Literature DB >> 25341966

Development of SNP markers for C57BL/6N-derived mouse inbred strains.

Kazuyuki Mekada1, Mayu Hirose, Ayumi Murakami, Atsushi Yoshiki.   

Abstract

C57BL/6N inbred mice are used as the genetic background for producing knockout mice in large-scale projects worldwide; however, the genetic divergence among C57BL/6N-derived substrains has not been verified. Here, we identified novel single nucleotide polymorphisms (SNPs) specific to the C57BL/6NJ strain and selected useful SNPs for the genetic monitoring of C57BL/6N-derived substrains. Informative SNPs were selected from the public SNP database at the Wellcome Trust Sanger Institute by comparing sequence data from C57BL/6NJ and C57BL/6J mice. A total of 1,361 candidate SNPs from the SNP database could distinguish the C57BL/6NJ strain from 12 other inbred strains. We confirmed 277 C57BL/6NJ-specific SNPs including 10 nonsynonymous SNPs by direct sequencing, and selected 100 useful SNPs that cover all of the chromosomes except Y. Genotyping of 11 C57BL/6N-derived substrains at these 100 SNP loci demonstrated genetic differences among the substrains. This information will be useful for accurate genetic monitoring of mouse strains with a C57BL/6N-derived background.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25341966      PMCID: PMC4329520          DOI: 10.1538/expanim.14-0061

Source DB:  PubMed          Journal:  Exp Anim        ISSN: 0007-5124


Introduction

C57BL/6 is the best-known inbred mouse strain and has been used as the genetic background for spontaneous and induced mutations. To produce knockout mice, embryonic stem (ES) cells derived from 129 mouse substrains were used initially to manipulate the mouse genome [19]; however, these substrains were not suitable for most biomedical studies, especially in immunology, neurobiology, and physiology [4, 13, 28]. Backcrossing to C57BL/6 mice is carried out frequently to generate congenic strains to facilitate phenotypic analyses, but this procedure requires additional cost and time. In addition, the targeted locus from the original ES cell genome remains in the congenic mice and may confound the results of studies using these animals [6]. Therefore, ES cells with a pure C57BL/6 genetic background are more useful for the generation of knockout mice. Recently, C57BL/6 mouse-derived ES cells were established in several laboratories. Importantly, ES cells derived from C57BL/6N mice maintained their pluripotency after homologous recombination [18, 25], and the methods used to generate germline-transmitting chimeric mice have been improved [5]. The International Knockout Mouse Consortium (IKMC) conducted large-scale mutagenesis to mutate all of the protein-coding genes in mice using gene trapping and targeting in ES cells [9, 22]. Since then, several mouse ES cells derived from the C57BL/6NTac strain have been used as standard ES cells for the production of mutant alleles [5, 18]. Moreover, the International Mouse Phenotyping Consortium has used the IKMC-targeted C57BL/6N ES cell clones to undertake the broad-based phenotyping of 20,000 mouse genes [2]. Since the 1950s, the C57BL/6 strain has diverged into several substrains, including two major groups, C57BL/6J and C57BL/6N. Currently, more than 20 inbred substrains derived from C57BL/6J and C57BL/6N mice have been established and distributed worldwide [1, 16]. The C57BL/6J strain has many specific single nucleotide polymorphisms (SNPs) that distinguish it from other inbred strains [17], and SNPs that can differentiate C57BL/6J substrains have also been identified [14, 32]. In addition, several phenotypic differences have been reported among C57BL/6J substrains [8, 20, 23, 24]. C57BL/6J-specific SNP information is useful for the genetic monitoring of mouse strains with a C57BL/6J-derived background and interpretation of phenotypic data. At least, 11 C57BL/6N-derived substrains exist and are commercially available. However, genetic variation among C57BL/6N-derived substrains, including C57BL/6NTac, which was used to generate the IKMC ES cells has not yet been verified. Previously, C57BL/6J-specific SNPs detected by comparing the reference C57BL/6J sequence [15] with other inbred mouse strains have been reported [7, 17, 26, 27, 29, 31]; however, C57BL/6N was not included in these SNP data. Recently, the Wellcome Trust Sanger Institute (WTSI) published whole genome resequencing data of 17 key mouse inbred strains including C57BL/6NJ, which enabled us to identify C57BL/6NJ-specific SNPs through comparisons with other inbred strains [10, 30]. In this study, we searched for SNPs specific to the C57BL/6NJ strain using the resequence database of the WTSI. Moreover, in light of the branching history of C57BL/6N-derived substrains, we found variation in the number of accumulated C57BL/6NJ-specific SNPs among the C57BL/6N-derived substrains, which can be used to differentiate the substrains.

Materials and Methods

Animals

SNP genotyping was conducted in 11 C57BL/6N and 7 C57BL/6J-derived inbred substrains available from different breeders and holders around the world (Table 1). As for the C57BL/6NJ, C57BL/6By, C57BL/6ByJ, and C57BL/6JEiJ strains, genomic DNA from one animal of each strain was obtained from The Jackson Laboratory Mouse DNA Resources (stock #005304, #000663, # 001139, and #000924, respectively; Bar Harbor, ME). As for the other strains, live mice or frozen tissue from two animals of the C57BL/6N-derived substrain and one animal of the C57BL/6J-derived substrain were used, respectively. Genomic DNA was extracted from the tail tips or kidneys using an Autogen NA-2000 automatic nucleic acid isolation system (KURABO Industries Ltd., Osaka, Japan) and/or a DNeasy Blood & Tissue Kit (QIAGEN GmbH, Hilden, Germany). All animal experiments were conducted in accordance with the Regulations for Animal Experiments of RIKEN (October 1, 2003 Rule No. 129, last amendment on March 31, 2008 Rule No. 29). Our experimental protocols, including those involving animals (Exp10-002), were approved by the Animal Experiments Committee of the RIKEN Tsukuba Institute.
Table 1.

C57BL/6 substrains investigated in this study

SubstrainSource
C57BL/6N substrainsC57BL/6NJThe Jackson Laboratory (Bar Harbor, MA, USA)
C57BL/6NCrSimSimonsen Laboratories, Inc. (Gilroy, CA, USA)
C57BL/6NTacTaconic Farm Inc. (New York, NY, USA)
C57BL/6NJclCLEA Japan Inc. (Tokyo, Japan)
C57BL/6NSeacKyudo Co. Ltd. (Tosu, Japan)
C57BL/6NCrlCrljCharls River Laboratories Japan, Inc. (Yokohama, Japan)
C57BL/6NCrlCharls River Laboratories International, Inc. (Wilmington, MA, USA)
C57BL/6NHsdHarlan Laboratories, Inc. (Indianapolus, IN, USA)
C57BL/6NCrSlcJapan SLC, Inc. (Hamamatsu, Japan)
C57BL/6ByThe Jackson Laboratory (Bar Harbor, MA, USA)
C57BL/6ByJThe Jackson Laboratory (Bar Harbor, MA, USA)

C57BL/6J substrainsC57BL/6JThe Jackson Laboratory (Bar Harbor, MA, USA) via Charls River Laboratories Japan, Inc. (Yokohama, Japan)
C57BL/6JJclCLEA Japan Inc. (Tokyo, Japan)
C57BL/6JJmsSlcJapan SLC, Inc. (Hamamatsu, Japan)
C57BL/6JEiJThe Jackson Laboratory (Bar Harbor, MA, USA)
C57BL/6JOlaHsdHarlan Laboratories, Inc. (Indianapolus, IN, USA)
C57BL/6JRccHsdHarlan Laboratories, Inc. (Indianapolus, IN, USA)
C57BL/6JBomTacTaconic Farm Inc. (New York, NY, USA)

Nomenclatured strain names of each C57BL/6 substrain were in accordance with JAX® NOTES [16].

Nomenclatured strain names of each C57BL/6 substrain were in accordance with JAX® NOTES [16].

In silico selection of informative SNPs for C57BL/6NJ

Informative SNPs were selected from the public SNP database at the Mouse Genome Project, WTSI (http://www.sanger.ac.uk/sanger/Mouse_SnpViewer/rel-1303), by comparing the sequence data of C57BL/6NJ with that of the C57BL/6J reference strain. SNPs marked with a “high confidence” call on the database were extracted, and then candidate C57BL/6NJ-specific SNPs were selected through a comparison with sequence data from the 12 other inbred mouse strains in the database (129P2/OlaHsd, 129S1/SvImJ, 129S5/SvEvBrd, A/J, AKR/J, BALB/cJ, C3H/HeJ, CBA/J, DBA/2J, LP/J, NOD/ShiLtJ, and NZO/HlLtJ).

Experimental confirmation of SNPs and genotyping

To confirm whether the in silico-selected C57BL/6NJ-specific candidate SNPs were present in mouse DNA samples, the SNP loci of the C57BL/6NJ and C57BL/6J strains were genotyped by PCR and direct sequencing. Target regions containing the candidate SNPs were amplified by PCR with flanking primers designed by using BatchPrimer3 v1.0 (probes.pw.usda.gov/batchprimer3/index.html). PCR was performed using a QIAGEN multiplex PCR Kit (QIAGEN GmbH) according to the manufacturer’s protocol. The PCR products were electrophoresed and separated on an E-Gel CloneWell 0.8% SYBR Safe gel using an E-Gel iBase Power system (both from Life Technologies, Carlsbad, CA). Sequencing reactions were performed in a DNA Engine® and Dyad™ PTC-220 Peltier Thermal Cycler (Bio-Rad, Laboratories, Inc., Hercules, CA) using an ABI BigDye® Terminator v3.1 Cycle Sequencing Kit with AmpliTaq DNA polymerase (Life Technologies), following the protocols supplied by the manufacturers. Single-pass sequencing was performed on each template primer. The fluorescently labeled fragments were purified from the unincorporated terminators with an ethanol precipitation protocol. The samples were resuspended in distilled water and then subjected to electrophoresis in an ABI 3730 × l sequencer (Life Technologies). After the SNPs were confirmed in both strains, the other C57BL/6 substrains were genotyped by the same method. The flanking primers used for each SNP typing are listed in Table 4.
Table 4.

Position of the 100 selected SNP loci and their flanking primer sequence

LocusNo.dbSNPIDChromosomePosition (bp)(GRCm38)C57BL/6JalleleC57BL/6NJalleleFlanking primer sequence (5’ to 3’)

Forward primerReverse primer
1rs246236360111,996,705C/CT/TACCCCCTGAACCTTCAATTCTTTCCCATGGAATTCTGCTC
2rs246490354114,344,561T/TA/AGGGGAAGAGTGGGATGACTATGGTCAGCATATTCCAGTGC
3rs212521754116,968,405C/CA/AGCAACGAAGGAAATTGAAGCTGTTGAGGCATGTCCCTTTT
4rs227394849119,544,960A/AT/TGGGCAGAACTTCCTTTTCCTTCTCACCTGAGTCCCTGGAT
5rs232920323121,639,642C/CG/GGAAATAGCACAGGTCCATCAAACCCAGCAGACAAGAGACAAA
6rs213024334130,167,141C/CT/TGGAATCTCAACCTAAGCAGCATGGAAAATTGAAGCAACCAG
7rs244794780140,107,883T/TA/ATCTGTTGCTCTCCAGCATTGCTACACCCTGGCCTGACACT
8rs260670033150,146,448C/CT/TAGCAGAAATGCCAAAATGCTTCAGACCCAAAAGGACATGC
9rs249907793161,950,812C/CA/ACCAGTGGGTTAAGTGGGATTATCAAATGGGGTGGCATTTA
10rs265151779183,182,637G/GA/AATTCTGCTAACTGCGGAGGATTGTTCACCCTCTTCCCCTA
11rs229124202189,861,338G/GT/TGGAAGGCAGATCACCAACTCTCTATGGTGGCCCTAGGATG
12rs237656339199,547,673G/GA/ATGGCTCCTGACATCTTTCCTGCTCCTGGATCGGCATATTA
13rs2235407541110,024,886G/GC/CGACCAAATGCCTTGAAAATGACTCTCCCCATCCCTTTTCTT
14rs2596836381119,116,297C/CT/TAGGTCTTGGGCTCTTTAGGGACTTGCTGGCTGACTCCTTC
15rs2299112891132,980,179T/TA/ATTTTATTTCCTCCGCATTGGACTCGGGAACACACAAGCTC
16rs2156227031142,008,378C/CA/ATTTTTGTGTTGGCCAAGGATCCTTTCTCTTCAGAGGGGTTTT
17rs2390173981154,474,620C/CT/TCAGATCCCGGCTCAATTTTAAGCTCATTAGCCTGGCATGT
18rs2142540721161,859,644C/CT/TGTTTGCTCCTCCCCCTACTCTGTATGAAAATGTGCAGGTTCTG
19rs2559148941172,611,934G/GA/AATGCCGGTGTACCTTCAGAGCCCCAGTAACCATTCTCCTG
20rs2223038181179,503,532G/GA/ACTGCCCATACTCCTGTCCATAGGGCCTGGTACTGAGAACA
21rs2622826751188,434,376A/AT/TACCCTTTGATGGTTCCCATTAATTTTGCTAGGCCCATGAAT
22rs251979693211,214,185C/CT/TCCCCACATTTGCTTATCCAGGCCAATTGTGAGGAATGCTT
23rs230600693221,681,174G/GT/TGGTCCAGCATTATTGGCATTGTGATCCCATCTGCCATCTT
24rs242780245230,188,489A/AC/CCCACTGTCACCAGCACATTCCCACCACTCCTCTCCGAATA
25rs228546410241,205,764T/TA/AATGCCCACAATGCAAACATATAGCCCCTCTGACTGTCCAC
26rs254996546251,969,852C/CT/TCCGTGACCAAGTATGCACAG GCTGAGGGTTCAGTTGTGGT
27rs256541267270,251,451C/CT/TCTGAAGAAAGGCCTGTTTGGCGAATTCAATGCTGCCAATA
28rs248280077280,873,138C/CT/TTGTGCCGATTCCTCTAGCTTCTGCACCAATTAGCAGCAA
29rs214356625296,674,180G/GT/TGTGTATGCCCCCAACCTTTACCAGTGATTGCATTTCACCTT
30rs2243445632102,710,505A/AT/TCAGGACAGGAGAGGGTCAAGATCCCAGGCCATAGGATTTT
31rs2519335042112,966,408T/TC/CGCTCGGTCTGAAAGGTCAACGGAAGCAAGAGCTTGGAAGA
32rs2585082212122,708,738T/TA/AACTTTGTGCCTTTTGCAACCGAGGGGGATCCAAGGATAAG
33rs2550141102132,432,999C/CT/TCAGCACAGATGGTTTCATGGAGATGCACAAGTGGCTCTGA
34rs2424139242140,793,056T/TG/GAAATTTTCTTCCCCACAGCAGTGAGCCAGTACAGGGGAGA
35rs2174437742152,781,403A/AG/GCTCTTCTTCCTGCCCTTCCTAGCCATTGAGTGAGGTGCTT
36rs2532121972164,813,748C/CT/TCTGAACTGCAACCCTCATCAAGTGTAGCCCTCCCTGTCCT
37rs2133762332170,240,435G/GA/AGCTAAGTGGTCTTGGGATGCGCCACCACACACAGCTAATTT
38rs2647192472180,149,012A/AG/GTTCTGCTAGGCTTCCTGGTGCTCCCTCACAACAGGCTCAT
39rs2215213922181,868,891C/CT/TTCTTTTTGCCTCTTGTTGGAACGTGCTTGTGAGCTCTCTGA
40rs25652080938,498,163G/GA/ATGGCAGAAGTTTGTTTCAGGCCATCTGGGGCTGAATACTT
41rs214801792332,773,111G/GC/CTGCTGGGGTAGTTTTCCACTGGAGGGAGTCAGGTGCAATA
42rs222821429366,305,330C/CT/TCACCCAACACCCACAGAGTATGTCTTTTCAAAGGGCCAGA
43rs243656799372,616,062G/GA/ACCCATTGGACACGAAAACTTCACTGCTGCTCATTGGTTCA
44rs2628279303109,597,274A/AT/TGGCAGTTTGGCCTGTAGGTACTTTACTGGCTTGCCTCACC
45rs2541452193147,657,255C/CT/TCAGCAGGATATGCGTCCTCTGCTTCCCCTCCCATAATTTC
46rs219227155419,328,298T/TC/CACACAAGAACTGGCACATGGTTGGGACCTGTCAGCCTATC
47rs235104023456,463,984C/CT/TAGCAGTTGGTGTGTTTGCTGCCCCCATTGCTTTGTGTCTA
48rs2618792874104,973,294T/TG/GGACGAGGGAAAATGAGTGGACAAATGGCATGTTCGTTTGA
49rs256724446535,701,259G/GA/AATTCATTCCTGACCCATCCA CTTCCTCAATTCCCCTCCAT
50rs260260338580,026,465G/GA/ATGGGGAAAGAATGTGCCTACTTGGTCCAACATCAAACTACCTT
51rs2172979945117,118,668G/GA/ACCAAGGAGCAGCCCTACTAACAACTCCTGGTCAACGCTCT
52rs2219906685150,224,989G/GT/TCTTGTAGAACCCAGGCCATC GTCCCCACCCATTACATCAG
53rs257294810639,971,164G/GA/AGCATTCAGCTCTCCTTCCTG GAGACCTGGGCACAATGACT
54rs224069095674,169,211C/CA/ACTCATCATGACACAAGGAGCACATGTGTGGCCCCTAGTTCT
55rs375404556113,159,679G/GA/AATTCCTGGCCAGCCTTAGAT TGTTGGTGAGAGTCCTTCCA
56rs2175440766144,513,005G/GC/CCACACATCCATCTGCCTCTG GCAGCCGGAGTATTAGCAAG
57rs212452109716,595,985A/AT/TGAGTTCAATCCCTGGGACAAGTGTCACTGTGGCTGGCTTA
58rs224103578753,390,545C/CT/TGGAGGGAATGTGTCAGTAACGCCTGACCTCAGTGTGCAGAA
59rs2435755097102,973,309C/CT/TTCATCACAGGAGGGAAGAGGGGCTATCTGTCGTCCTTTGC
60rs2293401857140,821,590A/AT/TCTTCAGGCCCTTCACGAGTAGATTCCTATTGGCTGGCTTG
61rs263791105822,903,742G/GA/ACGAATGTGCATTTGTCATCCGCCCTTCCAACTACCTCACA
62rs255341040858,790,625G/GA/AGGCACTGTTTATCTTGGGAACTGCCAAACAGCACTCAGAAG
63rs239219835879,117,401G/GA/ATAAATGGCCCGAATTCACATTGTGCACCTTCCTTTGTTCA
64rs256624163894,046,068G/GA/ATCAGAGCCCACAGAAAAAGGCCATGGGTTTCACACATTCA
65rs2117501478118,442,679G/GA/ATCGGGGGCTTAATTTCTCTTTGCCTAGACCTGGATTTGGT
66rs52003732910,125,248T/TC/CTTCTCCCCTCTGTGAGCAAGTTGCCACCACCTCAAAAACT
67rs214490504960,662,109G/GA/ATCATCCCGGAACATAAATGGAGTCTCGCCAATACGACTGC
68rs2435001469116,160,235C/CT/TCAGAAGGATCCTGGACTTGC CTCTTATCTCCCCGCCAGA
69rs511230661011,070,460G/GT/TCAAGGCCCCTGTAAATCCTTCGAGGGCCTAGCATATTTCA
70rs2194899731041,944,745G/GA/ACCTCGGCTAACTTCAAGCACGCCTGTGCGCTTACTTTGAT
71rs2135838721049,357,252G/GT/TGTTGCACAGGCTGAGAATGACCCAAATGAATTGCAAAGGT
72rs2462742901088,091,833T/TC/CCACAGAACACAGGCTCCAAAGCCAACATGGTCGGTAGACT
73rs2238570791112,253,003A/AT/TCTGGTTTGGAGGTGAGCATT AAAAGCTCCGGAAGGTGAAT
74rs2406174011146,222,615G/GA/ATGACCCCCAATCACACATTAGCCAGCTTATCCATCTGCAC
75rs2316564571229,886,947T/TG/GTCTTGGTTAAGGTGGCAAGGATTCACAAATGTCGGCATCA
76rs2174227771270,772,479C/CT/TCCGGGAAAAACATACACACCACCCTGCTCTCCTTGACAAA
77rs2213454421297,702,669A/AT/TTCCTCTCACCCGTATCTGCTGCGTCTTCAGAGACCTTCTCA
78rs2263104241341,494,375G/GC/CCATCTCCATGGTGCTCGATATCCACAGTTCAGCCAAAGG
79rs2305964091364,921,972C/CT/TGGTGTTGACCATGAGCCTTCCTGGGGTGAGCTTAGGTCTG
80rs25150721713101,112,155A/AT/TCCCTGTACCGTCCAATCATCTTCTCCCCACCTCTGATGTC
81rs24299160913119,477,808C/CA/ATTTTGGCTGTGCAATTCTTGCACACAGAGGTCGCCTATCA
82rs2651932701439,164,780C/CT/TGGCCATCTCATCAGTGCATAAGGCTGACATGGTTTTGAGC
83rs2354286821475,727,727G/GA/AACATCTCCAGCTTCCAGACC GAGGCGGTGACTATGAAGGA
84rs22260727514117,850,332G/GA/ATTGTGGTTTCAGGAATGTCGGGCAAACTTCTTGCCTCAGA
85rs2432458031522,748,238T/TG/GTGTTTCCTGAGAGGGTTTGCTTTGGGAAAGACAAGGGAGA
86rs2434005121555,816,925C/CT/TTCAGAGGCTGAAGTGACAGCGGGCAGTCTGTCTGTGGAAG
87rs2313211251597,760,563C/CG/GCTCTCACGAGGACATGAGCAGGCTCCCCAGTAAAACATGA
88rs2302438641620,458,800C/CT/TTGGGGGCTTATCTTGTTCACACTTAACCACAAGCCCAGGA
89rs2409488961661,450,798G/GA/ATGGAGCATGACAAGGAATCATTTGCAAAATCCATGATTGG
90rs2400679571740,854,409C/CT/TTGCTCATGGTAAATGCTGGATCAGCACTCAGGTGATTTCC
91rs2591440331769,131,609C/CT/TCATGCACACGGCAGTAGAAGCAGAGGTGGAACCAGGAAGA
92rs2259637801822,530,101G/GT/TAGCGGTATGCTTGCTTTGATACAAGGGCCAAATATTGCTG
93rs2146383311841,344,993T/TC/CCTGCCAGATAAGCCACCAATTCACCAATGACAGAGCAAAAA
94rs2557892421859,519,801C/CT/TTTCCCCTAGCTTGGAAACCTTCTTTCCTGGAGTTGCCCTA
95rs2636879611890,448,757A/AG/GTTCCCATTGTGGTCATTGAATGAGCTAAATTTGGAGCAAGC
96rs2324143571923,329,888C/CT/TCAGCCCTCCCCTTTATCTTCGTATGCCCCTGTTGGGTCTA
97rs2306561701940,364,531G/GA/AAGCGCTCGCTTTGACATAATTGGGACAGGAGGAGGTTACA
98rs246037535X84,805,631C/CT/TCCCTAGGGCAACATGGTAAACATTCCGTGCAAATGAGATG
99rs266019057X112,095,948A/AG/GGGTGGCAGAGATGGAAACATCTGTCTTGCTTGGTCGCTAA
100rs212226666X157,445,480T/TA/ATGCACTTGCACATCCTACAGGGGGTTTGGGTTTTCATTTT

SNP: single nucleotide polymorphism.

Results

From the SNP database, 1,361 informative SNPs on all of the chromosomes except Y were screened, and the SNPs were able to distinguish C57BL/6NJ from the other 12 inbred strains in silico (Table 2). No informative SNPs on chromosome Y were found in the database. Among the informative SNPs, 486 candidate SNPs from chromosome 1–X were selected to include approximately 1 SNP locus per 10 Mb, and the genotypes of the selected SNP loci were examined by direct sequencing of C57BL/6J and C57BL/6NJ DNA samples. As a result, 315 SNP loci were sequenced successfully and 277 SNPs were confirmed to be specific to C57BL/6NJ. The genotypes of the remaining 38 SNP loci were not consistent with the data in the SNP database. According to the Ensembl Mouse Genome Server (www.ensembl.org/Mus_musculus/Info/Index), 10 of the 277 SNPs were nonsynonymous variant SNPs, such as missense or stop-gain variants, which were predicted to affect the amino acid sequence of the protein (Table 3).
Table 2.

Confirmation of C57BL/6NJ-specific SNPs by direct sequencing of PCR products

ChromosomeNumber of SNPsselectedNumber of SNPssequencedDirect sequencingsucceededConfirmedData discrepancy
1919167607
2989867616
3894528253
47418880
5641613112
67148211011
75716990
88213981
96812880
1061141082
115011880
128012770
138513981
145412981
155911880
166911770
176210440
186710880
19209541
X60161073

Total136148631527738

SNP: single nucleotide polymorphism.

Table 3.

Status of 10 nonsynonymous variant SNPs

dbSNP IDChromosomePosition (bp)(GRCm38)Linked geneC57BL/6JalleleC57BL/6NJalleleVariant typeof C57BL/6NJ allele
rs262569844589,775,351Adamts3C/CT/TMissense (Val199Ile)
rs2297125655112,762,721Myo18bC/CT/TMissense (Arg1935His)
rs2435755097102,973,309Olfr577C/CT/TMissense (Val228Ile)
rs2462742901088,091,833PmchT/TC/CMissense (Ile132Thr)
rs2406174011146,222,615Cyfip2G/GA/AMissense (Ser968Phe)
rs2388931571190,480,671Stxbp4C/CT/TMissense (Ala535Thr)
rs24299160913119,477,8084833420G17RikC/CA/AMissense (Thr484Lys)
rs2481576001470,586,204Fam160b2G/GT/TMissense (Ser575Arg)
rs2460334091511,336,383Adamts12G/GT/TMissense (Cys1518Phe)
rs2305964091364,921,972Spata31C/CT/TStop gained (Arg645Ter)

Information of the variant type was obtained from the Ensembl Mouse Genome Server.

SNP: single nucleotide polymorphism.

SNP: single nucleotide polymorphism. Information of the variant type was obtained from the Ensembl Mouse Genome Server. SNP: single nucleotide polymorphism. Next, 100 SNPs for genetic monitoring of C57BL/6N-derived substrains were selected from the 277 SNPs to include 1 SNP locus per 10–40 Mb to cover all of the chromosomes except Y (Table 4), and these SNPs were genotyped in the other 10 C57BL/6N and 6 C57BL/6J-derived substrains. All C57BL/6N and C57BL/6J-derived substrains were homozygous for these 100 SNP loci. In addition, when two samples from the same strain were genotyped in the C57BL/6N-derived substrains, they were found to be completely identical. The genotyping results for the C57BL/6J-derived substrains were consistent with the C57BL/6J reference sequence in the database. SNP genotyping demonstrated variation in the number of C57BL/6NJ-specific SNPs among the C57BL/6N-derived substrains (Table 5 ). Fourteen SNPs at Locus Nos. 10, 13, 14, 22, 30, 42, 44, 45, 54, 58, 63, 68, 84, and 93 were shared commonly, while the remaining 86 SNPs were only shared partly among the 11 C57BL/6N-derived substrains.
Table 5.

SNPs among C57BL/6 substrains

SNP: single nucleotide polymorphism.

Discussion

The relationship between the genealogy of the C57BL/6N-derived substrains used in this study and the number of the 100 C57BL/6NJ-specific SNPs in the substrains is summarized in Fig. 1. Milestones in the establishment of the strains were obtained from the product catalogs of the breeders and previous reports [14, 16]. The C57BL/6 strain was separated from the C57BL parental strain at the end of the 1940s and introduced to The Jackson Laboratory. A few years later, C57BL/6 mice were sent to the National Institutes of Health (NIH; Bethesda, MD) from The Jackson Laboratory, and the C57BL/6N mice were separated into the other C57BL/6N substrains, including the C57BL/6By strain, at different times. C57BL/6NCrSim mice from Simonsen Laboratories (Gilroy, CA) were derived from C57BL/6N mice at the NIH in 1995. C57BL/6NTac mice from Taconic Farms (New York, NY) were derived from the NIH Animal Genetic Resource at F151 in 1991. C57BL/6NJ mice were derived from embryos cryopreserved at the NIH in 1984. C57BL/6NJcl mice were introduced to the Central Institute for Experimental Animals (Kawasaki, Japan) from the NIH at F121 in 1978, and then transferred to CLEA Japan (Tokyo, Japan) at F146 in 1988. Charles River Laboratories (Wilmington, MA) obtained C57BL/6N mice from the NIH in 1974. The C57BL/6NCrl mice were further transferred to Charles River Laboratories Japan (Yokohama, Japan) at F101 in 1976, and since then, the mice have been distributed as C57BL/6NCrlCrlj. C57BL/6NSeac mice were introduced to Kyudo (Tosu, Japan) from the Charles River Laboratory Japan in 1981. C57BL/6NHsd mice were derived from a nucleus colony at the NIH in 1974. C57BL/6NCrSlc mice were introduced to the Institute of Medical Science, The University of Tokyo (Tokyo, Japan) in 1972 by Mr. Samuel M. Poiey, and then the mice were transferred to Japan SLC (Hamamatsu, Japan) in 1975. C57BL/6By (C57BL/6ByJ) mice were derived from the breeding stocks of Dr. Donald Bailey at the NIH in 1961.
Fig. 1.

Genealogy of C57BL/6N-derived substrains (left) and a bar graph for the number of C57BL/6NJ-specific SNPs (single nucleotide polymorphisms) (right). Abbreviations in the genealogy: N: National Institutes of Health; By: Dr. Donald Bailey; J: The Jackson Laboratory; Cr: National Cancer Institute; Jms: Institute of Medical Science, The University of Tokyo; Slc: Japan SLC; Crl: Charles River Laboratories; Crlj: Charles River Laboratories Japan; Seac: Kyudo; Hsd: Harlan Laboratories; Jic: Central Institute for Experimental Animals; Jcl: CLEA Japan; Sim: Simonsen Laboratories; Tac: Taconic Farm. Doted line: the year of introduction was unknown. Broken line: the strain was stored as frozen embryos. The C57BL/6NHsd and C57BL/6NCrl strains were derived independently from the NIH on unknown dates in 1974. On the right (bar graph), the number of C57BL/6NJ-specific SNPs of each C57BL/6N-derived substrain is indicated as a solid bar. The number of SNPs is also indicated at the right side of each bar.

Genealogy of C57BL/6N-derived substrains (left) and a bar graph for the number of C57BL/6NJ-specific SNPs (single nucleotide polymorphisms) (right). Abbreviations in the genealogy: N: National Institutes of Health; By: Dr. Donald Bailey; J: The Jackson Laboratory; Cr: National Cancer Institute; Jms: Institute of Medical Science, The University of Tokyo; Slc: Japan SLC; Crl: Charles River Laboratories; Crlj: Charles River Laboratories Japan; Seac: Kyudo; Hsd: Harlan Laboratories; Jic: Central Institute for Experimental Animals; Jcl: CLEA Japan; Sim: Simonsen Laboratories; Tac: Taconic Farm. Doted line: the year of introduction was unknown. Broken line: the strain was stored as frozen embryos. The C57BL/6NHsd and C57BL/6NCrl strains were derived independently from the NIH on unknown dates in 1974. On the right (bar graph), the number of C57BL/6NJ-specific SNPs of each C57BL/6N-derived substrain is indicated as a solid bar. The number of SNPs is also indicated at the right side of each bar. The number of C57BL/6NJ-specific SNPs in each C57BL/6N-derived substrain was well correlated with its branching date from the original C57BL/6N strain (Fig. 1). Each C57BL/6N-derived substrain, except C57BL/6NTac and C57BL/6NCrSim, could only share C57BL/6NJ-specific SNPs that had arisen before its branching from the original C57BL/6N strain. The oldest C57BL/6By and C57BL/6ByJ strains may well preserve the genotype of C57BL/6N in approximately 1961 and only share 14 SNPs with other later substrains. As for the C57BL/6NTac and C57BL/6NCrSim strains, they only shared C57BL/6NJ-specific SNPs that had arisen before the C57BL/6NJ mice branched from the original C57BL/6N strain in 1984. Eleven SNPs that were detected only in the C57BL/6NJ strain were assumed to have arisen in C57BL/6NJ after it branched from the C57BL/6N strain in 1984. In other words, we could determine retrospectively when the C57BL/6NJ-specific SNPs had arisen by comparing the branching history and accumulated C57BL/6NJ-specific SNPs in different C57BL/6N-derived substrains. Similar observations have been reported previously in C57BL/6J-derived substrains [14, 32]. The C57BL/6NCrlCrlj and C57BL/6NSeac substrains that branched directly from C57BL/6NCrl and C57BL/6NCrlCrlj, respectively, but not directly from the original C57BL/6N, had only 70 C57BL/6NJ-specific SNPs, which is less than that of C57BL/6NCrl (Fig. 1). This corresponds to the number of discontinuous distribution patterns of SNPs seen in Table 5. One possible explanation for the discontinuous distribution of SNPs is that the 9 SNP loci, Nos. 20, 32, 38, 46, 48, 52, 66, 70, and 72 (Table 5), were heterozygous just before the branching of the C57BL/6NHsd and C57BL/6NCrl strains in 1974. Then, the SNPs were independently fixed to either C57BL/6NJ type or C57BL/6J type in the subsequent inbreeding of each substrain. Finally, 6 SNP loci (Nos. 20, 38, 46, 48, 52 and 66) of C57BL/6NHsd and 8 SNP loci (Nos. 32, 38, 46, 48, 52, 66, 70 and 72) of C57BL/6NCrl were thought to be fixed to C57BL/6NJ type, while the 9 SNP loci of C57BL/6NCrlCrlj and C57BL/6NSeac were fixed to C57BL/6J type. Although there was no significant difference in the pattern of the 100 selected SNPs between C57BL/6By and C57BL/6ByJ, and C57BL/6NTac and C57BL/6NCrSim, informative SNPs that can be used to discriminate these substrains can be found by genotyping additional candidate SNPs in the future. In the selected 277 SNPs, 10 nonsynonymous SNPs were identified that were predicted to affect the amino acid sequence of the protein (Table 3). According to the Ensembl Mouse Genome Server, 4 of these 10 SNP variants, which occurred in the Myo18b, Olfr577, Cyfip2, and Adamts12 genes, were predicted to affect adversely each protein’s function. Notably, the Ser968Phe variant of Cyfip2 in C57BL/6N mice was reported recently by Kumar et al. [11]; this mutation destabilizes CYFIP2 protein and leads to acute and sensitized cocaine-response phenotypes. Although the C57BL/6N-derived substrains are closely related strains, such genetic differences would undoubtedly affect the phenotypes in various studies and interact with targeted mutations. Other phenotypic differences in behavior have been also reported among several C57BL/6N-derived substrains [3, 12]. As for the C57BL/6J and C57BL/6N strains, a relationship between genome variation and phenotypic changes has also been demonstrated [21]. In the future, advanced phenotypic analyses among the C57BL/6N-derived substrains will reveal novel functions of the genome variations detected among these substrains. All of the SNPs detected in this report, including several nonsynonymous SNPs, will also be instrumental in the accurate identification of the C57BL/6N-derived substrain status of mutant mice and avoid the incorrect interpretation of data due to background effects. Furthermore, the selected SNP markers will be useful for quickly producing congenic strains to move a targeted mutation from one C57BL/6N-derived substrain to another substrain. Hence, our findings will serve as useful markers for the accurate and sophisticated genetic monitoring of C57BL/6N-derived congenic strains.
  30 in total

1.  Genetic polymorphisms among C57BL/6 mouse inbred strains.

Authors:  Esther Zurita; Mónica Chagoyen; Marta Cantero; Rosario Alonso; Anna González-Neira; Alejandro López-Jiménez; José Antonio López-Moreno; Carlisle P Landel; Javier Benítez; Florencio Pazos; Lluís Montoliu
Journal:  Transgenic Res       Date:  2010-05-27       Impact factor: 2.788

2.  A comprehensive SNP-based genetic analysis of inbred mouse strains.

Authors:  Shirley Tsang; Zhonghe Sun; Brian Luke; Claudia Stewart; Nicole Lum; Melissa Gregory; Xiaolin Wu; Marianne Subleski; Nancy A Jenkins; Neal G Copeland; David J Munroe
Journal:  Mamm Genome       Date:  2005-07       Impact factor: 2.957

3.  A high-resolution multistrain haplotype analysis of laboratory mouse genome reveals three distinctive genetic variation patterns.

Authors:  Jinghui Zhang; Kent W Hunter; Michael Gandolph; William L Rowe; Richard P Finney; Jenny M Kelley; Michael Edmonson; Kenneth H Buetow
Journal:  Genome Res       Date:  2005-02       Impact factor: 9.043

4.  Gene-targeting studies of mammalian behavior: is it the mutation or the background genotype?

Authors:  R Gerlai
Journal:  Trends Neurosci       Date:  1996-05       Impact factor: 13.837

5.  A conditional knockout resource for the genome-wide study of mouse gene function.

Authors:  William C Skarnes; Barry Rosen; Anthony P West; Manousos Koutsourakis; Wendy Bushell; Vivek Iyer; Alejandro O Mujica; Mark Thomas; Jennifer Harrow; Tony Cox; David Jackson; Jessica Severin; Patrick Biggs; Jun Fu; Michael Nefedov; Pieter J de Jong; A Francis Stewart; Allan Bradley
Journal:  Nature       Date:  2011-06-15       Impact factor: 49.962

Review 6.  Behavioral phenotypes of inbred mouse strains: implications and recommendations for molecular studies.

Authors:  J N Crawley; J K Belknap; A Collins; J C Crabbe; W Frankel; N Henderson; R J Hitzemann; S C Maxson; L L Miner; A J Silva; J M Wehner; A Wynshaw-Boris; R Paylor
Journal:  Psychopharmacology (Berl)       Date:  1997-07       Impact factor: 4.530

7.  Variation in airway responsiveness of male C57BL/6 mice from 5 vendors.

Authors:  Herng-Yu Sucie Chang; Wayne Mitzner; Julie Watson
Journal:  J Am Assoc Lab Anim Sci       Date:  2012-07       Impact factor: 1.232

8.  Genetic modifiers of the phenotype of mice deficient in mitochondrial superoxide dismutase.

Authors:  Ting-Ting Huang; Mohammed Naeemuddin; Sailaja Elchuri; Mutsuo Yamaguchi; Heather M Kozy; Elaine J Carlson; Charles J Epstein
Journal:  Hum Mol Genet       Date:  2006-02-23       Impact factor: 6.150

9.  Embryonic stem cells derived from C57BL/6J and C57BL/6N mice.

Authors:  Yoko Tanimoto; Saori Iijima; Yoshikazu Hasegawa; Yuko Suzuki; Yoko Daitoku; Seiya Mizuno; Taichiro Ishige; Takashi Kudo; Satoru Takahashi; Satoshi Kunita; Fumihiro Sugiyama; Ken-ichi Yagami
Journal:  Comp Med       Date:  2008-08       Impact factor: 0.982

10.  Agouti C57BL/6N embryonic stem cells for mouse genetic resources.

Authors:  Stephen J Pettitt; Qi Liang; Xin Y Rairdan; Jennifer L Moran; Haydn M Prosser; David R Beier; Kent C Lloyd; Allan Bradley; William C Skarnes
Journal:  Nat Methods       Date:  2009-06-14       Impact factor: 28.547

View more
  15 in total

1.  High fat feeding unmasks variable insulin responses in male C57BL/6 mouse substrains.

Authors:  Rebecca L Hull; Joshua R Willard; Matthias D Struck; Breanne M Barrow; Gurkirat S Brar; Sofianos Andrikopoulos; Sakeneh Zraika
Journal:  J Endocrinol       Date:  2017-01-30       Impact factor: 4.286

2.  Methodology and theoretical basis of forward genetic screening for sleep/wakefulness in mice.

Authors:  Chika Miyoshi; Staci J Kim; Takahiro Ezaki; Aya Ikkyu; Noriko Hotta-Hirashima; Satomi Kanno; Miyo Kakizaki; Mana Yamada; Shigeharu Wakana; Masashi Yanagisawa; Hiromasa Funato
Journal:  Proc Natl Acad Sci U S A       Date:  2019-07-23       Impact factor: 11.205

Review 3.  Research-Relevant Conditions and Pathology of Laboratory Mice, Rats, Gerbils, Guinea Pigs, Hamsters, Naked Mole Rats, and Rabbits.

Authors:  Timothy K Cooper; David K Meyerholz; Amanda P Beck; Martha A Delaney; Alessandra Piersigilli; Teresa L Southard; Cory F Brayton
Journal:  ILAR J       Date:  2021-12-31       Impact factor: 1.521

4.  Substrains matter in phenotyping of C57BL/6 mice.

Authors:  Kazuyuki Mekada; Atsushi Yoshiki
Journal:  Exp Anim       Date:  2021-01-14

Review 5.  Attention to Background Strain Is Essential for Metabolic Research: C57BL/6 and the International Knockout Mouse Consortium.

Authors:  Danielle A Fontaine; Dawn Belt Davis
Journal:  Diabetes       Date:  2016-01       Impact factor: 9.461

6.  Nonphosphorylatable Src Ser75 Mutation Increases Ethanol Preference and Consumption in Mice.

Authors:  Goro Kato
Journal:  eNeuro       Date:  2019-04-05

7.  Genetic differences between C57BL/6 substrains affect the process of testis differentiation in YPOS mice.

Authors:  Toshifumi Yokoyama; Yuuka Miura; Anzu Yamamoto; Chinatsu Hasegawa; Kohei Kawanishi; Nanako Takada; Takuya Omotehara; Tetsushi Hirano; Yohei Mantani; Takanori Miki; Nobuhiko Hoshi
Journal:  J Vet Med Sci       Date:  2019-03-04       Impact factor: 1.267

8.  A comparative analysis of hepatic pathological phenotypes in C57BL/6J and C57BL/6N mouse strains in non-alcoholic steatohepatitis models.

Authors:  Eri Kawashita; Keiichi Ishihara; Madoka Nomoto; Mika Taniguchi; Satoshi Akiba
Journal:  Sci Rep       Date:  2019-01-18       Impact factor: 4.379

Review 9.  Immune Relevant and Immune Deficient Mice: Options and Opportunities in Translational Research.

Authors:  Enrico Radaelli; Sara F Santagostino; Rani S Sellers; Cory F Brayton
Journal:  ILAR J       Date:  2018-12-31

10.  A combination of genetics and microbiota influences the severity of the obesity phenotype in diet-induced obesity.

Authors:  Margarethe Smoczek; Marius Vital; Dirk Wedekind; Marijana Basic; Nils-Holger Zschemisch; Dietmar H Pieper; Anja Siebert; Andre Bleich; Manuela Buettner
Journal:  Sci Rep       Date:  2020-04-09       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.