Literature DB >> 25286984

Expression patterns of β-defensin and cathelicidin genes in parenchyma of bovine mammary gland infected with coagulase-positive or coagulase-negative Staphylococci.

Ewa M Kościuczuk, Paweł Lisowski, Justyna Jarczak, Józef Krzyżewski, Lech Zwierzchowski, Emilia Bagnicka1.   

Abstract

BACKGROUND: Mastitis is still considered to be the most economically important infectious disease in dairy cattle breeding. The immune response in mammary gland tissues could help in developing support strategies to combat this disease. The role of neutrophils and macrophages in the innate response of mammary gland is well known. However, the immune response in mammary gland tissues, including levels of antimicrobial peptide transcripts, has not been well recognized. Moreover, most studies are conducted in vitro, on cell cultures, or on artificially infected animals, with analysis being done within a several dozen hours after infection.The aim of the study was to examine the in vivo transcript levels of beta-defensin and cathelicidins genes in cow mammary gland secretory tissue (parenchyma) with the chronic, recurrent and incurable mammary gland inflammation induced by coagulase-positive or coagulase-negative Staphyloccoci vs. bacteria-free tissue.
RESULTS: The mRNA of DEFB1, BNBD4, BNBD5, BNBD10 and LAP genes, but not of TAP gene, were detected in all investigated samples regardless of the animals' age and microbiological status of the mammary gland, but at different levels. The expression of most of the beta-defensin genes was shown to be much higher in tissues derived from udders infected with bacteria (CoPS or CoNS) than from bacteria-free udders, regardless of parity. Cathelicidins (CATH4, CATH5 and CATH6) showed expression patterns contrasting those of β-defensins, with the highest expression in tissues derived from bacteria-free udders.
CONCLUSION: Increased expression of genes encoding β-defensins in the infected udder confirms their crucial role in the defense of the cow mammary gland against mastitis. On the other hand, the elevated cathelicidin transcripts in non-infected tissues indicate their role in the maintenance of healthy mammary tissues. The expression levels of investigated genes are likely to depend on the duration of the infection and type of bacteria.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25286984      PMCID: PMC4194403          DOI: 10.1186/s12917-014-0246-z

Source DB:  PubMed          Journal:  BMC Vet Res        ISSN: 1746-6148            Impact factor:   2.741


Background

Mastitis is defined as chronic, latent or acute inflammation of the mammary gland, and is still considered to be the most economically important infectious disease in dairy cattle breeding [1]. The economic consequences of both clinical and sub-clinical mastitis include reduced milk yield, poor milk quality, increase in animal culling, and cost of veterinary services and medicine. The main pathogens causing mastitis in dairy cattle are contagious Gram-positive bacteria, such as Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae and Streptococcus uberis [2-4]. The most common CoNS are Staphylococcus chromogenes, Staphylococcus hyicus, Staphylococcus warneri, Staphylococcus epidermidis and others [5]. Infection with major bacterial pathogens often leads to chronic asymptomatic inflammation, which persists throughout the animal’s life [6,7]. The contagious infection causes an increase in total somatic cell count (SCC) as a consequence of both leukocyte and epithelial cell numbers increasing, with or without clinical signs of mastitis. On the other hand, it is commonly believed that the environmental bacteria are less virulent than contagious ones, and are usually quickly eradicated by the host’s immune system [8,9]. However, opportunistic bacteria, such as coagulase-negative Staphylococci (CoNS) and Escherichia coli can also cause clinical and severe mastitis depending on cow factors (host defense status) [2-4]. The level of different antibacterial factors, such as lactoferrin, Natural killer cells, immunoglobulins, cytokines and many others rises dramatically during both clinical and sub-clinical inflammation [10,11]. β-Defensins and cathelicidins, among others, are the part of the antimicrobial arsenal of the leucocytes. As summarized by Bagnicka et al. [12] more than 20 β-defensins were found in cattle tissues, and several of them are expressed in the mammary gland. Until now, seven bovine cathelicidin genes with proved expression of peptides having the antimicrobial activity have been identified and some of them were found in milk from mastitic mammary glands [13]. However, Whelehan et al. [14] predicted the additional putative cathelicidin genes named CATHL8, CATL2L2 and CATHL9. These three genes had the highest similarity to cathelicidin3 gene. Results of QTL mapping studies indicate β-defensin gene clusters as candidate regions influencing the number of somatic cells in milk [15,16]. In addition, the studies conducted by Ryniewicz et al. [17,18], Wojdak-Maksymiec et al., [19,20] and Bagnicka et al. [21,22] showed associations between polymorphisms in β-defensin genes and SCC, which could be used in genomic selection against mastitis. Because resistance to mastitis has a genetic background, and genetic improvement is possible [15,23,24], the recognition of the immune response in mammary gland tissues could aid in developing support strategies to combat this disease. The role of neutrophils and macrophages in the innate immune response of mammary gland is well known [25]. However, the immune response in mammary gland tissues, including levels of antimicrobial peptide (AMP) transcripts, has not been well recognized [26]. Moreover, most studies are conducted in vitro, on cell cultures [27-31], or on artificially infected animals, with an analysis being done within several dozen hours after infection [32,33]. The Bovine Innate Immune Microarray, which comprised several defensin and cathelicidin genes among 1480 immune related genes, showed no differences in AMP genes expression upon the infection of the bovine mammary gland with Staphylococcus aureus [34]. Meta-analysis done by Genini et al. [35] reveled only cathelicidin antimicrobial peptide (CAMP) which increased upon mastitis infection. Therefore, the aim of the present study was to estimate the in vivo transcript levels of β-defensin and cathelicidin genes in cow mammary gland secretory tissue (parenchyma) with the chronic, recurrent and incurable mammary gland inflammation caused by coagulase-positive or coagulase-negative Staphyloccoci vs. bacteria-free tissue.

Results

Health status of mammary gland

No bacteria were found in 18 samples of milk. In the remaining 47 samples only bacteria from the Staphyloccocus genus were stated; in 25 samples they were coagulase-positive (CoPS) and in 22 they were coagulase-negative (CoNS). The highest average number of somatic cells (SC) and the lowest lactose content were found in milks containing coagulase-positive Staphyloccoci in lactations 3/4 (Table 1). For both types of infectious bacteria, as well as in groups with uninfected milk, the older animals (lactations 3/4) contained higher numbers of SC and lower levels of lactose than the younger ones (lactations 1/2).
Table 1

The average number of somatic cells and lactose content in groups of animals

Group N Trait
SCC Lactose [%]
Mean SD Mean SD
CoPS1/214305220893.970.98
CoPS3/414701434433.630.83
CoNS1/274474034.670.12
CoNS3/49392430914.081.12
H1/2947204.500.26
H3/495501834.410.42

SCC – somatic cell count.

SD - Standard deviation.

CoPS1/2 - coagulase-positive Staphyloccoci infected cows in 1st and 2nd lactations.

CoPS3/4 - coagulase-positive Staphyloccoci infected cows in 3rd and 4th lactations.

CoNS1/2 - coagulase-negative Staphyloccoci infected cows in 1st and 2nd lactations.

CoNS1/2 - coagulase-negative Staphyloccoci infected cows in 3rd and 4th lactations.

H1/2 - pathogen-free cows in 1st and 2nd lactations.

H3/4 - pathogen-free cows in 3rd and 4th lactations.

The average number of somatic cells and lactose content in groups of animals SCC – somatic cell count. SD - Standard deviation. CoPS1/2 - coagulase-positive Staphyloccoci infected cows in 1st and 2nd lactations. CoPS3/4 - coagulase-positive Staphyloccoci infected cows in 3rd and 4th lactations. CoNS1/2 - coagulase-negative Staphyloccoci infected cows in 1st and 2nd lactations. CoNS1/2 - coagulase-negative Staphyloccoci infected cows in 3rd and 4th lactations. H1/2 - pathogen-free cows in 1st and 2nd lactations. H3/4 - pathogen-free cows in 3rd and 4th lactations.

Expression of β-defensin genes

The transcripts of all studied β-defensin genes, except for TAP (tracheal microbial peptide) mRNA, were found in all investigated samples regardless of the animals’ age and microbiological status of the mammary gland, but at different levels. Two different pairs of primers previously used by Whelehan et al. [23] and Alva-Murillo et al. [29] to detect TAP mRNA in bovine mammary glands were used in the present study, but no expression of TAP mRNA was detected in the cows’ mammary gland parenchyma. Previously, these primers were used by us to amplify TAP sequences from the pooled bovine cDNA and gave the expected 151 bp and 216 bp amplification products. The expression of most of the investigated β-defensin genes was shown to be much higher in tissues derived from quarters with stated bacteria in milk (CoPS or CoNS) than in tissues from bacteria-free udders, regardless of parity (Figures 1, 2, 3, 4 and 5). The differences between CoPS vs. CoNS infections were found due to the expression of DEFB1, BNBD4 and BNBD5 genes, and only in tissues derived from the mammary glands of animals in their lactations 3/4 (Figures 1, 2 and 3).
Figure 1

Expression of β-defensin1 gene with its standard errors (SE). DEFB1 expression in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05

Figure 2

Relative expression of β-defensin4 gene with its standard errors (SE). Expression of BNBS4 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01.

Figure 3

Relative expression of β-defensin5 gene with its standard errors (SE). Expression of BNBD5 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05. **- means differ between parities at p ≤ 0.01

Figure 4

Relative expression of β-defensin10 gene with its standard errors (SE). Expression of BNBD10 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; a,b – means differ within parities at p ≤ 0.05

Figure 5

Relative expression of lingual antimicrobial peptide gene with its standard errors (SE). Expression of LAP in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05

Expression of β-defensin1 gene with its standard errors (SE). DEFB1 expression in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05 Relative expression of β-defensin4 gene with its standard errors (SE). Expression of BNBS4 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. Relative expression of β-defensin5 gene with its standard errors (SE). Expression of BNBD5 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05. **- means differ between parities at p ≤ 0.01 Relative expression of β-defensin10 gene with its standard errors (SE). Expression of BNBD10 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; a,b – means differ within parities at p ≤ 0.05 Relative expression of lingual antimicrobial peptide gene with its standard errors (SE). Expression of LAP in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05 In lactations 1/2 the levels of DEFB1, BNBD4 and LAP transcripts were ca. 12, 2.5 and 3-fold higher, respectively, in the CoPS infected tissues than in non-infected tissues (Figures 1, 2 and 5). The CoPS3/4-infected cows showed DEFB1, BNBD4 and LAP expression levels 3.5, 7 and 7-fold higher, respectively, than healthy ones (Figures 1, 2 and 5). Thus, the expression levels were roughly the same in tissues derived from udders infected with CoPS, regardless of the parity. When tissues infected with CoNS were compared to those derived from bacteria-free udders, the differences were revealed in the expression levels of DEFB1 and BNBD5 genes (Figures 1 and 4); in lactations 1/2 it was 9 and 5-fold higher, respectively. With cows in lactations 3/4 a 2.5-fold higher expression of LAP mRNA was stated in CoNS-infected vs. uninfected tissues. Only a few differences were shown in the expression levels of defensin genes between age groups of cows. In the animals infected with CoPS, the expression of the BNBD5 gene was twofold higher in tissues derived from the mammary glands of cows in lactations 3/4 than those that in lactations 1/2 (Figures 3 and 4). The opposite results were obtained for the BNBD10 gene; expression was 3-fold higher in groups of animals in lactations 1/2 than in 3/4 (Figure 2). Moreover, the expression of the DEFB1 gene was 3.5-fold higher in non-infected tissues derived from cows in lactations 3/4 than in 1/2 (Figure 1).

Expression of cathelicidin genes

Cathelicidins (CATH) showed expression patterns contrasting those of β-defensins (Figures 6, 7 and 8). For all CATHs the highest levels of mRNA were found in healthy tissues (except for CATH6 expression in 1/2 lactation group). Moreover, the expressions levels of CATH6 in both age groups were higher in tissues infected with CoNS than with CoPS (Figure 8). Differences between age groups were found only for the expression levels of CATH5 and CATH6 in bacteria-free tissues (Figure 7). The observed 3 and 4-fold differences between CATH4 expression in tissues infected with CoNS vs. CoPS in both age groups were not statistically confirmed, possibly because of the high standard errors (SE) for LSMEAN solutions (Figure 6). In general, much higher standard errors were found for solutions obtained for expression results of cathelicidins’ than for defensins’ genes. This testifies to the higher variability between individuals of cathelicidin vs. defensin genes’ expressions.
Figure 6

Relative expression of cathelicidin4 gene with its standard errors (SE). Expression of CATH4 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05.

Figure 7

Relative expression of cathelicidin5 gene with its standard errors (SE). Expression of CATH5 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; a,b – means differ within parities at p ≤ 0.05. *- means differ between parities at p ≤ 0.05.

Figure 8

Relative expression of cathelicidin6 gene with its standard errors (SE). Expression of CATH6 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05. **- means differ between parities at p ≤ 0.01

Relative expression of cathelicidin4 gene with its standard errors (SE). Expression of CATH4 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05. Relative expression of cathelicidin5 gene with its standard errors (SE). Expression of CATH5 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; a,b – means differ within parities at p ≤ 0.05. *- means differ between parities at p ≤ 0.05. Relative expression of cathelicidin6 gene with its standard errors (SE). Expression of CATH6 in secretory tissues of cow mammary gland infected with coagulase-positive or coagulase-negative Staphylococci compared to non-infected samples according to number of lactation; A,B – means differ within parities at p ≤ 0.01. a,b – means differ within parities at p ≤ 0.05. **- means differ between parities at p ≤ 0.01

Discussion

The samples used in the current study were parenchyma samples, and were not homogenous secretory tissues. Parenchyma consists of alveoli that are lined with milk-secreting (inner epithelial cells) cuboidal cells and surrounded by myoepithelial cells. In the samples the lactiferous ducts lined by a stratified squamous keratinized epithelium and blood vessels also occurred. However, the secretory cells are the major component of parenchyma during lactation. Until now there has been only limited information on β-defensin gene expression levels in parenchyma of mammary glands naturally infected with coagulase-positive or coagulase-negative Staphylococci. Most studies have focused on comparison of the cow mammary gland immune response to the bacterial infection caused by E. coli and S. aureus, which are the major pathogens in cowsmastitis. Moreover, most these studies were conducted in vitro on culture of cells derived from the mammary parenchyma. The results of the present study suggest that the expression of most β-defensin genes (except TAP) in parenchyma derived from healthy mammary glands is constitutive and on similar levels, regardless of gene and parity (Figures 1, 2, 3, 4 and 5). These findings confirmed the results of Tetens et al. [15], who reported a constitutive expression of DEFB1, BNBD4, BNBD10 and LAP, and those of Goldammer et al. [2] who detected expression of LAP, DEFB1, BNBD4, BNBD5, and BNBD10 in parenchyma from cow udders free from pathogens. It is noteworthy that Tetens et al. [15] also did not find the TAP gene transcripts in the mammary secretory tissues of healthy cows, which agrees with our results. However, in the study by Roosen et al. [36] TAP mRNA expression was detected in the healthy lactating parenchyma of the mammary gland, but only in one out of nine cows examined. The constitutive expression of β-defensin genes in other tissues of dairy cattle has also been proved. Until now, high expression of BNBD4 and BNBD5 genes was found in bovine alveolar macrophages, while the DEFB1 (EBD) gene was highly expressed in the distal small intestine and colon, and also in healthy calves [37,38]. Moreover, LAP gene transcripts were identified in tongue and tracheal epithelial cells of healthy bovines [39,40]. Several studies confirmed both the constitutive and inducible expression of β-defensin genes in cows’ mammary gland alveoli. For example, Roosen et al. [36] identified LAP transcripts in both healthy and mastitis-affected mammary gland tissue. It has been proved that the expression level of β-defensin genes depends both on the presence and on the type of the infectious bacteria. In the present study expression of all studied β-defensin genes (except for BNBD10) was significantly higher in infected than in healthy tissues (Figures 1, 2, 3, 4, 5 and 6). Our results also showed that the expression levels of DEFB1, BNBD4, and BNBD5 genes (Figures 1, 2 and 3) were higher in tissues infected with coagulase-positive Staphylococci (CoPS) than with coagulase-negative Staphylococci (CoNS), thus indicating that the organism’s reaction to infection may depend on the type of bacteria. However, in the case of BNBD5 this difference was evident only in older cows, being in lactations 3 or 4. Previously, both in vitro and in vivo studies of the mammary secretory tissues have shown high expression of the BNBD5 gene 84 h after infection with S. aureus, while in tissues infected with E. coli the reaction was almost immediate (after 24 h) [32,41,42]. Whelehan et al. [23] found higher DEFB1, BNBD4 and BNBD5 transcript levels in cows’ mammary gland parenchyma experimentally infected with S. aureus as compared to tissues derived from healthy udders. However, in contradiction to our results, they found no difference between LAP gene expression levels in infected vs. non-infected tissues – the discrepancy which could be explained by differences in the duration of infection; Whelehan et al. [23] measured the gene expression 30 days after infection, while our study focused on chronic and recurrent inflammation during lactation. However, the higher expression of LAP gene in CoPS- and CoNS-infected mammary parenchyma as compared to healthy tissue shown in the presented study confirmed the results of other authors [36,43], who also observed increased LAP expression in mastitis caused both by Gram-positive bacteria (Streptococcus uberis, S. aureus, and Corynebacterium species), and Gram-negative bacteria (E. coli). On the other hand, Günther et al. [27] pointed out that stimulated LAP gene expression did not correlate with the concentration of E. coli in the cultured mammary epithelial cells within 6 h after bacterial stimulation, because the relative copy number of LAP mRNA rose only ~25-fold over the control as compared to mRNA encoding immune effector serum amyloid A3 (SAA3), which increased 500-fold in the same period after stimulation. The highest differences in AMPs expression obtained in our study (in the naturally occurred, recurrent infections) were only ~12-fold between CoPS-infected and healthy tissues for β-defensin1, and ~19-fold between healthy and CoNS-infected tissues for cathelicidin4. Also noteworthy, the results obtained in vivo by Whelehan et al. [23] showed no more than a 27-fold change of BNBD5 in alveoli after 30 days of the bacterial challenge. Fu et al. [44], within 24 h, found 10-fold and almost 100-fold higher BNBD5 gene expression after the stimulation of the cultured epithelial cells derived from the mammary gland with S. aureus and E. coli, respectively. Under the same circumstances, the changes in TLR2 and TLR4 expression increased 2- and 8-fold after 3 h with the S. aureus and E. coli challenge, respectively. Furthermore, mRNA levels of cytokines, such as TNF-α (tumor necrosis factor α), IL-8 (interleukin 8) and IL-β (interleukin β) increased only about 10-fold after S. aureus stimulation, while they increased 100-, almost 100-, and more than 1000-fold, respectively, within 3–6 h after the challenge with E. coli. However, the expressions of IL-6 were less than 5-fold and only slightly higher than 10-fold after the S. aureus and E. coli challenge, respectively. These results suggest that the changes in AMPs expressions are not as high as those of some other immune proteins and peptides. Our results also confirmed the findings of Tetens et al. [15], who observed that expression of LAP and BNBD5 genes in the mammary tissues may be either constitutive or inducible in response to the S. aureus challenge. Moreover, Whelehan et al. [23] in in vivo study identified DEFB1, BNBD4, BNBD5, LAP and TAP transcripts in different parts of the mammary gland, including the alveoli, as a result of intramammary infection with S. aureus. Although the expressions of BNBD4 and BNBD5 were strongly induced, the expression of DEFB1 was only moderately induced, while the expressions of LAP and TAP were not induced in mammary alveoli by the presence of bacteria. On the other hand, the study of Yang et al. [31], conducted in cell cultures derived from lactating cows’ alveoli, indicated significantly higher gene expression of both BNBD5 and TAP after challenge with S. aureus. Furthermore, Fu et al. [44], in a study on cultured epithelial cells from bovine mammary glands also stated the up-regulation of BNBD5 after stimulation with heat-inactivated E. coli or S. aureus. In our study, the expression of TAP was not found either in infected or healthy mammary tissues. Although it is difficult to explain such differences in TAP gene expression, the duration of inflammation might be one of the explanations. In earlier mentioned studies, the infections were artificially induced, and TAP expression was examined after 30 days (re-infused on day 28), but no later. Moreover, Petzl et al. [32] were not able to detect BNBD5 gene transcript until 84-h after infection with S. aureus. In contrast, our study was conducted on naturally occurring, long-term and recurrent infections. Nevertheless, increased expression of most studied β-defensin genes in infected udder tissues obviously confirmed the participation of these AMPs in the defense of cow mammary gland against invasion by pathogenic bacteria. So far, only several studies were conducted concerning on cathelicidin expression in mammary gland tissues. Tomasinsig et al. [33] found that 24 h after LPS treatment the expression levels of CATH4 and CATH6 were at the detection limit, while that of CATH5 was the same as in non-treated tissues, both in mammary gland tissues and in cultures bovine epithelial cells. These results are consistent with ours, and also confirm the important role of the cathelicidins in healthy mammary tissues. In contrast, however, in the milk of cows, Smolenski et al. [45] stated that the cathelicidin peptide levels were increased only during induced mastitis. They explained this phenomenon through a rapid increasing of neutrophils in milk, which is the basic source of these peptides. They underlined that epithelial cells are not the main source of cathelicidins in milk during mastitis. These findings confirm our results – low expression of cathelicidins in parenchyma of infected udders. Moreover, Ibeagha-Awemu et al. [46] found the upregulated expression of CATH14 in cultured mammary cells in response to E. coli and S. aureus. Smolenski et al. [45] obtained contradictory results in induced mastitis experiment vs. a naturally occurring infection. They found no cathelicidin expressions in mastitic milk samples (in vivo) collected in later stages of infection, probably because the apoptosis of neutrophils and domination of macrophages. These authors also hypothesize that infections with different bacteria caused different levels of cathelicidin expression. This finding was confirmed by the results of Whelehan et al. [14], who did not find any cathelicidin peptides in the milk of animals with naturally-occuring mastitis. In the alveolar region of the mammary gland (both healthy and experimentally-infected with S. aureus cows), however, they found the constitutive expression of CATH5. The expression of this cathelicidin was stable up to 48 hours after infection. Thus, the expression of some cathelicidin genes in mammary gland epithelium was proved in several studies, including ours. However, the new find of the current study was that their expression decreased in parenchyma obtained from mastitic animals. The previous in vitro studies indicated a synergistic activity of defensins and cathelicidins [47]. However, in vivo the synergy of peptides from these two families may not occur, possibly due to of the different salt concentration in healthy and infected tissues. The inhibitory effect of the physiological salt concentration (150 mM NaCl), occurring in healthy tissues, on the activity of defensins as well as the resistance of cathelicidin genes in the physiological or even higher NaCl concentration were proved [47,48]. Therefore, cathelicidins may constitute the first line of defense in healthy tissues thanks to the retaining the activity at a physiological salt concentration. This phenomenon was confirmed by current study. Our results also suggest that the low salt concentration inhibits expression of cathelicidins genes and activates defensin expressions. The opposing results for defensin and cathelicidin genes shown in the current study might indicate on lack of synergy in activity in vivo because their activity depends on salt concentration in different way. The in vivo studies known to the authors of presented publication did not report the age of examined cows, thus it not possible to compare our results with others. However, as we have shown, only the expression of BNBD5, CATH5 and CATH6 differs between age groups of animals within the healthy state of the mammary gland.

Conclusion

Increased expression of genes encoding β-defensins in the infected udder confirms their crucial role in the defense of cow mammary glands against mastitis. On the other hand, the elevated cathelicidin transcripts in non-infected tissues indicate their role in the maintenance of healthy mammary tissues. The expression levels of investigated genes are likely to depend on the duration of the infection and type of bacteria.

Methods

Animals and tissue samples

The study was conducted on 40 Polish Holstein-Friesian dairy cows of Black and White variety. The animals were born and maintained in the Experimental Farm of the Institute of Genetics and Animal Breeding in Jastrzębiec, Poland. The animals were kept under identical conditions in a loose barn with free access to water. They were fed the same total mixed ration (TMR) diet ad libitum, consisting of corn silage (75%), concentrates (20%) and hay (5%), supplemented with a mineral and vitamin mixture, according to the INRA system [49]. The cows were between their first and fourth lactations. Animals were culled at the end of lactation (286 days, SD = 27) due to reproduction problems or chronic, usually asymptomatic, recurrent and incurable mammary gland inflammation. They were slaughtered in a registered slaughter house under conditions which are under constant monitoring by the institutional authorities. Immediately after the slaughter, the mammary tissue samples were taken from deep in the secretory part of the gland (parenchyma) from each quarter. They were rinsed in PBS to remove, as accurately as possible, the milk and blood from tissue samples, and frozen in liquid nitrogen (altogether 160 samples). The samples were stored at -80°C until further analysis. All procedures involving animals were performed in accordance with the Guiding Principles for the Care and Use of Research Animals, and were approved by the III Local Ethics Commission (Warsaw University of Life Science; Permission No. 15/2010).

Presence of bacteria, somatic cell count and lactose content in milk

Milk samples were taken from each quarter of the udder two days before slaughter and examined for the presence of bacteria. The milk was streaked on agar with 5% sheep blood (Columbia, bioMérieux, Craponne, France) and ChapmanMannitol Salt Agar MSA (bioMérieux, Craponne, France) and incubated at 37°C for 18-24 h. Phenotypic evaluation of isolates included colony morphology, cell morphology and biochemical properties. Production of coagulase by Staphylococci was detected using a tube test with rabbit plasma. Additionally, S. aureus strains were identified using SlidexStaph-Kit (bioMérieux, Craponne, France).

Design of the study

The tissue samples were divided into six groups according to the parity and health status of the mammary gland, which was established on the basis of the analysis of the microbiological status of the quarter milk, SCC, and lactose content. Previous statistical analysis (variance analysis with GLM procedure of SAS/STAT software) revealed no differences between the first and second as well as between the third and fourth lactations in AMP gene expression levels, and therefore the samples were grouped into two parity classes: lactations 1/2 and 3/4. The two control groups consisted of samples collected from bacteria-free mammary glands of cows in lactations 1/2 and 3/4 (H1/2 and H3/4, respectively). The experimental groups consisted of samples collected from cows infected with coagulase-positive Staphylococci in lactations 1/2 and 3/4 (CoPS1/2 and CoPS3/4, respectively), and groups created from samples collected from cows infected with coagulase-negative Staphylococci in lactations 1/2 and 3/4 (CoNS1/2 and CoNS3/4, respectively). The groups H1/2 and H3/4 consisted of 9 samples each, the groups CoPS1/2 and the group CoPS3/4 of 14 samples in each, while CoNS1/2 consisted of 7 and CoNS3/4 consisted of 9 samples, chosen on the basis of microbiological examination, out of 160 samples taken from the slaughtered cows. No more than two quarter samples were taken from each cow. The samples of the mammary gland infected with more than one type of bacteria were excluded from analysis.

RNA isolation

Total RNA from the tissue samples was isolated using the RNeasy Mini Kit (Qiagen, Germany) with the DNAse digestion step according to the manufacture’s protocol. The quantity and quality of total RNA was estimated using NanoDrop (USA) and BioAnalyzer (Agilent, USA). Samples that meet the following criteria: >50 ng RNA with absorbance ratios A260/280 and A260/230 of ~2.0 and RIN (RNA Integrity Number) > 7.5, were used for further analyses. RNA was reverse transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Switzerland). 0.5 μg RNA was firstly denatured at 65°C for 10 min in the presence of 50 μM oligo(dT). Next, reverse-transcription was conducted in a total volume of 20 μl of mixture composed of 13 μl of RNA, 4 μl of reverse transcriptase buffer, 2 μl of 10 mM deoxynucleotides, 0.5 μl of protector RNase Inhibitor (40U/μl), and 0.5 μl of reverse transcriptase (20U/μl). The mixture was incubated at 50°C for 60 min, then at 85°C for 5 min, and finally stored at 20°C.

Quantitative Real Time PCR assays (qPCR)

Primers were designed with Primer 5 software (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) according to the GenBank bovine sequences, or based on literature [23,29,33] (Table 2). Primers were designed only for those genes whose complete sequences are available in the GenBank. The transcript levels of the following defensins and cathelicidins were investigated in mammary gland parenchyma: β-defensin1 (enteric β-defensin), neutrophil β-defensin4, neutrophil β-defensin5, neutrophil β-defensin10, tracheal antimicrobial peptide (TAP), lingual antimicrobial peptide (LAP), cathelicidin4 (indolicidin), cathelicidin5 (bovine myeloid antimicrobial peptide28) and cathelicidin6 (bovine myeloid antimicrobial peptide27). The data for the reference genes contains an Additional file 1.
Table 2

The primer sequences, amplicon length, melting temperature and no. of GenBank access of studied genes

Gene name Gene symbol Primersequence 5′-3′ Length of amplicon (bp) Melting temp. (°C) GenBank No access
Cathelicidin 4 = indolicidin CATHL4* ACCCATCCAATGACCAGTTTGACC TTCACTGTCCAGAAGCCCGAATCT17760X67340.1
Cathelicidin 5 = bovine myeloid antimicrobial peptide 28 CATHL5* = BMAP28 TCGGGAGTAACTTCGACATCACCT GGCCCACAATTCACCCAATTCTGA14160X97609.1
Cathelicidin 6 = bovine myeloid antimicrobial peptide 27 CATHL6* = BMAP27 ATGGGCTGGTGAAGCAATGTGTAG TGGAGTAGCGGAATGACTGGAGAA16360X97608.1
β-defensin1 = enteric β-defensin DEFB1 = EBD ATCCTCTAAGCTGCCGTCT AGCATTTTACTGAGGGCGT10258NM_175703.3
β-defensin4 = bovine neutrophil β-defensin4 DEFB4 = BNBD4 CGTTCTTGTGCCGTGTAG AAATTTTAGACGGTGTGTTG14958NM_174775
β-defensin5 = bovine neutrophil β-defensin5 DEFB5 = BNBD5 TCCTCGTGCTCCTCTTCCTA CATATTCCAACGGCAGCTTT14358NM_001130761
β-defensin10 = bovine neutrophil β-defensin10 DEFB10 = BNBD10 AGTTATCTAAGCTGCTGGG CGCTCTGTCAAAGGGTC17358NM_001115084
Tracheal antimicrobial peptide TAP** TCCTGGTCCTGTCTGCTTC CTACAGCATTTTACTGCCCG15158NM_174776
Tracheal antimicrobial peptide TAP*** GCGCTCCTCTTCCTGGTCCTG GCACGTTCTGACTGGGCATTGA21657NM_174776
Lingual antimicrobial peptide LAP GAAATTCTCAAAGCTGCCGTA TCCTCCTGCAGCATTTTACTT19458NM_203435

*primer sequences according to Tomasinsiget al. (2010) [33].

**primer sequences according to Whelehan et al. (2011) [23].

***primer sequences according to Alva-Murillo et al. (2012) [29].

The primer sequences, amplicon length, melting temperature and no. of GenBank access of studied genes *primer sequences according to Tomasinsiget al. (2010) [33]. **primer sequences according to Whelehan et al. (2011) [23]. ***primer sequences according to Alva-Murillo et al. (2012) [29]. qPCR was performed in the Light Cycler 480 (Roche, Mannheim, Germany) using 96-well optical plates with the SYBR Green technique. A PCR mix was prepared to give the indicated end concentrations: 3 μl water, 1 μl forward primer (10 μM), 1 μl reverse primer (10 μM), 5 μl of cDNA, and SYBER Green I Master Mix 2× conc. 10 μl (Roche, Germany). The following amplification protocol was used: 5 min pre-incubation at 95°C, 35 cycles of 3-segment amplification with 15 s at 95°C for denaturation, 30 s at 58-60°C for annealing and 20 s at 72°C for elongation. All runs included a negative control (without cDNA). A dissociation stage was added to verify the presence of one gene-specific peak and the absence of primer-dimer peaks. A 10-fold dilution series of cDNA was included in each run to determine PCR efficiency by constructing a relative quantification standard curve.

Statistical analysis

An expression level of defensins and cathelicidins genes was shown as the means of relative mRNA abundances with their standard errors (SE). All trait data were tested tfor normality of distribution, and somatic cell count (SSC) was transformed to natural logarithm values (SCS). Analysis of variance was conducted with the Tukey-Kramer test [50] to test the effects of the presence of bacterial pathogens on the relative expression of target genes. Effects such as parity and presence/lack of bacteria in milk were taken into consideration in the statistical model (Additional file 2): were:
  39 in total

1.  Short chain fatty acids (propionic and hexanoic) decrease Staphylococcus aureus internalization into bovine mammary epithelial cells and modulate antimicrobial peptide expression.

Authors:  Nayeli Alva-Murillo; Alejandra Ochoa-Zarzosa; Joel E López-Meza
Journal:  Vet Microbiol       Date:  2011-09-01       Impact factor: 3.293

Review 2.  Innate immunity of the bovine mammary gland.

Authors:  Pascal Rainard; Céline Riollet
Journal:  Vet Res       Date:  2006-02-23       Impact factor: 3.683

3.  The role of oct-1 in the regulation of tracheal antimicrobial peptide (TAP) and lingual antimicrobial peptide (LAP) expression in bovine mammary epithelial cells.

Authors:  Jun Yang; Yongming Sang; Kieran G Meade; Chris Ross
Journal:  Immunogenetics       Date:  2011-06-15       Impact factor: 2.846

Review 4.  Bovine milk antibodies for health.

Authors:  H Korhonen; P Marnila; H S Gill
Journal:  Br J Nutr       Date:  2000-11       Impact factor: 3.718

5.  Enteric beta-defensin: molecular cloning and characterization of a gene with inducible intestinal epithelial cell expression associated with Cryptosporidium parvum infection.

Authors:  A P Tarver; D P Clark; G Diamond; J P Russell; H Erdjument-Bromage; P Tempst; K S Cohen; D E Jones; R W Sweeney; M Wines; S Hwang; C L Bevins
Journal:  Infect Immun       Date:  1998-03       Impact factor: 3.441

6.  Proteomics, genomics, and pathway analyses of Escherichia coli and Staphylococcus aureus infected milk whey reveal molecular pathways and networks involved in mastitis.

Authors:  Eveline M Ibeagha-Awemu; Aloysius E Ibeagha; Serge Messier; Xin Zhao
Journal:  J Proteome Res       Date:  2010-09-03       Impact factor: 4.466

7.  The abundance of milk cathelicidin proteins during bovine mastitis.

Authors:  G A Smolenski; R J Wieliczko; S M Pryor; M K Broadhurst; T T Wheeler; B J Haigh
Journal:  Vet Immunol Immunopathol       Date:  2011-07-02       Impact factor: 2.046

8.  Cholecalciferol (vitamin D) differentially regulates antimicrobial peptide expression in bovine mammary epithelial cells: implications during Staphylococcus aureus internalization.

Authors:  Ana Dolores Téllez-Pérez; Nayeli Alva-Murillo; Alejandra Ochoa-Zarzosa; Joel E López-Meza
Journal:  Vet Microbiol       Date:  2012-05-15       Impact factor: 3.293

9.  Bovine TLR2 and TLR4 properly transduce signals from Staphylococcus aureus and E. coli, but S. aureus fails to both activate NF-kappaB in mammary epithelial cells and to quickly induce TNFalpha and interleukin-8 (CXCL8) expression in the udder.

Authors:  Wei Yang; Holm Zerbe; Wolfram Petzl; Ronald Marco Brunner; Juliane Günther; Christian Draing; Sonja von Aulock; Hans-Joachim Schuberth; Hans-Martin Seyfert
Journal:  Mol Immunol       Date:  2007-10-22       Impact factor: 4.407

10.  Strengthening insights into host responses to mastitis infection in ruminants by combining heterogeneous microarray data sources.

Authors:  Sem Genini; Bouabid Badaoui; Gert Sclep; Stephen C Bishop; Dave Waddington; Marie-Hélène Pinard van der Laan; Christophe Klopp; Cédric Cabau; Hans-Martin Seyfert; Wolfram Petzl; Kirsty Jensen; Elizabeth J Glass; Astrid de Greeff; Hilde E Smith; Mari A Smits; Ingrid Olsaker; Guro M Boman; Giuliano Pisoni; Paolo Moroni; Bianca Castiglioni; Paola Cremonesi; Marcello Del Corvo; Eliane Foulon; Gilles Foucras; Rachel Rupp; Elisabetta Giuffra
Journal:  BMC Genomics       Date:  2011-05-11       Impact factor: 3.969

View more
  16 in total

1.  Breed and adaptive response modulate bovine peripheral blood cells' transcriptome.

Authors:  Nataliya Pošćić; Tommaso Montanari; Mariasilvia D'Andrea; Danilo Licastro; Fabio Pilla; Paolo Ajmone-Marsan; Andrea Minuti; Sandy Sgorlon
Journal:  J Anim Sci Biotechnol       Date:  2017-01-25

2.  The clinical impact of antimicrobial resistance genomics in competition with she-camels recurrent mastitis metabolomics due to heterogeneous Bacilluslicheniformis field isolates.

Authors:  Nesreen Allam Tantawy Allam; Doaa Sedky; Enshrah Khalil Mira
Journal:  Vet World       Date:  2017-11-20

Review 3.  β-defensins: An innate defense for bovine mastitis.

Authors:  Ankita Gurao; Sudhir Kumar Kashyap; Ravinder Singh
Journal:  Vet World       Date:  2017-08-26

4.  Transcriptome profiling of Staphylococci-infected cow mammary gland parenchyma.

Authors:  Ewa M Kosciuczuk; Paweł Lisowski; Justyna Jarczak; Alicja Majewska; Magdalena Rzewuska; Lech Zwierzchowski; Emilia Bagnicka
Journal:  BMC Vet Res       Date:  2017-06-06       Impact factor: 2.741

5.  The secretome from bovine mammosphere-derived cells (MDC) promotes angiogenesis, epithelial cell migration, and contains factors associated with defense and immunity.

Authors:  Melissa M Ledet; Amy K Vasquez; Gat Rauner; Allison A Bichoupan; Paolo Moroni; Daryl V Nydam; Gerlinde R Van de Walle
Journal:  Sci Rep       Date:  2018-03-29       Impact factor: 4.379

6.  Runs of homozygosity in a selected cattle population with extremely inbred bulls: Descriptive and functional analyses revealed highly variable patterns.

Authors:  Daniel Goszczynski; Antonio Molina; Ester Terán; Hernán Morales-Durand; Pablo Ross; Hao Cheng; Guillermo Giovambattista; Sebastián Demyda-Peyrás
Journal:  PLoS One       Date:  2018-07-09       Impact factor: 3.240

7.  Small ruminant lentivirus infection influences expression of acute phase proteins and cathelicidin genes in milk somatic cells and peripheral blood leukocytes of dairy goats.

Authors:  Daria Reczyńska; Magdalena Zalewska; Michał Czopowicz; Jarosław Kaba; Lech Zwierzchowski; Emilia Bagnicka
Journal:  Vet Res       Date:  2018-11-13       Impact factor: 3.683

8.  A Differential Innate Immune Response in Active and Chronic Stages of Bovine Infectious Digital Dermatitis.

Authors:  Kaitlyn M Watts; Cristina Fodor; Caroline Beninger; Priyoshi Lahiri; Rakel Arrazuria; Jeroen De Buck; Cameron G Knight; Karin Orsel; Herman W Barkema; Eduardo R Cobo
Journal:  Front Microbiol       Date:  2018-07-19       Impact factor: 5.640

9.  Association between interleukin 8 receptor α gene (CXCR1) and mastitis in dairy cattle.

Authors:  Adrianna Pawlik; Grażyna Sender; Magdalena Kapera; Agnieszka Korwin-Kossakowska
Journal:  Cent Eur J Immunol       Date:  2015-08-03       Impact factor: 2.085

10.  Milk amyloid A as a biomarker for diagnosis of subclinical mastitis in cattle.

Authors:  Hany Ahmed Hussein; Khaled Abd El-Hamid Abd El-Razik; Alaa Mohamed Gomaa; Mohamed Karam Elbayoumy; Khaled A Abdelrahman; H I Hosein
Journal:  Vet World       Date:  2018-01-19
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.