Literature DB >> 25272010

Upregulated UHRF1 promotes bladder cancer cell invasion by epigenetic silencing of KiSS1.

Yu Zhang1, Zhen Huang2, Zhiqiang Zhu2, Xin Zheng2, Jianwei Liu2, Zhiyou Han3, Xuetao Ma3, Yuhai Zhang4.   

Abstract

Ubiquitin-like with PHD and RING finger domains 1 (UHRF1), as an epigenetic regulator, plays important roles in the tumorigenesis and cancer progression. KiSS1 functions as a metastasis suppressor in various cancers, and epigenetic silencing of KiSS1 increases the metastatic potential of cancer cells. We therefore investigated whether UHRF1 promotes bladder cancer cell invasion by inhibiting KiSS1. The expression levels of UHRF1 and KiSS1 were examined by quantitative real-time PCR assay in vitro and in vivo. The role of UHRF1 in regulating bladder cancer metastasis was evaluated in bladder cancer cell. We found that UHRF1 levels are upregulated in most clinical specimens of bladder cancer when compared with paired normal tissues, and UHRF1 expression levels are significantly increased in primary tumors that subsequently metastasized compared with non-metastatic tumors. Forced expression of UHRF1 promotes bladder cancer cell invasion, whereas UHRF1 knockdown decreases cell invasion. Overexpression of UHRF1 increases the methylation of CpG nucleotides and reduces the expression of KiSS1. UHRF1 and KiSS1 expression level is negatively correlated in vivo and in vitro. Knockdown of KiSS1 promotes bladder cancer cell invasion. Importantly, forced expression of KiSS1 partly abrogates UHRF1-induced cell invasion. These data demonstrated that upregulated UHRF1 increases bladder cancer cell invasion by epigenetic silencing of KiSS1.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25272010      PMCID: PMC4182677          DOI: 10.1371/journal.pone.0104252

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Human bladder cancer ranks second in frequency of genitourinary cancer [1], and approximately 50% of patients diagnosed with muscle-invasive bladder cancer (MIBC) develop distant metastases in the lungs and liver, resulting in poor 5-year survival rates [2]. Currently, the advances in suitable therapy for enhancing survival rate are limited because the underlying mechanisms causing cancer metastasis are not well understood. Therefore, it is very important to reveal the molecular mechanism of bladder cancer metastasis for developing effective therapy. UHRF1, also called ICBP90 in humans and Np95 in mice, is a multidomain protein, which is required for epigenetic regulation of gene expression and chromatin modification [3], [4]. UHRF1 increases the G1/S transition as the target of E2F transcription factor [5], and changes in UHRF1 expression level regulates cell cycle progression, cell proliferation and cell migration [6], [7]. UHRF1 is upregulated in multiple types of cancers, and overexpression of UHRF1 is involved in tumorigenesis and cancer progression [8], [9]. Several reports showed that UHRF1 may be an important biomarker for diagnosis and prognosis of cancers [5]. Unoki et al demonstrated that UHRF1 overexpression is associated with the grade and stage of bladder cancer [10]. Overexpression of UHRF1 in bladder cancer is also correlated with increased risk of cancer progression after transurethral resection [10]. Wang et al showed that UHRF1 is overexpressed in colorectal cancer (CRC) cell lines and clinical specimens [5]. UHRF1 expression levels are correlated with cancer metastasis and poor Dukes staging. UHRF1 knockdown induces cell apoptosis and cell cycle arrest at the G0/G1 phase and suppresses cell proliferation and migration. UHRF1 is a very important regulator of DNA methylation, and aberrant DNA methylation is a frequent epigenetic event in bladder cancer [6], [11]. UHRF1 recognizes hemimethylated DNA generated during DNA replication and recruits DNMT1 (DNA methyltransferase1) to ensure faithful maintenance of DNA-methylation patterns in daughter cells [6]. KiSS1 is identified as suppressing metastases in various cancers, such as bladder cancer, breast cancer cells and melanoma [12]. KiSS1 encodes a 145-amino acid protein that is processed into KiSSpeptins (KP), including KP10, KP13, KP14 and KP54 [12], [13], [14]. Recent studies showed that KiSS1 is epigenetically silenced by hypermethylation in bladder cancer [15]. Cebrian et al demonstrated that KiSS1 hypermethylation is frequently observed and is correlated with low gene expression, being restored by demethylating azacytidine in bladder cancer cells [12]. Hypermethylation of KiSS1 is also correlated with high tumor grade and stage. Despite these intriguing findings, little is known about whether UHRF1 increases bladder cancer cell invasion by epigenetic silencing of KiSS1. In the study, we tested whether UHRF1/KiSS1 represents a novel pathway regulating bladder cancer cell invasion. Our results revealed that UHRF1 expression is upregulated in primary tumors that subsequently metastasized, and overexpression of UHRF1 promotes bladder cancer cell invasion by epigenetic silencing of KiSS1.

Materials and Methods

Clinical samples and cell lines

Human bladder tissues were obtained with written informed consent from the Beijing Friendship Hospital affiliated to Capital Medical University. The study was approved by the Ethics Committee of Capital Medical University. 47 specimens (Table 1) of pathologically and normally diagnosed biopsy specimens (≥3 cm away from bladder cancer tissues) were collected from patients with bladder cancer, including 22 with non-muscle-invasive [NMI, stage pTa-pT1] and 25 with muscle-invasive [MI, stage ≥T2].Human bladder cancer cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and were maintained in RPMI 1640 with 10% FBS (GIBCO, Carlsbad, CA).
Table 1

Associations of UHRF1 level with clinicopathologic characteristics in 47 patients with bladder cancer.

VariablenUHRF1 level P
lowhigh
Age 47
<60 198110.594
≥60 281216
Gender
Male 3114170.365
Female 16610
Histologic grade
G1 8350.058
G2 291316
G3 1046
Depth of invasion
pTa-pT1 2210120.042
pT2-pT4 251015
KiSS1 level
Low 3114170.033
High 16106

Fisher's exact test was used for the statistical analyses.

Fisher's exact test was used for the statistical analyses.

Real-time quantitative PCR

Total RNA from bladder cancer cell lines and specimens was extracted using Trizol reagent (Invitrogen, Carlsbad, CA). The RT (reverse-transcription) reaction was performed using an M-MLV Reverse Transcriptase kit (Invitrogen). Real-time quantitative PCR was carried out using a standard SYBR Green PCR Master Mix (Life Technologies) protocol on the StepOne Real-Time PCR System (Applied Biosystems) according to the instructions from the respective manufacturer. β-actin was used as internal control for mRNA. Respective ΔCt values (both UHRF1 and KiSS1) were obtained by normalization to β-actin. Relative expression was calculated with respect to the control. The results were expressed as 2−ΔΔCt. *p<0.05.

Overexpression and Small interfering RNA

To overexpress UHRF1, plasmid pcDNA-UHRF1 was constructed by introducing a HindIII-EcoRI fragment containing the UHRF1 cDNA into the same sites in pcDNA3.1. The UHRF1 gene was amplified by PCR using the forward and reverse primers: cccaagcttgggATGTGGATCCAGGTTCGGACCATGGACGGG and ggaattccTCACCGGCCATTGCCGTAGCCGGGGAAG. pcDNA-UHRF1 was transfected into bladder cancer cell lines by using Lipofectamine 2000 (Invitrogen). To inhibit endogenous UHRF1 and KiSS1 expression, bladder cancer cells were transfected with 30 nM indicated indicated siRNA or negative control using Lipofectamine 2000. UHRF1-siRNAs (reference sequence, sc-76805) were purchased from Santa Cruz Biotechnology (Santa Cruz Biotechnology, Santa Cruz, CA). The KiSS1-siRNAs (reference sequence, sc-37443) were purchased from Santa Cruz Biotechnology.

Transwell invasion assay

Cell invasion was examined using Transwell invasion assay with inserts of 8-µm pore size (Corning Costar) as described previously [16]. Briefly, bladder cancer cells (RT4 or T24) were suspended in serum free medium, and then seeded onto Matrigel-coated Transwell filters in Biocoat Matrigel invasion chambers. The serum-containing medium was used as a chemo-attractant in the lower chamber. The bladder cancer cells were treated with indicated reagents for 72 h, and then cells that did not invade through the pores were eliminated by using a cotton swab. Cells on the lower surface of the membrane were stained with Crystal violet. The cell numbers were determined by counting of the penetrating cells under a microscope at 200× magnification in random fields in each well.

Methylation Analysis of KiSS1

A search for enrichment of CpG in KiSS1 was performed and bisulfite sequencing primers were designed using the CpG Island Searcher online tool (MethPrimer, http://www.urogene.org/methprimer/). The forward primers are GATGGAAGGGGAATAGTTTTATTAGA, and the reverse primers are TACAACTAAAACTCCTTCCACCTAC [12]. Genomic DNA was prepared from bladder cancer cells using the QiAmp DNA blood Mini kit, and then the genomic DNA was bisulfite modified using EZ DNA Methylation-Gold Kit from Zymo research [17]. The PCR products were cloned into pMD-18T (TaKaRa) according to manufacturer's instructions. 9 positive clones were sequenced. The data were analyzed using the BiQ analyzer software [17].

Statistical Analysis

Data are expressed as mean ±SD (standard deviation) from at least three separate experiments. The differences between groups were analyzed using Student's t test. The difference was deemed statistically significant at p<0.05.

Results

UHRF1 level is upregulated in metastatic bladder urothelial carcinoma

UHRF1 results in abnormal DNA methylation and cancer metastasis, and UHRF1 expression is correlated with a poor prognosis in several cancers. To assess whether UHRF1 regulates bladder cancer metastasis, we first examined UHRF1 expression in bladder cancer cell lines and cancer tissues. Figure 1A showed that the expression levels of UHRF1 are significantly upregulated in most bladder cancer tissues compared with adjacent normal controls. UHRF1 is remarkably increased expression in 77% (36/47) of bladder cancer tissues (Figure 1A). When the 47 tumor tissues were stratified based on clinical progression, UHRF1 expression is significantly increased in primary tumors that subsequently metastasized compared with non-metastatic tumors (Figure 1B). Then we assayed the expression levels of UHRF1 in both invasive bladder cancer cell lines and noninvasive bladder cancer cell lines. Among the three invasive cell lines (253J, T24 and KU7) the UHRF1 levels are relatively higher than those in the noninvasive ones (Figure 1C). These data suggest that UHRF1 overexpressoin may be related to bladder cancer metastasis.
Figure 1

Higher UHRF1 expression is associated with bladder cancer metastasis.

(A) The quantitative analysis of UHRF1 expression level was carried out in bladder cancer tissues (n = 47) and adjacent normal tissues. Total RNA was extracted and subjected to real-time PCR to analyze the expression of UHRF1 in each sample. β-actin was used as an internal control. The relative UHRF1 level was calculated by 2−ΔΔCt where ΔCt = Ct (UHRF1) – Ct (β-actin) and ΔΔCt = ΔCt (tumor tissue) – ΔCt (adjacent normal tissue). (B) The bladder cancer specimens were divided into two groups based on clinical progression. The UHRF1 levels in the metastasis group (n = 25) were higher than those in the no-metastasis group (n = 22). *p<0.05. (C) UHRF1 expression level was assayed by real-time PCR in three noninvasive and three invasive bladder cancer cell lines. Normal urothelial cells were used as control. *p<0.05.

Higher UHRF1 expression is associated with bladder cancer metastasis.

(A) The quantitative analysis of UHRF1 expression level was carried out in bladder cancer tissues (n = 47) and adjacent normal tissues. Total RNA was extracted and subjected to real-time PCR to analyze the expression of UHRF1 in each sample. β-actin was used as an internal control. The relative UHRF1 level was calculated by 2−ΔΔCt where ΔCt = Ct (UHRF1) – Ct (β-actin) and ΔΔCt = ΔCt (tumor tissue) – ΔCt (adjacent normal tissue). (B) The bladder cancer specimens were divided into two groups based on clinical progression. The UHRF1 levels in the metastasis group (n = 25) were higher than those in the no-metastasis group (n = 22). *p<0.05. (C) UHRF1 expression level was assayed by real-time PCR in three noninvasive and three invasive bladder cancer cell lines. Normal urothelial cells were used as control. *p<0.05.

Upregulated UHRF1 increases bladder cancer cell invasion in vitro

To investigate the role of UHRF1 in regulating cell invasion, the bladder cancer cell lines treated with UHRF1-siRNA or pcDNA-UHRF1 were analyzed. We first demonstrated whether RT4 and T24 cells can be used as in vitro model to investigate UHRF1 by assaying its expression in RT4 or T24 cells after overexpression or knockdown of UHRF1. Figure 2A and C showed that the pcDNA-UHRF1 treatment significantly increases UHRF1 levels in non-invasive RT4 cells, whereas UHRF1-siRNA treatment decreases UHRF1 expression in invasive T24 cells. Furthermore, upregulation of UHRF1 promotes RT4 cell invasion (Figure 2B), whereas siRNA-mediated UHRF1 silencing inhibits T24 cell invasion (Figure 2D). These results demonstrated that UHRF1 positively regulates bladder cancer cell invasion.
Figure 2

Overexpression of UHRF1 promotes bladder cancer cell invasion.

(A) RT4 cells were treated with pcDNA-UHRF1, and the relative level of UHRF1 was assayed by realtime PCR. *p<0.05. (B) UHRF1 was overexpressed in RT4 cells, and invasion assay was performed as described in Material and Methods. Representative figures of each experiment are shown. These results show data from five independent experiments, expressed as the mean ±SD. *p<0.05. (C) T24 cells were treated with UHRF1-siRNA, and the relative level of UHRF1 was assayed by realtime PCR. *p<0.05. (D) Invasion assay was performed after UHRF1 knockdown. Representative figures of each experiment are shown. These results show data from five independent experiments, expressed as the mean ±SD. *p<0.05.

Overexpression of UHRF1 promotes bladder cancer cell invasion.

(A) RT4 cells were treated with pcDNA-UHRF1, and the relative level of UHRF1 was assayed by realtime PCR. *p<0.05. (B) UHRF1 was overexpressed in RT4 cells, and invasion assay was performed as described in Material and Methods. Representative figures of each experiment are shown. These results show data from five independent experiments, expressed as the mean ±SD. *p<0.05. (C) T24 cells were treated with UHRF1-siRNA, and the relative level of UHRF1 was assayed by realtime PCR. *p<0.05. (D) Invasion assay was performed after UHRF1 knockdown. Representative figures of each experiment are shown. These results show data from five independent experiments, expressed as the mean ±SD. *p<0.05.

UHRF1 increases the methylation of CpG nucleotides and reduces the expression of KiSS1

Previous studies showed that KiSS1 is frequently hypermethylated in bladder cancer and is correlated with cancer progression [12]. Here we investigated whether UHRF1 regulates bladder cancer cell invasion by epigenetic silencing of KiSS1. We first assayed whether UHRF1 regulates KiSS1 expression. As shown in Figure 3A and B, forced expression of UHRF1 inhibits KiSS1 expression, whereas knockdown of UHRF1 increases KiSS1 expression. We then assayed the expression level of UHRF1 and KiSS1 in both invasive bladder cancer cell lines and noninvasive bladder cancer cell lines. Figure 3C showed that the UHRF1 levels are relatively higher with concurrent low levels of KiSS1 in invasive cell lines. A significant negative correlation is also observed between the UHRF1 mRNA levels and the KiSS1 mRNA levels in vivo (r 2 = 0.0648, p = 0.0063, Figure 3D). We further investigated whether UHRF1 inhibits KiSS1 expression by increasing the methylation of CpG nucleotides of KiSS1. We analyzed the methylation status of CpG islands in KiSS1 by bisulfite sequencing, as reported previously [12], [15]. The methylation assay results for the KiSS1 gene in 14 bladder cancer tissues and adjacent normal controls are summarized in Figure 4A. Bisulfite sequencing analysis revealed that KiSS1 methylation frequency is markedly increased in bladder cancer tissues compared with adjacent controls (Figure 4A). Correlation analysis showed that the KiSS1 methylation level is positively correlated with UHRF1 expression in both bladder cancer and normal bladder tissues (Figure 4B, p = 0.0036, R2 = 0.2091). Bisulfite sequencing analysis further showed that UHRF1 overexpression increases the methylation of CpG nucleotides of KiSS1 (Figure 4C,D). These results suggest that UHRF1 suppresses KiSS1 expression by epigenetic silencing of KiSS1.
Figure 3

UHRF1 negatively regulates KiSS1 expression.

(A and B) KiSS1 expression level was assayed in RT4 cells overexpressed with UHRF1 or T24 cells treated with UHRF1-siRNA. *p<0.05. (C) UHRF1 and KiSS1 levels were assayed by real-time PCR in three noninvasive and three invasive bladder cancer cell lines. Normal urothelial cells were used as control. *p<0.05. (D) Negative correlation between the UHRF1 mRNA levels and the KiSS1 levels in 24 bladder cancer samples (r 2 = 0.0648, p = 0.0063).

Figure 4

UHRF1 reduces the expression of KiSS1 by increasing the methylation of CpG nucleotides.

(A) The methylation analysis of the KiSS1 gene in 14 bladder cancer tissues and adjacent normal samples. BSQ analysis revealed that KiSS1 methylation frequency is markedly increased with bladder cancer samples. ** p<0.01. (B) A positive correlation is observed between KiSS1 methylation and UHRF1 expression (R2 = 0.2091, p = 0.0036). (C and D) CpG island methylation status of KiSS1 was analyzed by bisulfite sequencing in RT4 cells. Nine individual clones were shown per cell line. CpG dinucleotides were represented as dark squares for methylated cytosines and open squares for unmethylated cytosines.

UHRF1 negatively regulates KiSS1 expression.

(A and B) KiSS1 expression level was assayed in RT4 cells overexpressed with UHRF1 or T24 cells treated with UHRF1-siRNA. *p<0.05. (C) UHRF1 and KiSS1 levels were assayed by real-time PCR in three noninvasive and three invasive bladder cancer cell lines. Normal urothelial cells were used as control. *p<0.05. (D) Negative correlation between the UHRF1 mRNA levels and the KiSS1 levels in 24 bladder cancer samples (r 2 = 0.0648, p = 0.0063).

UHRF1 reduces the expression of KiSS1 by increasing the methylation of CpG nucleotides.

(A) The methylation analysis of the KiSS1 gene in 14 bladder cancer tissues and adjacent normal samples. BSQ analysis revealed that KiSS1 methylation frequency is markedly increased with bladder cancer samples. ** p<0.01. (B) A positive correlation is observed between KiSS1 methylation and UHRF1 expression (R2 = 0.2091, p = 0.0036). (C and D) CpG island methylation status of KiSS1 was analyzed by bisulfite sequencing in RT4 cells. Nine individual clones were shown per cell line. CpG dinucleotides were represented as dark squares for methylated cytosines and open squares for unmethylated cytosines.

UHRF1 increases bladder cancer cell invasion by inhibiting KiSS1

UHRF1 decreases KiSS1 expression by increasing the methylation of CpG nucleotides of KiSS, and downregulation of KiSS1 promotes bladder cancer cell invasion. Therefore we speculated that the role of UHRF1 in regulating cell invasion is partly mediated by KiSS1. We first assayed whether KiSS1 inhibition increases bladder cancer cell invasion. As shown in Figure 5A and B, knockdown of KiSS1 promotes RT4 cell invasion. More important, KiSS1 overexpression partly inhibits UHRF1-inducing RT4 cell invasion (Figure 5C and D). These results confirm that UHRF1 promotes bladder cancer cell invasion, at least in part, by epigenetic silencing of KiSS1.
Figure 5

UHRF1 increases bladder cancer cell invasion by inhibiting KiSS1.

(A and B) RT4 cells were treated with KiSS1-siRNA and invasion assay was performed after KiSS1 knockdown. Representative figures of each experiment are shown. These results show data from five independent experiments, expressed as the mean ±SD. *p<0.05. (C and D) RT4 cells were overexpressed with the UHRF1 or UHRF1 plus KiSS1, and invasion assay was performed. *p<0.05.

UHRF1 increases bladder cancer cell invasion by inhibiting KiSS1.

(A and B) RT4 cells were treated with KiSS1-siRNA and invasion assay was performed after KiSS1 knockdown. Representative figures of each experiment are shown. These results show data from five independent experiments, expressed as the mean ±SD. *p<0.05. (C and D) RT4 cells were overexpressed with the UHRF1 or UHRF1 plus KiSS1, and invasion assay was performed. *p<0.05.

Discussion

In mammals, DNA methylation occurs at the C5 position of cytosine in the context of CpG dinucleotides, resulting in 5-methylcytosine (5mC) [18]. The modification of genomic DNA by methylation is an important epigenetic signal, and changes in the pattern of DNA methylation have been a consistent finding in various tumor types [19]. Recent studies showed that epigenetic inheritance of DNA methylation requires UHRF1, which recruits DNMT1 to DNA replication forks through a unique hemimethylated CpG-binding activity [20]. Liu et al reported that UHRF1 recruits DNMT1 for DNA maintenance methylation through binding either hemi-methylated CpG or H3K9me2/3, and that the presence of both binding activities ensures high fidelity DNA maintenance methylation [20]. UHRF1 overexpression is associated with the tumor stages and predicts poor prognoses in various cancers [21]. UHRF1 coordinates PPARG (peroxisome proliferator-activated receptor γ) epigenetic silencing and mediates colorectal cancer progression [22]. Knockdown of UHRF1 elicits PPARG re-activation, accompanied by positive histone marks and DNA demethylation, corroborating its role in PPARG silencing. Babbio et al showed that UHRF1 contributes to epigenetic gene silencing in prostate cancer progression [23]. In the present study, we found that the expression levels of UHRF1 are significantly increased in most bladder cancer tissues compared with adjacent normal controls. Moreover, UHRF1 expression is significantly increased in primary tumors that subsequently metastasized compared with non-metastatic tumors. We also found that the UHRF1 levels are relatively higher in invasive bladder cancer cell lines than those in the noninvasive ones. Furthermore, upregulated UHRF1 promotes noninvasive RT4 cell invasion, whereas knockdown of UHRF1 inhibits invasive T24 cell invasion. These data demonstrated that upregulation of UHRF1 contributes to bladder cancer cell invasion. KiSS1 is a tumor metastasis suppressor gene in several cancers. KiSS1 expression is markedly decreased in invasive bladder tumors compared with their respective normal urothelium [24]. Lower KiSS1 level is correlated with overall survival in bladder tumors [24]. KiSS1 is significantly methylated. Inactivation of KiSS1 by promoter methylation is an infrequent event in pancreatic ductal adenocarcinoma (PDAC) [25]. KiSS1 is also epigenetically modified in colorectal cancer, and KiSS1 methylation is associated with tumor grade, predicted recurrence and overall survival [15]. Here we found that UHRF1 negatively regulates KiSS1 expression. UHRF1 levels are relatively higher with concurrent low levels of KiSS1 in invasive bladder cancer cell lines. A significant negative correlation is also observed between the UHRF1 mRNA levels and the KiSS1 mRNA levels in vivo. Bisulfite sequencing analysis showed that UHRF1 inhibits KiSS1 expression by increases the methylation of CpG nucleotides of KiSS1. More important, KiSS1 overexpression partly inhibits RT4 cell invasion in UHRF1-overexpressing cells.

Conclusion

Our data showed that upregulated UHRF1 contributes to bladder cancer cell invasion by epigenetic silencing of KiSS1.
  25 in total

Review 1.  DNA methylation patterns and epigenetic memory.

Authors:  Adrian Bird
Journal:  Genes Dev       Date:  2002-01-01       Impact factor: 11.361

2.  UHRF1 coordinates peroxisome proliferator activated receptor gamma (PPARG) epigenetic silencing and mediates colorectal cancer progression.

Authors:  L Sabatino; A Fucci; M Pancione; V Carafa; A Nebbioso; C Pistore; F Babbio; C Votino; C Laudanna; M Ceccarelli; L Altucci; I M Bonapace; V Colantuoni
Journal:  Oncogene       Date:  2012-01-30       Impact factor: 9.867

3.  UHRF1 promotes cell growth and metastasis through repression of p16(ink⁴a) in colorectal cancer.

Authors:  Feng Wang; Yong-Zhi Yang; Chen-Zhang Shi; Peng Zhang; Mary Pat Moyer; Hui-Zhen Zhang; Yang Zou; Huan-Long Qin
Journal:  Ann Surg Oncol       Date:  2012-01-05       Impact factor: 5.344

4.  The retinoblastoma gene and its product are targeted by ICBP90: a key mechanism in the G1/S transition during the cell cycle.

Authors:  Michaël Jeanblanc; Marc Mousli; Raphaël Hopfner; Kawtar Bathami; Nadine Martinet; Abdul-Qader Abbady; Jean-Claude Siffert; Eric Mathieu; Christian D Muller; Christian Bronner
Journal:  Oncogene       Date:  2005-11-10       Impact factor: 9.867

5.  Critical role of the ubiquitin ligase activity of UHRF1, a nuclear RING finger protein, in tumor cell growth.

Authors:  Yonchu Jenkins; Vadim Markovtsov; Wayne Lang; Poonam Sharma; Denise Pearsall; Justin Warner; Christian Franci; Betty Huang; Jianing Huang; George C Yam; Joseph P Vistan; Erlina Pali; Jorge Vialard; Michel Janicot; James B Lorens; Donald G Payan; Yasumichi Hitoshi
Journal:  Mol Biol Cell       Date:  2005-09-29       Impact factor: 4.138

6.  The SRA protein UHRF1 promotes epigenetic crosstalks and is involved in prostate cancer progression.

Authors:  F Babbio; C Pistore; L Curti; I Castiglioni; P Kunderfranco; L Brino; P Oudet; R Seiler; G N Thalman; E Roggero; M Sarti; S Pinton; M Mello-Grand; G Chiorino; C V Catapano; G M Carbone; I M Bonapace
Journal:  Oncogene       Date:  2012-02-13       Impact factor: 9.867

7.  Tumor suppressor role of KiSS-1 in bladder cancer: loss of KiSS-1 expression is associated with bladder cancer progression and clinical outcome.

Authors:  Marta Sanchez-Carbayo; Paola Capodieci; Carlos Cordon-Cardo
Journal:  Am J Pathol       Date:  2003-02       Impact factor: 4.307

8.  KiSS-1 methylation and protein expression patterns contribute to diagnostic and prognostic assessments in tissue specimens for colorectal cancer.

Authors:  Patricia Moya; Sergio Esteban; Antonio Fernandez-Suarez; Marisa Maestro; Manuel Morente; Marta Sánchez-Carbayo
Journal:  Tumour Biol       Date:  2012-11-07

Review 9.  The systemic treatment of advanced and metastatic bladder cancer.

Authors:  Syed A Hussain; Nicholas D James
Journal:  Lancet Oncol       Date:  2003-08       Impact factor: 41.316

10.  UHRF1 phosphorylation by cyclin A2/cyclin-dependent kinase 2 is required for zebrafish embryogenesis.

Authors:  Jaime Chu; Elizabeth A Loughlin; Naseem A Gaur; Sucharita SenBanerjee; Vinitha Jacob; Christopher Monson; Brandon Kent; Amanke Oranu; Yuanying Ding; Chinweike Ukomadu; Kirsten C Sadler
Journal:  Mol Biol Cell       Date:  2011-11-09       Impact factor: 4.138

View more
  32 in total

1.  Elevated expression of UHRF1 predicts unfavorable prognosis for patients with hepatocellular carcinoma.

Authors:  Dong Liang; Huanzhou Xue; Yang Yu; Feng Lv; Wei You; Bin Zhang
Journal:  Int J Clin Exp Pathol       Date:  2015-08-01

2.  UHRF1 promotes proliferation of gastric cancer via mediating tumor suppressor gene hypermethylation.

Authors:  Lin Zhou; Yulong Shang; Zhi'an Jin; Wei Zhang; Chunlei Lv; Xiaodi Zhao; Yongqiang Liu; Naiyi Li; Jie Liang
Journal:  Cancer Biol Ther       Date:  2015-07-06       Impact factor: 4.742

3.  miR-128 downregulation promotes growth and metastasis of bladder cancer cells and involves VEGF-C upregulation.

Authors:  X U Zhou; Lin Qi; Shiyu Tong; Y U Cui; Jinbo Chen; Tianxiang Huang; Zhi Chen; Xiong-Bing Zu
Journal:  Oncol Lett       Date:  2015-09-09       Impact factor: 2.967

Review 4.  A Tox21 Approach to Altered Epigenetic Landscapes: Assessing Epigenetic Toxicity Pathways Leading to Altered Gene Expression and Oncogenic Transformation In Vitro.

Authors:  Craig L Parfett; Daniel Desaulniers
Journal:  Int J Mol Sci       Date:  2017-06-01       Impact factor: 5.923

5.  KISS-1, Mediated by Promoter Methylation, Suppresses Esophageal Squamous Cell Carcinoma Metastasis via MMP2/9/MAPK Axis.

Authors:  Houyu Duan; Xiang Ding; Hesheng Luo
Journal:  Dig Dis Sci       Date:  2022-01-07       Impact factor: 3.487

6.  Clinicopathological analysis of UHRF1 expression in medulloblastoma tissues and its regulation on tumor cell proliferation.

Authors:  Zhen-Yu Zhang; Jia-Jun Cai; Jin Hong; Kay Ka-Wai Li; Zhou Ping; Yin Wang; Ho-Keung Ng; Yu Yao; Ying Mao
Journal:  Med Oncol       Date:  2016-07-23       Impact factor: 3.064

Review 7.  KISS1 in metastatic cancer research and treatment: potential and paradoxes.

Authors:  Thuc Ly; Sitaram Harihar; Danny R Welch
Journal:  Cancer Metastasis Rev       Date:  2020-09       Impact factor: 9.264

Review 8.  Role of the tumor microenvironment in regulating the anti-metastatic effect of KISS1.

Authors:  Sitaram Harihar; Srijit Ray; Samyukta Narayanan; Anirudh Santhoshkumar; Thuc Ly; Danny R Welch
Journal:  Clin Exp Metastasis       Date:  2020-02-22       Impact factor: 5.150

Review 9.  Signalling pathways in UHRF1-dependent regulation of tumor suppressor genes in cancer.

Authors:  Mahmoud Alhosin; Ziad Omran; Mazin A Zamzami; Abdulrahman L Al-Malki; Hani Choudhry; Marc Mousli; Christian Bronner
Journal:  J Exp Clin Cancer Res       Date:  2016-11-14

10.  Downregulation of miR-199b is associated with distant metastasis in colorectal cancer via activation of SIRT1 and inhibition of CREB/KISS1 signaling.

Authors:  Zhan-Long Shen; Bo Wang; Ke-Wei Jiang; Chun-Xiang Ye; Cheng Cheng; Yi-Chao Yan; Ji-Zhun Zhang; Yang Yang; Zhi-Dong Gao; Ying-Jiang Ye; Shan Wang
Journal:  Oncotarget       Date:  2016-06-07
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.