Literature DB >> 25271406

Clinical isolates of Shiga toxin 1a-producing Shigella flexneri with an epidemiological link to recent travel to Hispañiola.

Miranda D Gray, Keith A Lampel, Nancy A Strockbine, Reinaldo E Fernandez, Angela R Melton-Celsa, Anthony T Maurelli.   

Abstract

Shiga toxins (Stx) are cytotoxins involved in severe human intestinal disease. These toxins are commonly found in Shigella dysenteriae serotype 1 and Shiga-toxin-producing Escherichia coli; however, the toxin genes have been found in other Shigella species. We identified 26 Shigella flexneri serotype 2 strains isolated by public health laboratories in the United States during 2001-2013, which encode the Shiga toxin 1a gene (stx1a). These strains produced and released Stx1a as measured by cytotoxicity and neutralization assays using anti-Stx/Stx1a antiserum. The release of Stx1a into culture supernatants increased ≈100-fold after treatment with mitomycin C, suggesting that stx1a is carried by a bacteriophage. Infectious phage were found in culture supernatants and increased ≈1,000-fold with mitomycin C. Whole-genome sequencing of several isolates and PCR analyses of all strains confirmed that stx1a was carried by a lambdoid bacteriophage. Furthermore, all patients who reported foreign travel had recently been to Hispañiola, suggesting that emergence of these novel strains is associated with that region.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25271406      PMCID: PMC4193171          DOI: 10.3201/eid2010.140292

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Shiga toxins (Stx) are potent AB5 cytotoxins that inhibit eukaryotic protein synthesis, eventually leading to host cell death (). Infections with bacteria that produce Stx result in hemorrhagic colitis and can lead to serious complications like hemolytic uremic syndrome (HUS) (). Although 4 species of Shigella cause bacillary dysentery, historically only Shigella dysenteriae type 1 has been recognized as carrying the genes for Shiga toxin (stx). Likewise, S. dysenteriae 1 is the only Shigella species that causes HUS as a complication of infection (). The genes encoding the toxin are found in an operon consisting of stxA and stxB. The stx locus in S. dysenteriae 1 is surrounded by DNA sequence homologous to lambdoid bacteriophage sequence; however, the toxin genes are not associated with a complete prophage genome (,). Insertion sequences flanking the stx region suggest that gene rearrangements occurred and resulted in a defective phage. As a consequence, viable phage are not recovered from S. dysenteriae 1 cultures even under conditions that induce phage production (). Stx has been extensively studied in Shiga toxin–producing Escherichia coli (STEC), notably E. coli O157:H7. STEC produce 2 variants of Stx: Stx1a (which differs from S. dysenteriae 1 Stx by 1 aa), and Stx2 (which shares 56% identity with Stx1a) (,). In contrast to the toxin genes in S. dysenteriae 1, those in STEC are generally carried by lambdoid prophages, which integrate into the host bacterial chromosome (). The phage remains in a lysogenic state until environmental conditions induce expression of phage lytic cycle genes, leading to new phage production and lysis of the host bacterium. The stx and stx loci are found within the late gene regions of the phage; therefore, induction of the lytic cycle increases expression of the toxin genes and host cell lysis allows for toxin release (). Recently, acquisition of stx genes in clinical isolates of other Shigella species has been reported (,). Three cases of infection with S. dysenteriae 4 were described, and all were shown to express stx. No further characterization of the stx-encoding S. dysenteriae 4 strains was reported; however, all 3 infected patients had reported recent travel to Hispañiola (). An isolate of Shiga toxin–producing S. sonnei from a patient returning from the Ukraine was also characterized; the toxin genes were determined to be carried by a lambdoid prophage homologous to stx-encoding phages found in STEC (). We identified 26 clinical isolates of S. flexneri 2 that encode stx. DNA sequence and PCR analyses determined that stx is encoded by a lambdoid prophage. Characterization of the phage indicated that it behaves similarly to stx-encoding phages that infect STEC. Like the patients from whom stx-encoding S. dysenteriae 4 was isolated, patients from whom stx-encoding S. flexneri 2 was isolated and who reported foreign travel had also recently visited Hispañiola. The potential consequences of an epidemiological link to this region are discussed.

Methods

Bacterial Strains and Growth Conditions

Shigella clinical isolates used in this study are listed in Table 1. S. flexneri strains were grown in Tryptic Soy Broth (BD Difco, Franklin Lakes, NJ, USA) at 37°C with aeration or on Tryptic Soy Broth plates containing 1.5% agar and 0.025% Congo red. E. coli K-12 strain MG1655 was grown in Luria-Bertani broth and on Luria-Bertani agar plates. Kanamycin and ampicillin were used at 50 μg/mL and 100 μg/mL, respectively.
Table 1

Isolation information for clinical strains of Shigella flexneri , USA, 2001–2013*

StrainSource state (laboratory no.)Isolation dateRecent travel destination
stx1a-positive
BS937HI (HI_N10–094)2010 MarHaiti
BS938MA (MA_12EN1615)2012 MayNA
BS942MA (MA_10EN1901)2010 SepNR
BS943MA (MA_11EN1036)2011 JunNA
BS951PA (05E00067)2005 JanNR
BS954PA (05E02261)2005 DecDominican Republic
BS955PA (06E00134)2006 JanNR
BS957PA (06E00281)2006 FebNR
BS958PA (06E00283)2006 JanNR
BS959PA (06E00305)2006 FebNR
BS960PA (06E00941)UnknownHaiti
BS963PA (08E01943)2008 SepNR
BS965PA (M09015890001A)2009 JulNA
BS968PA (M10005231001A)2010 FebHaiti
BS971PA (M11028960001A)2011 NovHaiti
BS972MA (12EN7814)2012 NovNR‡
BS974IN (01–3105)†2001 AprHaiti
BS980MA (05–3606)†2005 OctNR‡
BS981CT (06–3001)†2005 DecDominican Republic
BS982GA (08–3370)†2008 AprNR
BS988CT (2012C-3273 †2012 JanHaiti
BS989CT (2013C-3310)†2013 (month unknown)NR
BS998PA (M13004940001A)2013 MarHaiti
BS999MA (MA_13EN0428)2013 JanHaiti
BS1010MD (MDA10005139)2009 DecDominican Republic
BS1011
MD (MDA12018728)
2012 Jan
NA
stx1a-negative
BS952PA (05E00414)2005 AprPeru
BS969PA (M11015188001A)2011 JunIndia
BS970PA (M11015261001A)2011 JunNR

*NA, no information available; NR, none reported; stx, Shiga toxin 1a gene.
†Obtained by the Centers for Disease Control and Prevention.
‡No foreign travel reported, but patient had contact with a person who recently returned from Haiti.

*NA, no information available; NR, none reported; stx, Shiga toxin 1a gene.
†Obtained by the Centers for Disease Control and Prevention.
‡No foreign travel reported, but patient had contact with a person who recently returned from Haiti.

PCR Analysis of stx-Encoding S. flexneri

DNA lysates were used for PCR for stx with primers stx1-det-F1 and stx1-seq-R1, and for stx with primers stx_F/stxR1. All strains were verified to contain the virulence plasmid of S. flexneri by PCR amplification of virF with primers VirF1 and VirF2. To show that stx was phage encoded, we analyzed lysates by PCR with primer pairs Stx1R2/Phage_stxR2 and Phage_stx1F2/Stx1F2. The insertion site of the phage into S. flexneri locus S1742 was determined by amplifying the upstream region of S1742 and an early phage gene with primers S1742_up/Stx_phage_up and by amplifying a late phage gene and the downstream region of S1742 with primers Stx_phage_dn/S1742_dn. All PCRs were conducted by using PCR Master Mix (2X) (Fermentas, Pittsburgh, PA, USA) according to the manufacturer’s specifications. Primer sequences and expected amplicons are listed in Table 2.
Table 2

Primer pairs used for PCR analysis

Primer pairSequence, 5′ → 3′Amplicon size, bpSource
stx1-det-F1GTACGGGGATGCAGATAAATCGC698 (14)
stx1-seq-R1GAAGAAGAGACTGAAGATTCCATCTG
stx2_F4GGCACTGTCTGAAACTGCTCCTGT627 (14)
stx2R1ATTAAACTGCACTTCAGCAAATCC
VirF1GCAAATACTTAGCTTGTTGCACAGAG907This study
VirF2GGGCTTGATATTCCGATAAGTC
VirB01TTCTACCATCAATCTCCCTTCC897This study
IpaAFwdGTATCTAGCGCCCTCAGCAAG
IpaHFGCGTTCCTTGACCGCCTTTCCGATACCG628This study
IpaHRCTTTCAGCCGGTCAGCCACCCTCTGAGAG
Stx1R2AGCGAATGACATTCAGCGAATCTA1,059This study
Phage_stxR2GACGCCATACAAGGAGTC
Stx1F2ACGCCTGATTGTGTAACTGGAAA1,333This study
Phage_stx1F2CACTCGCGTCACTGTATG
Stx_phage_upGACCGCACACTGTGCTATC1,155This study
S1742 upCCGTGCGGGTATTTAACAATAATGG
Stx_phage_dnAGTCAAACCGCGCTATTGG1,224This study
S1742 dnTGCATGACAGAGGCAATAAACCCGAT
RecAko-site1GCTATCGACGAAAACAAACAGAAAGCGTTGGCGGCAGCACTGGGCCAGATTGTGTAGGCTGGAGCTGCTTC1,609This study
RecAko-site2AAAATCTTCGTTAGTTTCTGCTACTCCTTCGCTGTCATCTACAGAGAAATCCATATGAATATCCTCCTTA
RecA-1ACATATTGACTATCCGGTATTACCCGG1,148, 1,701*This study
RecA-3GACCGTCCGTGCACACATTATCTATT

*Amplicon sizes for wild-type recA or insertion of kan cassette into recA, respectively.

*Amplicon sizes for wild-type recA or insertion of kan cassette into recA, respectively.

Construction of recA Mutants

recA was replaced with a kanamycin-resistance cassette by using λ red recombination (). Primers RecAko-site1 and RecAko-site2 were used to amplify kan from pKD4 with 5′ and 3′ overhangs homologous to internal regions of recA. Kanamycin-resistant colonies of BS766 () were double purified and screened by PCR with primers RecA-1/RecA-3 for detection of the size difference between chromosomal recA and the kanamycin-resistance cassette. This mutant was used as the donor for growing a P1L4 lysate, which was used to transduce the recA::kan mutation into BS937, BS938, and BS974. Kanamycin-resistant transductants were purified and confirmed by use of PCR, as described above.

Cytotoxicity Assay

The cytotoxicity of bacterial samples for Vero cells was determined as previously described (,). In brief, 100 μL of diluted samples was overlain in 96-well plates containing confluent monolayers of Vero cells and incubated for 48 hours at 37°C in 5% CO2. Viable cells were fixed with 10% formalin and stained with 0.13% crystal violet. The optical density (OD) of the stained wells was measured at 630 nm by using a BioTek (Winooski, VT, USA) EL800 spectrophotometric plate reader. The CD50 (cytotoxic dose that kills 50% of the cells) was calculated by determining the inverse dilution of the bacterial sample that was required to kill 50% of the Vero cells.

In Vitro Neutralization of Stx1a

Overnight supernatants were serially diluted 10-fold in medium. We mixed 100 μL of diluted samples with 100 μL medium, a 1:25 dilution of F45 polyclonal anti-Stx1/Stx1a antiserum (,), or a 1:25 dilution of rabbit polyclonal antiserum against S. flexneri whole cell lysate. Toxin samples were incubated with antibody for 2 hours at 37°C in 5% CO2. We then applied 100 μL of the toxin–antibody mixture to Vero cells and incubated as above.

Mitomycin C Induction of Bacterial Lysis, Shiga Toxin 1a Production, and Prophage Induction

Overnight cultures of bacteria were inoculated 1:100 into Tryptic Soy Broth, and 2 hours after inoculation a final volume of 0.5 μg/mL mitomycin C (Sigma, St. Louis, MO, USA) was added to the cultures. To monitor the induction of bacterial lysis, we read the OD600 hourly over a period of 8 hours. Induction of bacterial lysis was noted as a 3-4–fold decrease in OD600 compared with the stx-negative control strains. To determine the effect of mitomycin C on production of Stx1a and prophage induction, we collected whole cell lysates and supernatants 3 hours after addition of mitomycin C. Samples were then analyzed for cytotoxicity on Vero cells. For isolation of phage particles, supernatants were prepared similarly, except that a final concentration of 10 mmol/L MgSO4 and a drop of chloroform were added after centrifugation. As described previously, 100 μL of phage lysate was absorbed onto 200 μL of E. coli MG1655 for 20 minutes at 37°C (). Molten L-agar top agar () containing 10 mmol/L MgSO4 was added to the phage/bacteria mixture and poured onto L-agar plates. Plates were incubated overnight at 37°C, and plaque-forming units (PFUs) were counted.

Isolation of Lysogens

Supernatants containing phage were prepared from mitomycin C–induced culture of BS937. Phage lysate was spotted onto an L-soft agar overlay containing either E. coli MG1655 or S. flexneri 2457T and incubated overnight at 37°C. A loop from the zone of clearing was streaked for isolation of single colonies, which were subsequently screened for stx genes by PCR. Positive colonies from the initial screening were double colony purified, and PCR was repeated to ensure that the colonies were positive for stx. MG1655 lysogens were confirmed to not be contaminates of the donor strain, BS937, by testing for S. flexneri chromosomal and virulence plasmid genes by use of PCR primer pairs IpaHF/IpaHR and VirB01/IpaFWD (Table 2), respectively. Similarly, 2457T lysogens were analyzed by PCR as described above. Two independently isolated lysogens of MG1655 and 2457T were used for further analysis.

Virulence Assays

Virulence-associated phenotypes were determined by a gentamicin protection invasion assay in HeLa cells and by plaque formation in L2 monolayers, as previously described (,). Both assays were conducted 3 independent times and included technical duplicates or triplicates in each individual experiment.

Whole-Genome Sequencing

DNA was isolated from overnight cultures by using a QIAGEN DNEasy Kit (Valencia, CA, USA). Samples were prepared for sequencing by using a Nextera XT DNA Sample Preparation Kit (Illumina, San Diego, CA, USA) and sequenced on an Illumina MiSeq sequencing system. The phage sequence was assembled by mapping the reads to the reference phage NC_004913.2 by using Bowtie 2 version 2.1.0 (http://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.1.0/).

Nucleotide Sequence Accession Number

The complete phage sequence of ϕPOC-J13 from strain BS937 was submitted to GenBank. The sequence is available under accession no. KJ603229.

Results

Identification and Epidemiology of stx-positive S. flexneri 2 Strains

BS937 and BS938 (Table 1) were acquired from the Hawaii and Massachusetts state laboratories, which had determined the isolates to be positive for stx by PCR. Both strains shared the same pulsed-field gel electrophoresis (PFGE) XbaI pattern, JZXX01.0357, as indicated in the Centers for Disease Control and Prevention PulseNet database (http://www.cdc.gov/pulsenet). To identify other clinical isolates of S. flexneri 2 that might be stx-positive, we searched the PulseNet database for strains that matched this PFGE pattern. From state public health laboratories, we obtained 18 additional strains of S. flexneri that matched this PFGE pattern. We also received time-matched, but not PFGE-matched, strains of S. flexneri as negative controls. Six additional strains that had been confirmed to be stx-positive S. flexneri were acquired from the Centers for Disease Control and Prevention. Clinical strains included in this study and their sources are listed in Table 1. The stx-positive S. flexneri strains had been isolated over 13 years (2001–2013). They were isolated during all months except August, indicating that seasonality is not involved in the emergence and/or spread of stx-encoding S. flexneri. Among patients from whom stx-positive S. flexneri strains were isolated, no incidences of HUS were reported, suggesting that the stx-positive S. flexneri strains did not cause more severe disease than would typically be caused by such strains lacking stx. Among 22 patients for whom travel information was available, 9 reported no foreign travel or knowledge of contact with persons who had traveled. The 13 patients who reported travel had all recently visited Hispañiola or interacted with a traveler who had returned from this region (Table 1).

Verification of Stx1a in S. flexneri Isolates

The presence of stx in the S. flexneri strains was confirmed by PCR (data not shown). All isolates that matched PFGE pattern JZXX01.0357 or had previously been shown to encode stx yielded a PCR product of the correct size for the toxin gene. PCR analysis for stx did not produce a product. The 3 negative controls did not generate a PCR product for either stx or stx. To determine if Stx1a was released from the bacteria, we tested supernatants from overnight cultures in a Vero cell cytotoxicity assay. All stx-positive isolates released a toxin into the supernatant, which killed Vero cells. To confirm that the toxin responsible for killing the cells was Stx1a, we tested overnight supernatants from 3 representative isolates for Vero cell cytotoxicity after neutralization by anti-Stx/Stx1a antiserum. After neutralization, supernatants were no longer cytotoxic to Vero cells (Figure 1). These findings demonstrate that the extracellular product responsible for cytotoxicity to Vero cells is indeed Stx1a and not a different protein being released by the stx-expressing S. flexneri.
Figure 1

Shiga toxin 1a (Stx1a) is produced and released from stx1a–encoding Shigella flexneri isolates. Overnight supernatants from BS937, BS938, and BS974 were serially diluted 10-fold in medium alone, medium containing anti-Stx/Stx1a antiserum, or antiserum against whole cell lysates of S. flexneri. After 2 hours of incubation, samples were analyzed in a Vero cell cytotoxicity assay. Stx from S. dysenteriae 1 was included as a positive control. CD50/mL is defined as the reciprocal of the dilution of Stx1 that kills 50% of Vero cells. *CD50/mL was below the level of detection. Data are averages of 3 independent experiments. Error bars indicate standard error. α indicates anti.

Shiga toxin 1a (Stx1a) is produced and released from stx1a–encoding Shigella flexneri isolates. Overnight supernatants from BS937, BS938, and BS974 were serially diluted 10-fold in medium alone, medium containing anti-Stx/Stx1a antiserum, or antiserum against whole cell lysates of S. flexneri. After 2 hours of incubation, samples were analyzed in a Vero cell cytotoxicity assay. Stx from S. dysenteriae 1 was included as a positive control. CD50/mL is defined as the reciprocal of the dilution of Stx1 that kills 50% of Vero cells. *CD50/mL was below the level of detection. Data are averages of 3 independent experiments. Error bars indicate standard error. α indicates anti.

Effects of Mitomycin C on Stx1a and Prophage Production

stx is generally found encoded by functional prophages (). The prophage lytic cycle can be induced with DNA damaging agents (); therefore, to address whether the toxin carried in stx-encoding S. flexneri was associated with a prophage, we tested sensitivity to lysis when grown in the presence of mitomycin C. All Stx1a-producing S. flexneri isolates showed a sharp decrease in OD600 within 3–4 hours after addition of mitomycin C, whereas the stx-negative strains showed no decrease in OD600 (data not shown). Because all stx-encoding S. flexneri isolates behaved similarly in the assays, we selected 3 isolates (BS937, BS938, and BS974) to characterize more thoroughly. To further investigate the response to mitomycin C, we grew log-phase cultures and collected samples to measure cell-associated and released toxin. Supernatants and whole cell lysates from bacteria treated with mitomycin C exhibited elevated cytotoxicity to Vero cells (Figure 2). To determine if Stx1a–producing S. flexneri generated infectious phage, we analyzed supernatants from untreated and mitomycin C–treated cultures in a PFU assay. After treatment with mitomycin C, PFUs in supernatants of BS937, BS938, and BS974 increased ≈1,000-fold (Figure 3).
Figure 2

Mitomycin C induces production of Shiga toxin 1a (Stx1a) in a recA-dependent manner. Exponentially growing cultures of the indicated parental strains or recA mutants were grown with or without 0.5 μg/mL mitomycin C (mito C) for 3 hours. Supernatants (A) or whole cell lysates (B) were prepared for determination of cytotoxicity for Vero cells. CD50/mL values were determined as described in Figure 1. Data are averages of 3 biological replicates. Error bars indicate standard error. Δ indicates samples that are recA mutants.

Figure 3

Infectious phage in the supernatants of Shiga toxin 1a gene (stx)–encoding Shigella flexneri are induced with mitomycin C (mito C) treatment. Supernatants were collected from exponential cultures of BS937, BS938, and BS974 grown with or without 0.5 μg/mL mito C for 3 h. The number of infectious phage particles was determined by a soft agar overlay method that used Escherichia coli MG1655 as the recipient. Plaque forming units (PFUs) of phage lysate were counted after 24 h incubation. Data are averages of 3 independent experiments. Error bars indicate standard error.

Mitomycin C induces production of Shiga toxin 1a (Stx1a) in a recA-dependent manner. Exponentially growing cultures of the indicated parental strains or recA mutants were grown with or without 0.5 μg/mL mitomycin C (mito C) for 3 hours. Supernatants (A) or whole cell lysates (B) were prepared for determination of cytotoxicity for Vero cells. CD50/mL values were determined as described in Figure 1. Data are averages of 3 biological replicates. Error bars indicate standard error. Δ indicates samples that are recA mutants. Infectious phage in the supernatants of Shiga toxin 1a gene (stx)–encoding Shigella flexneri are induced with mitomycin C (mito C) treatment. Supernatants were collected from exponential cultures of BS937, BS938, and BS974 grown with or without 0.5 μg/mL mito C for 3 h. The number of infectious phage particles was determined by a soft agar overlay method that used Escherichia coli MG1655 as the recipient. Plaque forming units (PFUs) of phage lysate were counted after 24 h incubation. Data are averages of 3 independent experiments. Error bars indicate standard error. Induction of the prophage lytic cycle by mitomycin C is caused by the SOS response (). During the SOS response, the bacterial protease RecA becomes active and cleaves the phage repressor cI, which maintains the phage in a quiescent state under non-SOS conditions. Cleavage of cI enables transcription of the phage antiterminator Q, which activates the late phage genes, including stx (). STEC recA mutants no longer release toxin or respond to agents that trigger the SOS response (,,). To investigate whether similar regulation occurs in Stx1a-producing S. flexneri, we constructed recA deletions in BS937, BS938, and BS974. recA mutants were cultured with mitomycin C as above, and samples were collected to measure the presence of toxin and phage. In the absence of mitomycin C, the recA mutants produced and released toxin in amounts comparable to those of the parental strains; however, when cultured with mitomycin C, the recA mutants did not exhibit increased cytotoxicity to Vero cells (Figure 2). Additionally, in the absence or presence of mitomycin C, no PFUs were enumerated from the recA mutants. Collectively, these data suggest that stx in S. flexneri is carried by a lambdoid prophage.

stx Carriage by a Lambdoid Prophage in S. flexneri

To identify the location of stx, we sequenced BS937, BS938, and BS974. Whole-genome sequencing confirmed that stx was encoded within a 62-kb lambdoid prophage. To extend the analysis to all the clinical isolates in this study, we used the PCR strategy and primer design shown in Figure 4. To ensure that stx in all isolates was phage encoded, we designed primers to amplify from stxA and stxB (encoding subunits A and B of Stx1a) and 1 kb either upstream or downstream of the stx operon. All stx-positive strains yielded a PCR product consistent with the toxin being phage encoded. No DNA was amplified from the stx-negative isolates.
Figure 4

Schematic of PCR designed to determine that Shiga toxin 1a gene (stx) is phage encoded and inserted into the S1742 locus of Shigella flexneri. The genetic map shows the insertion of ϕPOC-J13 into locus S1742 of stx-encoding S. flexneri. Location and direction of the primers used for PCR analyses are indicated. The top part of the figure indicates the genes flanking the stx1a operon. Q, antiterminator; A and B, Stx1a subunits that form the assembled toxin (A is the stx1aA subunit and B is the stx1aB subunit); yshS, a hypothetical protein that shares homology with yjhS from Escherichia coli K-12; orf, open reading frame; S, gene that encodes the phage holin; R, gene that encodes the phage endolysin.

Schematic of PCR designed to determine that Shiga toxin 1a gene (stx) is phage encoded and inserted into the S1742 locus of Shigella flexneri. The genetic map shows the insertion of ϕPOC-J13 into locus S1742 of stx-encoding S. flexneri. Location and direction of the primers used for PCR analyses are indicated. The top part of the figure indicates the genes flanking the stx1a operon. Q, antiterminator; A and B, Stx1a subunits that form the assembled toxin (A is the stx1aA subunit and B is the stx1aB subunit); yshS, a hypothetical protein that shares homology with yjhS from Escherichia coli K-12; orf, open reading frame; S, gene that encodes the phage holin; R, gene that encodes the phage endolysin. Whole-genome sequencing revealed that the phage was inserted into locus S1742 (which encodes a putative oxidoreductase) of the S. flexneri chromosome. Primers were designed (Figure 4) to determine if the stx-encoding phage inserted into S1742 for all isolates. All stx-positive strains generated the expected PCR product when amplified with primers specific for the early phage sequence and upstream of S1742 and with primers directed to the late phage sequence and downstream of S1742. None of the stx-negative strains yielded an amplified product with the primer pairs. A representative gel of the 4 amplifications for 1 stx-negative and 6 stx-positive isolates is shown in Figure 5. These data suggest that a phage has integrated into all stx-positive isolates. We named this stx-encoding phage ϕPOC-J13.
Figure 5

PCR results from representative clinical isolates illustrate that the Shiga toxin 1a gene (stx) is phage encoded and inserted into the S1742 locus of Shigella flexneri. PCRs based on the primer scheme detailed in Figure 4 are shown for 6 stx-positive strains (BS937, BS938, BS942, BS954, BS974, BS980) and 1 stx-negative isolate (BS952). To show that stx is phage encoded, we used primer pairs Stx1R2/Phage_stxR2 (A) and Phage_stx1F2.Stx1F2 (B). To analyze the insertion of ϕPOC-J13 into locus S1742, we used primer pairs S1742_up/Stx_phage_up (C) and Stx_phage_dn/S1742_dn (D).

PCR results from representative clinical isolates illustrate that the Shiga toxin 1a gene (stx) is phage encoded and inserted into the S1742 locus of Shigella flexneri. PCRs based on the primer scheme detailed in Figure 4 are shown for 6 stx-positive strains (BS937, BS938, BS942, BS954, BS974, BS980) and 1 stx-negative isolate (BS952). To show that stx is phage encoded, we used primer pairs Stx1R2/Phage_stxR2 (A) and Phage_stx1F2.Stx1F2 (B). To analyze the insertion of ϕPOC-J13 into locus S1742, we used primer pairs S1742_up/Stx_phage_up (C) and Stx_phage_dn/S1742_dn (D).

Lysogeny of Laboratory Strains of E. coli and S. flexneri with ϕPOC-J13

E. coli MG1655 and S. flexneri 2457T were lysogenized as described earlier. To test for production and release of Stx1a, we examined whole cell lysates and supernatants from overnight cultures of MG1655 and 2457T lysogens in Vero cell cytotoxicity assays. The average CD50/mL of supernatants from MG1655 and 2457T lysogens was 1 ×105, similar to that of the stx-positive S. flexneri clinical isolates. Lysogens were also tested for the presence of phage in supernatants of overnight cultures by determining PFUs. The 2457T lysogens released ≈106 PFUs/mL; however, no viable phage could be recovered from MG1655 lysogens. To confirm that stx in the lysogens was phage associated, we conducted PCR amplification as described above (Figure 4). The MG1655 and 2457T lysogens yielded a PCR product that indicated that the phage regions upstream and downstream of stx were present. Lysogens were also tested for integration of the phage into locus S1742 by use of the primers illustrated in Figure 4. In 2457T lysogens, ϕPOC-J13 inserted into S1742 and produced a PCR product of the expected size. Similarly, in lysogens of MG1655, ϕPOC-J13 inserted into ynfG, the E. coli S1742 homologue. These findings demonstrate that the integration of ϕPOC-J13 is site specific, as has been shown for other lambdoid prophages ().

Virulence Phenotypes of Shiga Toxin 1a–producing S. flexneri

We wanted to determine if the presence of ϕPOC-J13 altered the virulence phenotypes associated with S. flexneri. Invasion and plaquing efficiencies of BS937, BS938, and BS974 were compared with those of laboratory strain 2457T (Table 3). BS938 and BS974 exhibited similar invasion efficiency as 2457T; however, invasion with BS937 was significantly higher. All 3 Stx1a–producing S. flexneri isolates showed plaquing efficiency comparable to that of 2457T, and the plaque diameters were consistent among all strains. Although it is unclear why BS937 was more invasive, the comparable level of cell-to-cell spread suggests that ϕPOC-J13 does not appreciably alter the virulence properties of S. flexneri.
Table 3

Virulence properties of Shigella flexneri strains

StrainInvasion, % ± SE*Plaquing efficiency, % ±SE†
2457T0.35 ± 0.044.34 ± 0.63
BS9371.24 ± 0.273.22 ± 0.56
BS9380.22 ± 0.034.34 ± 0.79
BS9740.40 ± 0.093.24 ± 0.44

Number of colony-forming units (CFUs) recovered from HeLa cells after gentamicin protection divided by the input CFUs.
†Number of plaques formed on L2 monolayers divided by the input CFUs.

Number of colony-forming units (CFUs) recovered from HeLa cells after gentamicin protection divided by the input CFUs.
†Number of plaques formed on L2 monolayers divided by the input CFUs.

Discussion

Bacteriophages are recognized for their contribution to the genetic diversity of bacteria and for their capacity to transfer virulence factors (). It was first noted in the early 1980s that stx in E. coli was encoded by a lambdoid bacteriophage (,). We have identified a new stx-encoding bacteriophage, ϕPOC-J13, from clinical isolates of S. flexneri. Generally, the acquisition of toxin genes is thought to increase the virulence of a bacterial species. However, according to the available clinical data and our in vitro virulence assays, the production of Stx1a in S. flexneri does not seem to increase pathogenicity within the host. Characterization of ϕPOC-J13 determined that it behaves similarly to stx-encoding phages found in STEC; however, some differences are notable. First, although ϕPOC-J13 responded to DNA damaging treatment by inducing the lytic cycle and induction was RecA-dependent, recA mutants of S. flexneri Stx1a–producing strains still maintained a level of Stx1a production and release comparable to that of the noninduced parental strains. In contrast, recA mutants of STEC produce a very low level of Stx, and the toxin that is present remains largely cell associated rather than being released into the supernatant (,,). One explanation for the differences in phenotype between Stx1a-producing S. flexneri recA mutants and the STEC mutants might be that all STEC recA mutants examined encoded stx; thus, the regulation of stx- and stx-encoding phages might vary. Additionally, although Stx1a was produced in S. flexneri recA mutants, viable phage particles were not recovered. stx has an upstream promoter that is not dependent on induction of the phage lytic cycle (). A similar promoter might be responsible for the baseline level of Stx1a produced in the S. flexneri recA mutants and would explain the lack of infectious phage in the mutants. ϕPOC-J13 lysogenized laboratory strains of E. coli and S. flexneri. Viable phage particles were recovered from the supernatants of 2457T lysogens but not from those of MG1655 lysogens, even though Stx1a was produced and released by lysogens of both species. This result might suggest that the stability and/or assembly of ϕPOC-J13 varies according to the host bacterium. Host differences in the regulation of ϕPOC-J13 might also account for the discrepancies between the recA mutants of Stx1a-producing S. flexneri and STEC. Our future studies will compare the differences in regulation of stx in ϕPOC-J13 with that of known STEC phages. Another aspect of these stx-encoding S. flexneri isolates is their potential epidemiological link to Hispañiola. Although some patients reported no travel, ≈60% reported travel to this region or interaction with a traveler returning from this region. Most of our clinical isolates came from public health laboratories in the eastern United States, suggesting a possible focus in that area. However, the large number of isolates from the eastern United States might simply reflect the large Haitian immigrant population in this region and the resultant frequent travel to Haiti (). Nevertheless, further surveillance of Stx1a–producing S. flexneri is warranted to determine the extent of their emergence in Hispañiola. The epidemiological link to Hispañiola generates many questions about what has led to the emergence of these strains. The earliest Stx1a–producing S. flexneri isolates pre-date the earthquake that struck Haiti in January 2010. Thus, this natural disaster is not linked to the presence of stx-encoding S. flexneri in the region. One possibility is that the ecosystem in Hispañiola is favorable for the acquisition of ϕPOC-J13 by S. flexneri and possibly other Shigella species. An environmental reservoir of Shigella spp. has never been identified; therefore, it is tempting to speculate that production of Stx1a might give S. flexneri a survival advantage in the aquatic environment. In accordance with this hypothesis, studies on the survival of Shigella spp. in amebae indicate that S. dysenteriae 1 can persist longer than S. flexneri within Acanthamoeba castellanii (,). In addition, Stx–producing bacteria can kill the protozoan Tetrahymena thermophile to avoid consumption by this predator (). Thus, Stx1a might benefit S. flexneri by providing a defense against eukaryotic predators. It will be important to study clinical isolates of other Shigella species and bacterial genera to determine whether they also harbor ϕPOC-J13; we expect that the occurrence of this stx-encoding phage will be more widespread. Although toxin production in S. flexneri did not suggest an increase in pathogenicity, the consequences of the emergence of such Stx1a–producing strains are impossible to predict. Future studies that address these questions will provide a better understanding of the emergence of stx-encoding S. flexneri.
  34 in total

1.  Isolation of Shigella sonnei lysogenic for a bacteriophage encoding gene for production of Shiga toxin.

Authors:  L Beutin; E Strauch; I Fischer
Journal:  Lancet       Date:  1999-05-01       Impact factor: 79.321

Review 2.  Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion.

Authors:  Harald Brüssow; Carlos Canchaya; Wolf-Dietrich Hardt
Journal:  Microbiol Mol Biol Rev       Date:  2004-09       Impact factor: 11.056

Review 3.  Shigellosis: recent progress, persisting problems and research issues.

Authors:  G T Keusch; M L Bennish
Journal:  Pediatr Infect Dis J       Date:  1989-10       Impact factor: 2.129

4.  Functional and genetic analysis of regulatory regions of coliphage H-19B: location of shiga-like toxin and lysis genes suggest a role for phage functions in toxin release.

Authors:  M N Neely; D I Friedman
Journal:  Mol Microbiol       Date:  1998-06       Impact factor: 3.501

5.  OspF and OspC1 are Shigella flexneri type III secretion system effectors that are required for postinvasion aspects of virulence.

Authors:  Daniel V Zurawski; Chieko Mitsuhata; Karen L Mumy; Beth A McCormick; Anthony T Maurelli
Journal:  Infect Immun       Date:  2006-10       Impact factor: 3.441

6.  Characterization of a shiga toxin 2e-converting bacteriophage from an Escherichia coli strain of human origin.

Authors:  M Muniesa; J Recktenwald; M Bielaszewska; H Karch; H Schmidt
Journal:  Infect Immun       Date:  2000-09       Impact factor: 3.441

7.  Shiga toxin as a bacterial defense against a eukaryotic predator, Tetrahymena thermophila.

Authors:  William Lainhart; Gino Stolfa; Gerald B Koudelka
Journal:  J Bacteriol       Date:  2009-06-05       Impact factor: 3.490

8.  Cloning and sequencing of the genes for Shiga toxin from Shigella dysenteriae type 1.

Authors:  N A Strockbine; M P Jackson; L M Sung; R K Holmes; A D O'Brien
Journal:  J Bacteriol       Date:  1988-03       Impact factor: 3.490

9.  Acanthamoeba castellanii an environmental host for Shigella dysenteriae and Shigella sonnei.

Authors:  Amir Saeed; Hadi Abd; Benjamin Edvinsson; Gunnar Sandström
Journal:  Arch Microbiol       Date:  2008-08-20       Impact factor: 2.552

10.  Temperature Depended Role of Shigella flexneri Invasion Plasmid on the Interaction with Acanthamoeba castellanii.

Authors:  Amir Saeed; David Johansson; Gunnar Sandström; Hadi Abd
Journal:  Int J Microbiol       Date:  2012-02-28
View more
  24 in total

1.  In Silico Serotyping Based on Whole-Genome Sequencing Improves the Accuracy of Shigella Identification.

Authors:  Yun Wu; Henry K Lau; Teresa Lee; David K Lau; Justin Payne
Journal:  Appl Environ Microbiol       Date:  2019-03-22       Impact factor: 4.792

Review 2.  The genomic signatures of Shigella evolution, adaptation and geographical spread.

Authors:  Hao Chung The; Duy Pham Thanh; Kathryn E Holt; Nicholas R Thomson; Stephen Baker
Journal:  Nat Rev Microbiol       Date:  2016-02-29       Impact factor: 60.633

3.  Prevalence of Shiga toxin-producing Shigella species isolated from French travellers returning from the Caribbean: an emerging pathogen with international implications.

Authors:  M D Gray; D W Lacher; S R Leonard; J Abbott; S Zhao; K A Lampel; E Prothery; M Gouali; F-X Weill; A T Maurelli
Journal:  Clin Microbiol Infect       Date:  2015-05-14       Impact factor: 8.067

4.  Distribution and characterization of Shiga toxin converting temperate phages carried by Shigella flexneri in Hispaniola.

Authors:  Marta Fogolari; Carla Mavian; Silvia Angeletti; Marco Salemi; Keith A Lampel; Anthony T Maurelli
Journal:  Infect Genet Evol       Date:  2018-07-31       Impact factor: 3.342

5.  Polymorphism of CRISPR shows separated natural groupings of Shigella subtypes and evidence of horizontal transfer of CRISPR.

Authors:  Chaojie Yang; Peng Li; Wenli Su; Hao Li; Hongbo Liu; Guang Yang; Jing Xie; Shengjie Yi; Jian Wang; Xianyan Cui; Zhihao Wu; Ligui Wang; Rongzhang Hao; Leili Jia; Shaofu Qiu; Hongbin Song
Journal:  RNA Biol       Date:  2015-09-01       Impact factor: 4.652

Review 6.  Ecology, Structure, and Evolution of Shigella Phages.

Authors:  Sundharraman Subramanian; Kristin N Parent; Sarah M Doore
Journal:  Annu Rev Virol       Date:  2020-05-11       Impact factor: 10.431

Review 7.  The Evasive Enemy: Insights into the Virulence and Epidemiology of the Emerging Attaching and Effacing Pathogen Escherichia albertii.

Authors:  Shantanu Bhatt; Marisa Egan; Brian Critelli; Andrew Kouse; Daniel Kalman; Chirag Upreti
Journal:  Infect Immun       Date:  2018-12-19       Impact factor: 3.441

8.  Fighting Shigella by Blocking Its Disease-Causing Toxin.

Authors:  Diksha Haksar; Mostafa Asadpoor; Torben Heise; Jie Shi; Saskia Braber; Gert Folkerts; Lluis Ballell; Janneth Rodrigues; Roland J Pieters
Journal:  J Med Chem       Date:  2021-04-28       Impact factor: 7.446

9.  Insights into the genome architecture and evolution of Shiga toxin encoding bacteriophages of Escherichia coli.

Authors:  Graça Pinto; Marta Sampaio; Oscar Dias; Carina Almeida; Joana Azeredo; Hugo Oliveira
Journal:  BMC Genomics       Date:  2021-05-19       Impact factor: 3.969

10.  Species-wide whole genome sequencing reveals historical global spread and recent local persistence in Shigella flexneri.

Authors:  Thomas R Connor; Clare R Barker; Kate S Baker; François-Xavier Weill; Kaisar Ali Talukder; Anthony M Smith; Stephen Baker; Malika Gouali; Duy Pham Thanh; Ishrat Jahan Azmi; Wanderley Dias da Silveira; Torsten Semmler; Lothar H Wieler; Claire Jenkins; Alejandro Cravioto; Shah M Faruque; Julian Parkhill; Dong Wook Kim; Karen H Keddy; Nicholas R Thomson
Journal:  Elife       Date:  2015-08-04       Impact factor: 8.140

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.