of E.coli to become dormant in salt water (Xu ) facilitates their survival in the ballast tanks of ships. Since the transfer of genes between organisms is known to occur in natural environments (Bitton, 2005), the possibility exists that the virulence genes of diarrheagenic present in the port waters may be transferred to other bacteria. The presence of enterobacterias and E.coli strains with virulence genes revealed the existence of pathogenic potential in water samples from the PCM. This fact suggests further studies in the rivers of the western region of São Luis Isle and in the ballast water of docked ships are needed in order to better understand the origin of this contamination. The microbiological analysis of edible marine organisms, such as oysters, in the coastal areas near the port complex is perhaps the best monitoring tool to prevent possible outbreaks of gastroenteritis caused by the ingestion of shellfish contaminated with pathogenic E. coli. The presence of E. coli with virulence genes in the PCM makes it possible that these bacteria are carried to other countries via the ballast water of ships, transferring virulence genes to the microbiota of their ports and, thereby, may cause epidemiological outbreaks in these places.
  11 in total

1.  Comparison of total coliform, fecal coliform, and enterococcus bacterial indicator response for ocean recreational water quality testing.

Authors:  R T Noble; D F Moore; M K Leecaster; C D McGee; S B Weisberg
Journal:  Water Res       Date:  2003-04       Impact factor: 11.236

2.  Microbiological water quality in urban coastal beaches: the influence of water dynamics and optimization of the sampling strategy.

Authors:  Adriano A Bordalo
Journal:  Water Res       Date:  2003-07       Impact factor: 11.236

3.  Prevalence and distribution of fecal indicator organisms in South Florida beach sand and preliminary assessment of health effects associated with beach sand exposure.

Authors:  Tonya D Bonilla; Kara Nowosielski; Marie Cuvelier; Aaron Hartz; Melissa Green; Nwadiuto Esiobu; Donald S McCorquodale; Jay M Fleisher; Andrew Rogerson
Journal:  Mar Pollut Bull       Date:  2007-07-03       Impact factor: 5.553

4.  Survival and viability of nonculturableEscherichia coli andVibrio cholerae in the estuarine and marine environment.

Authors:  H S Xu; N Roberts; F L Singleton; R W Attwell; D J Grimes; R R Colwell
Journal:  Microb Ecol       Date:  1982-12       Impact factor: 4.552

Review 5.  The fate of enteric pathogenic bacteria in estuarine and marine environments.

Authors:  D J Grimes; R W Atwell; P R Brayton; L M Palmer; D M Rollins; D B Roszak; F L Singleton; M L Tamplin; R R Colwell
Journal:  Microbiol Sci       Date:  1986-11

6.  Multiplex PCR assay for identification of human diarrheagenic Escherichia coli.

Authors:  Claudia Toma; Yan Lu; Naomi Higa; Noboru Nakasone; Isabel Chinen; Ariela Baschkier; Marta Rivas; Masaaki Iwanaga
Journal:  J Clin Microbiol       Date:  2003-06       Impact factor: 5.948

7.  Survival of Escherichia coli in lake bottom sediment.

Authors:  P LaLiberte; D J Grimes
Journal:  Appl Environ Microbiol       Date:  1982-03       Impact factor: 4.792

8.  [Drinking water in rural farms as a risk factor to human health].

Authors:  Luiz Augusto do Amaral; Antonio Nader Filho; Oswaldo Durival Rossi Junior; Fernanda Lúcia Alves Ferreira; Ludmilla Santana Soares Barros
Journal:  Rev Saude Publica       Date:  2003-08-20       Impact factor: 2.106

9.  Occurrence of Proteus mirabilis associated with two species of venezuelan oysters.

Authors:  Milagro Fernández-Delgado; Monica Contreras; María Alexandra García-Amado; Pulchérie Gueneau; Paula Suárez
Journal:  Rev Inst Med Trop Sao Paulo       Date:  2007 Nov-Dec       Impact factor: 1.846

10.  The link between phylogeny and virulence in Escherichia coli extraintestinal infection.

Authors:  B Picard; J S Garcia; S Gouriou; P Duriez; N Brahimi; E Bingen; J Elion; E Denamur
Journal:  Infect Immun       Date:  1999-02       Impact factor: 3.441

View more
  2 in total

1.  Prevalence of diarrheagenic Escherichia coli in animal products in Duhok province, Iraq.

Authors:  Z M Taha; N A Yassin
Journal:  Iran J Vet Res       Date:  2019       Impact factor: 1.376

2.  Antibiotic-Resistant Pathogenic Escherichia Coli Isolated from Rooftop Rainwater-Harvesting Tanks in the Eastern Cape, South Africa.

Authors:  Mokaba Shirley Malema; Akebe Luther King Abia; Roman Tandlich; Bonga Zuma; Jean-Marc Mwenge Kahinda; Eunice Ubomba-Jaswa
Journal:  Int J Environ Res Public Health       Date:  2018-05-01       Impact factor: 3.390

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.