Primers for low-copy nuclear genes in the Hawaiian endemic Clermontia (Campanulaceae) and cross-amplification in Lobelioideae.

PREMISE OF THE STUDY: Primers were developed to amplify 12 intron-less, low-copy nuclear genes in the Hawaiian genus Clermontia (Campanulaceae), a suspected tetraploid. • METHODS AND
RESULTS: Data from a pooled 454 titanium run of the partial transcriptomes of seven Clermontia species were used to identify the loci of interest. Most loci were amplified and sequenced directly with success in a representative selection of lobeliads even though several of these loci turned out to be duplicated. Levels of variation were comparable to those observed in commonly used plastid and ribosomal markers. •
CONCLUSIONS: We found evidence of a genome duplication that likely predates the diversification of the Hawaiian lobeliads. Some genes nevertheless appear to be single-copy and should be useful for phylogenetic studies of Clermontia or the entire Lobelioideae subfamily.

Although phylogenetic studies of plants rely heavily on plastid and nuclear ribosomal loci, the limitations of these loci are well known. Plastid loci are uniparentally inherited and susceptible to chloroplast capture (Rieseberg and Soltis, 1991). Furthermore, their low variation is particularly problematic for investigations of recent radiations such as those in the Hawaiian Islands, and indeed these markers have provided only limited resolution there. Nuclear ribosomal loci are subject to complex concerted evolution (Alvarez and Wendel, 2003), which can be incomplete so that multiple ancient alleles are maintained within a single individual, or rapid such that traces of hybridization are quickly erased. As a result, both plastid and ribosomal markers provide only incomplete information when hybridization is common.

The genus Clermontia Gaudich. (Campanulaceae, subfamily Lobelioideae) comprises 22 species endemic to Hawai‘i, 13 of which are on the IUCN Red List of Threatened Species. Species identification in the field is often difficult, particularly in the absence of flowers, and apparent hybrids can be common. Clermontia and other Hawaiian lobeliads (six genera total) form a monophyletic clade that represents the largest plant radiation in Hawai‘i (Givnish et al., 2009). The members of this clade, as well as the members of clade 4 of Antonelli (2008), in which the Hawaiian clade is nested, are suspected paleotetraploids (Lammers, 1988). To find genetic markers that will be useful for phylogenetics and DNA barcoding within Clermontia, we used 454 data of partial cDNA libraries to design primers for single-exon nuclear loci in Clermontia and then tested their cross-amplification in Campanulaceae.

METHODS AND RESULTS

We obtained a pooled, partial transcriptome library from leaf and floral buds (fixed in the field in RNAlater [QIAGEN, Gaithersburg, Maryland, USA] and stored at −80°C) of seven taxa: Clermontia arborescens (H. Mann) Hillebr., C. clermontioides (Gaudich.) A. Heller, C. fauriei H. Lév., C. kakeana Meyen, C. kohalae Rock, C. parviflora Gaudich. ex A. Gray, and C. peleana Rock. RNA isolation, cDNA synthesis, and 454 sequencing were done at the University of Arizona Genetics Core Laboratory. The 454 run provided 1.4 million reads with an average length of 395 bp. 454 adapters, ribosomal RNA, and low-quality and low-complexity sequences were removed/trimmed using SeqClean (http://compbio.dfci.harvard.edu/tgi/software/), and each taxon was assembled separately by the TGI Clustering tools (TGICL; Pertea et al., 2003), using default settings. We conducted BLAST searches of the 400 most highly expressed genes in Arabidopsis (C. Fizames, personal communication) against our data in CLC DNA Workbench (CLC bio, Aarhus, Denmark) to identify a set of genes with high coverage within each of all or most of the species. We selected loci (generally only a small portion of a gene) that comprised a single, long exon (200 bp) with matches in multiple species, and designed primers with FastPCR (PrimerDigital Ltd., Helsinki, Finland; http://www.primerdigital.com/fastpcr.html) for their amplification using default settings. The presence of introns was tested by comparison with genomic and cDNA sequences in the Arabidopsis Information Resource database (www.arabidopsis.org). Avoiding introns allowed the direct sequencing of accessions even in the case of gene duplications; introns often contained indels, which often resulted in alleles of different lengths in heterozygotes or among copies of duplicated genes. Twelve exon regions were identified (Table 1, Appendix 1) and were tested on seven accessions: C. fauriei (the earliest diverging species within the genus), C. arborescens, C. kakeana, Cyanea asplenifolia Hillebr. (Cyanea is a Hawaiian endemic genus and putative sister group of Clermontia; Givnish et al., 2009), Hippobroma longiflora (L.) G. Don (belonging to a different major clade of Lobelioideae and a likely tetraploid; Antonelli, 2008), Lobelia erinus L. (one of the earliest diverging Lobelioideae; Antonelli, 2008), and Campanula persicifolia L. (Campanuloideae). Leaf material was collected in the field and dried in silica gel, and genomic DNA was extracted using the Nucleospin Plant II Kit (Macherey-Nagel, Düren, Germany). The nuclear regions were amplified using the following mix: 12.3 μL of H2O, 4 μL of GoTaq 5× Buffer (Promega Corporation, Madison, Wisconsin, USA), 2 μL of MgCl2 25 mM, 0.4 μL of dNTP 1.25 μM, 0.2 μL of each primer 10 μM, 0.1 μL of GoTaq Flexi DNA polymerase 5 U/μL (Promega Corporation), and 0.8 μL of DNA template. The following amplification program was used: 2 min at 94°C; 38 cycles of 1 min at 94°C, 1 min at 63°C, and 1 min at 72°C; and a final extension of 5 min at 72°C. PCR products were sequenced directly at the Core Genetics Laboratory at the University of Hawai‘i Hilo. The identity of each amplified gene was validated through BLAST or tBLASTx (Clerm4, Clerm10) searches in GenBank. In every case, the 10 best matches (identities >80%) were either the same gene from a different species or a gene that was not yet annotated.

Table 1.

Identity of the 12 intron-less, low-copy nuclear genes identified in this study, with primer sequences, results from cross-amplification tests, and inference of putative gene duplication.

Gene	Putative Arabidopsis homolog	Putative product	Forward primer sequence (5′–3′)	Reverse primer sequence (5′–3′)	Length (bp)	Failed sequences	Duplication in Hawai‘i
Clerm1	At1g14320	RPL10 (ribosomal protein)	GACCTGCTAGGTGTTACCGT	ATCTTCTGACGACCAGGGA	484		yes
Clerm2	At1g61520	Lhca*3 (chlorophyll-binding protein)	TTGGATTCGACCCACTTGG	ACTTAAGGCTGGTCAGCAC	594	Campanula	no
Clerm3	At2g05070	Lhcb2.2 (chlorophyll-binding protein)	GGTGACTACGGATGGGACAC	CATCAGCCAGTCCAAGTGGGT	382		yes
Clerm4	At3g26520	TIP2 (tonoplast intrinsic protein)	GATGACATTCGGGCTGGTA	CAGTAGACCCAGTGGTTGG	210	Campanula	no
Clerm5	At4g18100	RPL32e (ribosomal protein)	ATTGATTCCCGGGTGAGAA	GTCACCACAACATCAAGCT	248	Campanula, Lobelia	Clermontia
Clerm6	At3g13920	EIF4-1 (translation initiation factor)	TTTGAGAAGCCCTCTGCAA	TTGCCTACGCAACATGTCAA	351		yes
Clerm7	At4g14880	ATCYS3-A (acetylserine(thiol)lyase)	TCTTATCGAACCAACAAGTGG	TCGGATTGGCAGGATTCTC	257		no
Clerm8	At5g05170	CESA3 (cellulose synthase)	AGAGCCATCGCAATTGGCTG	GCGAAATACCACTCTGGAGC	264		no
Clerm9	At3g23810	SAHH2 (S-adenosyl-l-homocysteine hydrolase)	CATGTCCTTAGCCGACTTCG	ACCATTAGCCTGCATTTGG	608		no
Clerm10	At1g79550	PGK (phosphoglycerate kinase)	GTCAAGATGGCAAATGATTGC	CCTTCAGTGGAAGCATGAGC	212		yes
Clerm11	At1g66580	SAG24 (senescence-associated gene/ribosomal protein L10e)	GACCTGCTAGGTGTTACCGT	CCCTCATACCAGTCTGGAGC	339		yes
Clerm12	At3g56940	Magnesium protoporphyrin IX monomethyl ester cyclase	TCTACACGACGGATTTCGAGG	TGAGGCGTCTACCAAGCTC	264		yes

Missing sequences are due to failed amplification (Clerm5), weak amplification (Clerm4), or amplification of a different gene (Clerm2).

All 12 nuclear regions were successfully amplified and sequenced in Clermontia, Cyanea, and Hippobroma; a single gene was not amplified in Lobelia erinus, and three could not be sequenced in Campanula (Table 1). A high number of ambiguous bases were found consistently in the forward and reverse sequences of some accessions, suggesting the presence of multiple gene copies. In five genes (Clerm1, Clerm6, Clerm10, Clerm11, Clerm12), ambiguous sites were identical across the three Clermontia species and Cyanea but absent in the other genera (example in Fig. 1). To confirm the hypothesis of gene duplication, we separated alleles computationally from the direct sequences using PHASE (default settings) within the software DnaSP (Librado and Rozas, 2009), and built a neighbor-joining tree of the alleles in SeaView (Gouy et al., 2010) with default settings. In each of these five cases, we recovered two clades, each comprising a single allele from each of the four Hawaiian lobeliad species examined (example in Appendix S1). This pattern strongly suggests a genome duplication event that predates the divergence of Clermontia and Cyanea. Clerm5 was duplicated in Clermontia but apparently not in Cyanea. This is the only gene for which direct sequences turned out to be difficult to read due to the divergence of the two gene copies, which may be due to the presence of an intron not present in Arabidopsis. Five genes (Clerm2, Clerm4, Clerm7, Clerm8, and Clerm9) behaved as single-copy genes in Clermontia. No recombination was detected in those genes using genetic algorithms for recombination detection (GARD; Kosakovsky Pond et al., 2006; http://www.datamonkey.org/). The percentage of variable sites within each of these genes was comparable to those of the plastid loci rbcL, matK, and psbA-trnH and the nuclear ribosomal ITS and ETS (Table 2). Genotyping of a broader taxonomic sample of Clermontia revealed a much greater number of variants at these newly described nuclear genes and a different pattern of evolution compared to plastid genes (Pillon et al., 2013).

Fig. 1.

Example of electropherograms for Clerm12 comparing Clermontia fauriei, Cyanea asplenifolia, and Hippobroma longiflora. Only the forward sequence is shown; asterisks indicate ambiguous sites. The matching positions of multiple ambiguous sites in Clermontia and Cyanea implicate an ancestral gene duplication prior to the divergence of these two genera rather than heterozygosity. Note: black = G; green = A; red = T; blue = C.

Table 2.

Comparison of variation of the five apparently nonduplicated nuclear genes with three plastid and two nuclear ribosomal loci.

Characteristic	Clerm2	Clerm4	Clerm7	Clerm8	Clerm9	rbcL	matK	psbA-trnH	ITS	ETS
Length (bp)	594	210	257	264	608	599	889	460–462	874–877	594–600
No. of variable sites	12	5	4	5	5	10	16	9	17	12
Percent variable sites	2.0	2.4	1.6	1.9	0.8	1.7	1.8	1.9	1.9	2.0
1st position (nonsynonymous)	2 (2)	1 (1)	0	1 (1)	0	3 (1)	9 (8)	NA	NA	NA
2nd position (nonsynonymous)	2 (2)	0	0	1 (1)	0	0	3 (3)	NA	NA	NA
3rd position (nonsynonymous)	8 (2)	4 (0)	4 (0)	3 (0)	5 (0)	7 (3)	4 (1)	NA	NA	NA
Indels	0	0	0	0	0	0	0	2	1	2

Note: NA = not applicable.

For each gene, variation was measured on a sample that included Clermontia fauriei, C. kakeana, C. arborescens, and Cyanea asplenifolia.

CONCLUSIONS

The selection of intron-less regions proved successful for the amplification and direct sequencing of several nuclear loci and the detection of duplicated genes. The large number of gene duplications shared between Clermontia and Cyanea strongly supports the hypothesis of whole-genome duplication that predates the diversification of the lobeliads in Hawai‘i. Whole genome duplication has similarly been demonstrated in Hawaiian silverswords (Barrier et al., 1999). Despite the genome duplication, we nevertheless identified a number of apparently single-copy genes, whether due to the loss of one copy in each case or the selectivity of our primers for one copy. Geographic and taxonomic patterns of variations of two of these markers within Clermontia are examined in a study of their potential use as DNA barcodes (Pillon et al., 2013).

Click here for additional data file.