Literature DB >> 25097499

Molecular characterization of methicillin-resistant Staphylococcus aureus isolated from tertiary care hospitals.

Atif H Asghar1.   

Abstract

BACKGROUND AND OBJECTIVES: Methicillin-resistant S. aureus (MRSA) tends to be resistant to multiple antibiotics. Methicillin resistance is conferred by the acquisition of the mecA gene, which is carried by a mobile genetic element called the staphylococcal cassette chromosome mec (SCCmec). There are five major types of SCCmec elements (I-V). The majority of hospital-acquired MRSA (HA-MRSA) strains carry SCCmec types I, II, or III, whereas community-acquired MRSA (CA-MRSA) strains carry SCCmec types IV or V. In addition, Panton-Valentine Leucocidin (PVL) is a gene encoding a powerful cytotoxin that is strongly associated with CA-MRSA strains. The present study was aimed to identify the types of SCCmec and PVL genes among clinical MRSA isolates.
METHODS: This study was conducted in 5 tertiary care hospitals in Makkah city from March to September of 2012. A total of 206 S. aureus clinical isolates were analysed using standard microbiological methods. Multiplex PCR was performed on genomic DNA from MRSA isolates in order to identify the types of SCCmec. In addition, PCR was performed to detect the PVL gene among the isolates.
RESULTS: Of the 206 S. aureus isolates, 114 (55.3%) were MRSA, and 100 of the MRSA isolates carried the mecA gene. RESULTS from SCCmec typing revealed that 3% were type I; 9% were type II; 47% were type III, and 29% were type IV. Nineteen per cent of the isolates harboured the PVL gene. Furthermore, there was a statistically significant correlation between the presence of the PVL gene and SCCmec type IV.
CONCLUSION: The virulence of MRSA strains is increasing in both hospital and community settings in Makkah, highlighting the importance of their rapid identification in order to appropriately control infection.

Entities:  

Keywords:  MRSA; PVL; SCCmec; Staphylococcus aureus; mecA

Year:  2014        PMID: 25097499      PMCID: PMC4121680          DOI: 10.12669/pjms.304.4946

Source DB:  PubMed          Journal:  Pak J Med Sci        ISSN: 1681-715X            Impact factor:   1.088


INTRODUCTION

Staphylococcus aureus (S. aureus) is an important human pathogen that is transmitted in both hospitals and the community. MRSA is a major challenge to hospitals all over the world due to the emergence and spread of isolates with decreased susceptibilities to several antibiotics classes including methicillin and other members of ß-lactam family. MRSA is often sub-categorized as HA-MRSA or CA-MRSA. MRSA is developed by multiple insertions of SCCmec into successful methicillin-susceptible S. aureus (MSSA) lineages. The resistance of the organism is due to the acquisition of the methicillin resistance gene mecA, coding for the low-affinity penicillin-binding protein (PBP2A). Previously, five major types of SCCmec elements (I–V) and several variants there have been identified based on the mec gene complex and ccr gene allotypes. CA-MRSA strains carry SCCmec type IV or V, whereas the majority of HA-MRSA strains carry SCCmec type I, II or III.[1],[2] Various molecular typing techniques have been developed for investigating the spread and evolution of MRSA, the most common of which is SCCmec typing. Oliveira et al. developed a multiplex PCR method for the detection of SCCmec types I through IV using mecA and different loci on SCCmec.[3] Zhang et al. developed a multiplex PCR method for the characterization of SCCmec types I through V.[4] MRSA has spread globally since it was first described in the early 1960s and is currently a major cause of nosocomial infections worldwide.[5] Some S. aureus strains produce Panton-Valentine Leucocidin (PVL), a powerful cytotoxin in human and rabbit mononuclear cells. It has been reported that the PVL gene is strongly associated with CA-MRSA strains worldwide. CA-MRSA infections have mostly been associated with staphylococcal strains bearing the SCCmec type IV element and PVL genes.[6] Studies showed that the presence of PVL in S. aureus associated with increased disease severity, ranging from cutaneous infection requiring surgical drainage to severe chronic osteomyelitis, and deadly necrotizing pneumonia.[7] The present study aimed to identify the types of SCCmec and the PVL gene among clinical MRSA isolates collected from Makkah hospitals.

METHODS

This study was conducted in the five major tertiary-care hospitals from March to September 2012. A total of 206 non-duplicated clinical isolates of S. aureus were identified in these hospitals during the study period using standard microbiological methods. These methods included colony morphology on blood and mannitol agar, Gram stain, and catalase and coagulase tests. The collected strains were stored at -86°C in brain-heart infusion containing 15% glycerol until use. Detection of MRSA was carried out using the oxacillin agar screen test according to Clinical Laboratory Standards Institute (CLSI) guidelines. The presence of any growth (>1 colony) was defined as oxacillin or methicillin resistant.[8] For DNA extraction, a single colony was taken from a nutrient agar plate (Oxoid) after overnight incubation. Cell suspensions were centrifuged at 4,500 rpm for 5 minutes at 4°C. Cell pellets were washed with 1 mL of TE (10 mM Tris pH 8, 10 mM EDTA) and resuspended in 100 µL of TE. After the addition of 50 µL of 10% sodium dodecyl sulphate (SDS), the mixture was incubated for 30 min at 65°C. The lysates were centrifuged, and supernatants were removed. The microtubes were then placed in a microwave oven and heated three times for 1 min each at 750 W. The pellets were dissolved in 200 µL of TE and were extracted with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) for 15 min. The aqueous phase was recovered by centrifugation for 20 min, precipitated with ethanol, and resuspended in 50 µL TE.[9] Mutiplex PCR was performed for the detection of the SCCmec gene. Table-I lists the primers used to amplify the SCCmec gene. Two sets of primers were used. The first set (Oliviera primers) was designed for the typing of SCCmec types I–IV based on selected loci (A through F) upstream and downstream the mecA gene.[3] The second set (Zhang primers) was designed for the typing of SCCmec types II, III, and V.[4] For detection of the PVL gene, a single PCR was performed. Table-I lists the primers used to amplify the PVL gene. The 50-µL PCR mixture contained 8 µL of DNA template, 1 µL (100 pmol) of each primer, and a 25 µL of Taq PCR Master Mix polymerase containing 100 mM Tris-HCl, 500 mM KCl (pH 8.3), 1.5 mM MgCl2, 200 µM of each deoxyribonucleoside triphosphate, and 0.025 U of Taq polymerase (Qiagen, USA). Amplification of DNA was performed using the Mastercycler personal PCR machine. For the Oliveira primers, the cycling conditions were as follows: initial denaturation for 5 min at 94°C; 35 cycles of denaturation for 30 sec at 94°C, annealing for 30 sec at 53°C, and extension for 1 min at 72°C; and a final extension for 5 min at 72°C. For the Zhang primers, the cycling conditions were as follows: initial denaturation at 94°C for 5 minutes; 10 cycles of 94°C for 45 seconds, 65°C for 45 seconds, and 72°C for 1.5 minutes; 25 cycles of 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 1.5 minutes; and a final extension at 72°C for 10 minutes. For amplification of the PVL gene, the cycling conditions were as follows: initial denaturation for 5 min at 94°C; 35 cycles of denaturation for 40 sec at 94°C, annealing for 40 sec at 53°C, and extension for 1 minutes at 72°C; and a final extension for 10 minutes at 72°C.
Table-I

Primers used for amplification of SCCmec and PVL

Primers Oligonucleotide sequence (5'–3') Size (bp) SCCmec type
Oliveira Primers
1CIF2 F2TTCGAGTTGCTGATGAAGAAGG495I
2CIF2 R2ATTTACCACAAGGACTACCAGC
3KDP F1AATCATCTGCCATTGGTGATGC484II
4KDP R1CGAATGAAGTGAAAGAAAGTGG
5MECI P2ATCAAGACTTGCATTCAGGC209II, III
6MECI P3GCGGTTTCAATTCACTTGTC
7DCS F2CATCCTATGATAGCTTGGTC342I, II, IV
8DCS R1CTAAATCATAGCCATGACCG
9RIF4 F3GTGATTGTTCGAGATATGTGG243III
10RIF4 R9CGCTTTATCTGTATCTATCGC
11RIF5 F10TTCTTAAGTACACGCTGAATCG414III
12RIF5 R13GTCACAGTAATTCCATCAATGC
17MECA P4TCCAGATTACAACTTCACCAGG162 mecA
18MECA P7CCACTTCATATCTTGTAACG
Zhang Primers
19Type II-FCGTTGAAGATGATGAAGCG398SSmec II
20Type II-RCGAAATCAATGGTTAATGGACC
21Type III-FCCATATTGTGTACGATGCG280SCCmec III
22Type III-RCCTTAGTTGTCGTAACAGATCG
23Type V-FGAACATTGTTACTTAAATGAGCG325SCCmec V
24Type V-RTGAAAGTTGTACCCTTGACACC
PVL Primers
25PVL-1ATCATTAGGTAAAATGTCTGGACATGATCCA433PVL
26PVL-2GCATCAAGTGTATTGGATAGCAAAAGC
Data analysis was performed using Statistical Package for Social Sciences IBM SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). The significance of correlations for means was determined with the χ2 test and for independence with the Fisher exact test using GraphPad InStat 3.0 software (GraphPad Inc., San Diego, California, USA). Statistical significance was defined as a p-value <0.05.

RESULTS

Results from PCR analysis revealed that only 100 strains carried the mecA gene. The results from MRSA typing are shown in Table-II. Of the confirmed MRSA isolates, 3% were SCCmec type I; 9% were type II; 47% were type III, and 29% were type IV (Fig.1). Using Zhang primers, none of the isolates were identified as SCCmec type V. Twelve of the MRSA isolates could not be typed. Among the confirmed MRSA isolates, 19% harboured the PVL gene (Fig.2). PVL-positive isolates were mostly SCCmec type III (42.1%) and type IV (47.3%) (Table-II). There was a significant correlation between presence of PVL and SCCmec type IV (P = 0.0423).
Table-II

Frequency of SCCmec types and PVL among MRSA isolates

MRSA clinical isolates
I II III IV V Untypeable
SCCmec (100)3 (3%)9 (9%) 47 (47%)29 (29%)-12 (12%)
PVL (19)008 (42.2%)9 (47.3%)-2 (10.5%)
Fig.1

Multiplex PCR assay for SCCmec typing. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp DNA ladder

Fig.2

PCR detection of the PVL gene among selected MRSA isolates. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp DNA ladder

DISCUSSION

In the past decade, the world has seen a steady increase in the incidence of MRSA. Methicillin resistance is conferred by the mecA gene, which is located on SCCmec and can be detected by PCR techniques for rapid and accurate identification of MRSA subcultures.[10] In the present study, only 100 of 114 MRSA isolates were confirmed to carry the mecA gene. In combination with genotyping of the S. aureus chromosome, the SCCmec typing system has become an important technique for distinguishing between HA-MRSA and CA-MRSA. Most HA-MRSA infections are SCCmec types I, II, and III, while CA-MRSA infections are SCCmec types IV and V.[1],[2] In this study, two multiplex PCR systems were used: the first was developed by Oliveira and Lencastre, which identified four SCCmec types using characteristic genes in junkyard regions; the second was developed by Zhang et al.[3],[4] Both systems identified the mec and ccr region, although they differ slightly with respect to primer sequences and target genes. Primers used for amplification of SCCmec and PVL Frequency of SCCmec types and PVL among MRSA isolates Multiplex PCR assay for SCCmec typing. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp DNA ladder PCR detection of the PVL gene among selected MRSA isolates. Lane 1: negative control; Lane 2: positive control; Lanes 3, 4, and 6: 433-bp PVL gene fragment; Lane 5: isolate negative for the PVL gene; Lane M: 100-bp DNA ladder In the present study, among the 100 confirmed MRSA strains, 3% were SCCmec type I; 9% were SCCmec type II; 47% were SCCmec type III, and 29% were SCCmec type IV. We did not detect any SCCmec type V. The distribution of SCCmec types is reported to vary by region worldwide. For instance, SCCmec types I to III are the most frequent nosocomial MRSA strains in the world.[11],[12] In the present study, the majority of the hospital isolates were SCCmec type III. Similarly, SCCmec type III strains have been reported to be predominant in isolates from Saudi Arabia and other Asian countries, while SCCmec type II strains are predominant in Japan and Korea and are uncommon in Saudi Arabia, Philippines, Korea, and Japan.[13] The incidence of CA-MRSA has increased and is a potential cause of healthcare-associated infections in Saudi Arabia.[14] In a study conducted in the Makkah region, located on the West coast of Saudi Arabia, CA-MRSA accounted for 15.8% of all MRSA isolates.[14] In the present study, we did not detect SCCmec type V isolates using Zhang primers. Similar results were reported by Budimir et al.[15] Some authors have proposed using PCR with a single primer pair for the detection of type V, however, this method would require four separate reactions, which may not be suitable for large-scale analysis.[4] In the present study, 12% of MRSA isolates could not be classified into any of the described SCCmec types. Similar data have been previously reported; Oliviera et al. reported that 8% of isolates were non-typeable for SCCmec.[3] Some studies have reported the spread of CA-MRSA SCCmec type IV strains in hospital settings in Europe, United States, and Switzerland.[16],[17] CA-MRSA is most likely carried in the upper respiratory tract or various cutaneous and mucosal sites and introduced into the hospital by patients or nursing staff.[18],[19] Another genetic feature of CA-MRSA is the high prevalence of the PVL gene, which encodes a cytotoxin that causes leukocyte destruction and tissue necrosis. PVL-producing strains are associated with severe skin and soft-tissue infections and necrotizing pneumonia.[19] In fact, the PVL gene is a stable marker of CA-MRSA and is largely absent from HA-MRSA strains.[6] In the present study, 19% of isolates harboured PVL genes. Similarly, a study from the Netherlands reported that 15% of isolates were positive for PVL.[20] Higher rates were reported in Algeria and while lower rates were reported in England.[21],[22] Recently, the genomic sequence of a CA-MRSA isolate indicated the presence of both SCCmec IV and PVL.[23] Most CA-MRSA infections have been associated with strains bearing the SCCmec type IV element and PVL genes.[6] Recently, a case series revealed that PVL-negative CA-MRSA may also cause severe necrotizing pneumonia, suggesting the presence of other virulence factors responsible for necrotizing pneumonia.[24] In this study, we identified a statistically significant correlation between the presence of PVL and the SCCmec type IV gene (P value: <0.05). Moussa et al. studied the genotypes of MRSA from Riyadh and found that CA-MRSA strains harboured the SCCmec type IV element and PVL genes.[25] Furthermore, Moroney et al. reported that 23 of 25 (92%) SCCmec-type-IV isolates were positive for PVL. Similar results were also obtained by Vandenesch et al., who reported that the PVL gene and SCCmec IV were shared by all CA-MRSA isolates from three continents.[26] Based on our findings, we conclude that over 50% of S. aureus isolates were MRSA in Makkah. Screening and isolation of MRSA-positive patients is essential in order to control the transmission of MRSA in both hospitals and the community. SCCmec types I–IV were identified among the S. aureus isolates, while type V was not detected in this study. There was a statistically significant correlation between the presence of the PVL gene and SCCmec type IV. The increasing incidence of virulent MRSA strains in both hospitals and the community highlights the importance of their rapid identification in order to appropriately control infection.
  25 in total

1.  A simple method for the isolation of chromosomal DNA from gram positive or acid-fast bacteria.

Authors:  C Bollet; M J Gevaudan; X de Lamballerie; C Zandotti; P de Micco
Journal:  Nucleic Acids Res       Date:  1991-04-25       Impact factor: 16.971

2.  Molecular characterization of methicillin-resistant Staphylococcus aureus bloodstream isolates from Croatia.

Authors:  Ana Budimir; Ruud H Deurenberg; Vanda Plecko; Cornelis Vink; Smilja Kalenic; Ellen E Stobberingh
Journal:  J Antimicrob Chemother       Date:  2005-12-09       Impact factor: 5.790

3.  MRSA in children presenting to hospitals in Birmingham, UK.

Authors:  A Adedeji; T M A Weller; J W Gray
Journal:  J Hosp Infect       Date:  2006-12-04       Impact factor: 3.926

4.  Staphylococcal cassette chromosome mec and Panton-Valentine leukocidin characterization of methicillin-resistant Staphylococcus aureus clones.

Authors:  Shannon M Moroney; Loree C Heller; Jesse Arbuckle; Monica Talavera; Ray H Widen
Journal:  J Clin Microbiol       Date:  2006-12-27       Impact factor: 5.948

5.  Severe community-onset pneumonia in healthy adults caused by methicillin-resistant Staphylococcus aureus carrying the Panton-Valentine leukocidin genes.

Authors:  John S Francis; Meg C Doherty; Uri Lopatin; Cecilia P Johnston; Gita Sinha; Tracy Ross; Mian Cai; Nadia N Hansel; Trish Perl; John R Ticehurst; Karen Carroll; David L Thomas; Eric Nuermberger; John G Bartlett
Journal:  Clin Infect Dis       Date:  2004-12-07       Impact factor: 9.079

6.  Staphylococcal cassette chromosome mec (SCCmec) typing of methicillin-resistant Staphylococcus aureus strains isolated in 11 Asian countries: a proposal for a new nomenclature for SCCmec elements.

Authors:  Piriyaporn Chongtrakool; Teruyo Ito; Xiao Xue Ma; Yoko Kondo; Suwanna Trakulsomboon; Chuntima Tiensasitorn; Mantana Jamklang; Tavinun Chavalit; Jae-Hoon Song; Keiichi Hiramatsu
Journal:  Antimicrob Agents Chemother       Date:  2006-03       Impact factor: 5.191

7.  A review of community-acquired methicillin-resistant Staphylococcus aureus for primary care physicians.

Authors:  Huda A Bukharie
Journal:  J Family Community Med       Date:  2010-09

Review 8.  Community-associated meticillin-resistant Staphylococcus aureus as a cause of hospital-acquired infections.

Authors:  R L Skov; K S Jensen
Journal:  J Hosp Infect       Date:  2009-09-27       Impact factor: 3.926

9.  A population-based study of the incidence and molecular epidemiology of methicillin-resistant Staphylococcus aureus disease in San Francisco, 2004-2005.

Authors:  Catherine Liu; Christopher J Graber; Michael Karr; Binh An Diep; Li Basuino; Brian S Schwartz; Mark C Enright; Simon J O'Hanlon; Jonathon C Thomas; Francoise Perdreau-Remington; Shelley Gordon; Helen Gunthorpe; Richard Jacobs; Peter Jensen; Gifford Leoung; James S Rumack; Henry F Chambers
Journal:  Clin Infect Dis       Date:  2008-06-01       Impact factor: 9.079

10.  Molecular characterization of methicillin-resistant Staphylococcus aureus recovered from outpatient clinics in Riyadh, Saudi Arabia.

Authors:  Ihab Moussa; Atef M Shibl
Journal:  Saudi Med J       Date:  2009-05       Impact factor: 1.484

View more
  10 in total

1.  Antibiotic resistance and genotyping of mecA-positive methicillin-resistant Staphylococcus aureus (MRSA) from milk and nasal carriage of dairy water buffaloes (Bubalus bubalis) in the Philippines.

Authors:  Alona T Badua; Sukolrat Boonyayatra; Nattakarn Awaiwanont; Paula Blanca V Gaban; Claro N Mingala
Journal:  J Adv Vet Anim Res       Date:  2020-06-29

2.  Genomic Investigation of Methicillin-Resistant Staphylococcus aureus ST113 Strains Isolated from Tertiary Care Hospitals in Pakistan.

Authors:  Nimat Ullah; Hamza Arshad Dar; Kanwal Naz; Saadia Andleeb; Abdur Rahman; Muhammad Tariq Saeed; Fazal Hanan; Taeok Bae; Amjad Ali
Journal:  Antibiotics (Basel)       Date:  2021-09-17

3.  Role of Bioaerosols on the Short-Distance Transmission of Multidrug-Resistant Methicillin-Resistant Staphylococcus aureus (MRSA) in a Chicken Farm Environment.

Authors:  Bing-Mu Hsu; Jung-Sheng Chen; Gwo-Jong Hsu; Suprokash Koner; Viji Nagarajan; Hsin-Chi Tsai
Journal:  Antibiotics (Basel)       Date:  2022-01-10

4.  Staphylococcal Cassette Chromosome mec Types Among Methicillin-Resistant Staphylococcus aureus in Northern Iran.

Authors:  Akram Taherirad; Roghayeh Jahanbakhsh; Fatemeh Shakeri; Shaghayegh Anvary; Ezzat Allah Ghaemi
Journal:  Jundishapur J Microbiol       Date:  2016-07-17       Impact factor: 0.747

5.  Whole-genome epidemiology, characterisation, and phylogenetic reconstruction of Staphylococcus aureus strains in a paediatric hospital.

Authors:  Serena Manara; Edoardo Pasolli; Daniela Dolce; Novella Ravenni; Silvia Campana; Federica Armanini; Francesco Asnicar; Alessio Mengoni; Luisa Galli; Carlotta Montagnani; Elisabetta Venturini; Omar Rota-Stabelli; Guido Grandi; Giovanni Taccetti; Nicola Segata
Journal:  Genome Med       Date:  2018-11-13       Impact factor: 11.117

6.  High prevalence of direct repeat unit types of 10di, 8 h and 8i among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated in Tehran, Iran.

Authors:  Mitra Motallebi; Fereshteh Jabalameli; Reza Beigverdi; Mohammad Emaneini
Journal:  Antimicrob Resist Infect Control       Date:  2019-03-06       Impact factor: 4.887

7.  Methicillin-Resistant Staphylococcus aureus ST80 Clone: A Systematic Review.

Authors:  Assia Mairi; Abdelaziz Touati; Jean-Philippe Lavigne
Journal:  Toxins (Basel)       Date:  2020-02-14       Impact factor: 4.546

8.  Molecular characterization of methicillin-resistant Staphylococcus aureus in nosocomial infections in a tertiary-care facility: emergence of new clonal complexes in Saudi Arabia.

Authors:  A Senok; R Ehricht; S Monecke; R Al-Saedan; A Somily
Journal:  New Microbes New Infect       Date:  2016-07-29

9.  Increased resistance of a methicillin-resistant Staphylococcus aureus Δagr mutant with modified control in fatty acid metabolism.

Authors:  Hun-Suk Song; Tae-Rim Choi; Yeong-Hoon Han; Ye-Lim Park; Jun Young Park; Soo-Yeon Yang; Shashi Kant Bhatia; Ranjit Gurav; Yun-Gon Kim; Jae-Seok Kim; Hwang-Soo Joo; Yung-Hun Yang
Journal:  AMB Express       Date:  2020-04-07       Impact factor: 3.298

10.  Acinetobacter baumannii and methicillin-resistant Staphylococcus aureus in long-term care facilities in eastern Taiwan.

Authors:  Hsin-Chi Tsai; Tung-Yi Huang; Jung-Sheng Chen; Wen-Jen Chen; Chong-Yen Lin; Bing-Mu Hsu
Journal:  Ci Ji Yi Xue Za Zhi       Date:  2019-09-16
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.