Literature DB >> 24858919

Global gene expression analysis of long-term stationary phase effects in E. coli K12 MG1655.

Kotakonda Arunasri1, Mohammed Adil1, Pathan Akbar Ali Khan1, Sisinthy Shivaji1.   

Abstract

Global gene expression was monitored in long-term stationary phase (LSP) cells of E. coli K12 MG1655 and compared with stationary phase (SP) cells that were sub-cultured without prolonged delay to get an insight into the survival strategies of LSP cells. The experiments were carried out using both LB medium and LB supplemented with 10% of glycerol. In both the media the LSP cells showed decreased growth rate compared to SP cells. DNA microarray analysis of LSP cells in both the media resulted in the up- and down-regulation of several genes in LSP cells compared to their respective SP cells in the corresponding media. In LSP cells grown in LB 204 genes whereas cells grown in LB plus glycerol 321 genes were differentially regulated compared to the SP cells. Comparison of these differentially regulated genes indicated that irrespective of the medium used for growth in LSP cells expression of 95 genes (22 genes up-regulated and 73 down-regulated) were differentially regulated. These 95 genes could be associated with LSP status of the cells and are likely to influence survival and growth characteristics of LSP cells. This is indeed so since the up- and down-regulated genes include genes that protect E. coli LSP cells from stationary phase stress and genes that would help to recover from stress when transferred into fresh medium. The growth phenotype in LSP cells could be attributed to up-regulation of genes coding for insertion sequences that confer beneficial effects during starvation, genes coding for putative transposases and simultaneous down-regulation of genes coding for ribosomal protein synthesis, transport-related genes, non-coding RNA genes and metabolic genes. As yet we still do not know the role of several unknown genes and genes coding for hypothetical proteins which are either up- or down-regulated in LSP cells compared to SP cells.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24858919      PMCID: PMC4032248          DOI: 10.1371/journal.pone.0096701

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Bacterial cells when inoculated into a fresh medium exhibit a growth cycle with five phases [1], [2]. Initially the bacteria exhibit a lag phase at which cell number is not increased. The lag phase is followed by the log or the exponential phase when the cell number increases rapidly. These exponentially growing bacteria due to depletion of nutrients, accumulation of waste products and high cell density enter into the stationary phase during which no increase in cell number is observed. Nutrient-depleted stationary-phase cultures eventually enter a death phase when 90–99% of the population dies releasing nutrients that could be scavenged by the surviving bacteria. Such bacteria could survive for prolonged periods (months or even years) and this phase has been termed as long-term stationary phase [1]. This phase is characterized by alternating peaks of growth and death [3]. Thus study of cells in the long-term stationary phase (LSP) would help to unravel strategies for long-term survival of bacteria [1]. Cells in order to sustain life under these starving conditions form dormant spores, aggregates and/or fruiting bodies [4]. In addition, the cells may undergo a change in morphology from rod-shaped to coccoid cells as in Escherichia coli [5]. The cell membrane also becomes less permeable and less fluid [6]. One important molecular change that becomes obvious during the long-term stationary phase is the decline in the protein synthetic capacity of the cells, thus resulting in surplus ribosomes that are no longer involved in translation. These surplus ribosomes are either degraded as in Salmonella [7] or modified as in E. coli [8]. The decrease in protein synthesis in E. coli has been attributed to a decrease in concentration of the three initiation factors, particularly IF3 [9]. During prolonged starvation which occurs in LSP, cells exhibit a phenomenon termed as ‘growth advantage in stationary phase’ (GASP), where the surviving cells exhibit a growth advantage over the wild type cells [1]. Survival of GASP cells may be due to the expression of several survival genes in long-term stationary phase in order to combat stress due to depletion of nutrients and other environmental factors [5] or due to adaptive mutations in cells that are exposed to stationary phase for long duration [1]. The primary aim of the study is to monitor changes at gene expression level in a LSP culture of E. coli K12 MG1655 kept for 28 days at room temperature and subsequently grown to a mid logarithmic phase of growth in a fresh medium. Comparison of the global gene expression of these LSP cells with those of stationary phase cells that were sub-cultured without prolonged delay would provide insight into the survival strategies of LSP cells. The results indicated that expression of genes is dependent on the physiological state (stationary phase versus LSP) and the results are in accordance with earlier reports that gene expression is controlled by the physiological state of the cell [10], [11]. In addition, DAVID (Database for Annotation, Visualization and Integrated Discovery) analysis revealed various geneontology term enrichments pertaining to LSP. Finally, the comparative differential gene expression data of E. coli grown in LB broth versus E. coli grown in LB broth supplemented with glycerol broth provided insight into the effects pertaining to the LSP in E. coli.

Materials and Methods

Bacterial Strain and Growth Conditions

Stock cultures of E. coli K12 MG1655 (henceforth E. coli) were maintained on Luria-Bertani (LB) agar plates (containing 10 g peptone, 10 g NaCl, 5 g yeast extract and 2% (w/v) agar in 1000 ml distilled water) at 30°C. To develop the inoculums, a single colony of E. coli from the LB agar plate was inoculated into LB broth (LB agar minus agar) and incubated for growth under shaking at 150 r.p.m and at 30°C. E. coli growth was monitored by measuring absorbance at 600 nm using a spectrophotometer (Shimadzu UV-VIS 1700, North America). E. coli grown to a OD of 0.8 (106 CFU/ml) was used as inoculum for all the experiments unless otherwise mentioned.

Growth of E. coli in Two Different Media

E. coli was grown aerobically in two different media namely Luria-Bertani broth (LB) and LB broth supplemented with 10% (v/v) glycerol (hereafter LB + glycerol) at 30°C in an incubator shaker with continuous shaking (150 r.p.m). When the cells reached 0.8 OD 600nm, the culture was centrifuged and the pellet was suspended into a fresh medium to a concentration of 106 CFU/5 ml. These cells were then held for 28 days at room temperature without shaking. After 28 days the cells (OD at 600 nm was recorded as 1.8 and 1.5 for both LB broth and LB + glycerol grown E. coli cultures respectively) were inoculated (5% v/v containing106 CFU/ml) into 100 ml of LB broth and 100 ml of LB + glycerol respectively and growth was monitored by measuring absorbance at 600 nm. For this purpose aliquots of 0.5 ml were withdrawn at regular intervals of time and OD at 600 nm was recorded and the growth curves plotted (Figure 1). Growth studies were conducted in three replicates for each culture condition. To compare the growth of LSP E. coli cells with stationary phase cells (SP), overnight grown E. coli cells (15 h grown in LB broth and 20 h grown in LB + glycerol broth) were inoculated (5% v/v containing 106 CFU/ml) into 100 ml of LB broth and 100 ml of LB + glycerol broth respectively and growth was monitored by measuring absorbance at 600 nm and the growth curves plotted (Figure 1).
Figure 1

Growth of stationary phase culture of E. coli (O,•) and long-term stationary phase culture of E. coli which was held for 28 days at room temperature (□, ▪) that were sub-cultured for growth at 30°C in Luria-Bertani (LB) broth in the presence (O, □) and absence (•, ▪) of glycerol (10%).

Growth of E. coli in Two Different Media for Gene Expression Studies

For gene expression studies three biological replicates were maintained for each medium (LB and LB+glycerol). Long-term stationary phase (LSP) cells (28 days old culture) incubated in both LB and LB + glycerol broth were transferred to fresh media and grown until 0.8 OD600nm and used for gene expression studies. Similarly, stationary phase (SP) culture that is grown over night in LB broth (16 h) and LB + glycerol broth (20 h) were inoculated into fresh LB broth and LB + glycerol and grown till 0.8 OD600nm and used for gene expression studies. After reaching 0.8 OD600nm, 10 ml of the culture was harvested and suspended in 3 volumes of RNA later solution (Ambion Inc., USA) and stored at 4°C. From the stored culture 3 ml was used for the isolation of RNA.

RNA Extraction and cDNA Synthesis

Qiagen RNeasy mini-prep kit (Qiagen, USA) was used for the extraction of RNA from about 3 ml of E. coli culture and cDNA synthesized using the first strand cDNA synthesis kit from Invitrogen (Invitrogen Bioservices India Pvt. Ltd., Bangalore) as described previously [12]. The cDNA synthesized for all the three replicates of LSP and SP E. coli cultures grown freshly in both LB broth and LB+glycerol broth was fragmented with DNAse 1 (Promega Corporation, Madison, USA) and then labelled with biotin at the 3′ end using the labelling reagent from Affymetrix (CA, USA) and Terminal transferase enzyme (Promega Corporation, Madison, USA).

DNA Microarray and Data Analysis

The labelled, fragmented cDNA of LSP and SP E.coli cultures was used to hybridize with the 20,366 genes representing four E. coli strains (viz., non-pathogenic E. coli K12 MG1655, uropathogenic E. coli strain CFT073 and enterohemorragic E. coli O157:H7 strains EDL 933 and Sakai). The E. coli gene chip arrays were purchased from Affymetrix and the hybridisation protocol followed was as per the Affymetrix protocol (www.affymetrix.com). The chip contained approximately 10,000 probe sets. Images of the microarray chips were scanned using Affymetrix 428 Array Scanner and GCOS software and subsequently processed to get intensity cell files for the probe sets. The intensity cell files obtained for all the replicates of LSP and SP E. coli cultures were then imported, normalized for background correction and data analysed using Gene Spring 11.5 software. Genes that exhibited ≥2.0 fold increase or decrease (treated versus control) in expression and P≤0.05 were considered as differentially regulated. The microarray data was submitted to Gene Expression Omnibus (GEO) web deposit of National Centre for Biotechnology Information (NCBI) with an accession number GSE34275 for stationary phase grown E. coli cells and GSE50828 for long-term stationary phase E. coli cells grown in fresh medium.

Real Time PCR

Validation of the differentially expressed genes was done as described previously [12]. The RT-PCR reactions (10 µl) were performed in triplicate for LSP and SP E. coli cells cDNA with, SYBR Green PCR Master Mix (Applied Biosystems, CA, USA) and 2.5 pM primer (Table 1). Template was pre-incubated at 50°C for 2 min, denatured at 95°C for 10 min and subjected to 40 cycles under the following thermal conditions: 95°C (15 s) and 52°C (30 s). Relative expression of genes (insB, yhcE, ybfD, c3113, cysH, ydcC, oppA, csrC, dnaK, hdeA, ssrS, ryjA and aceB) in LSP cultures grown in LB broth and eleven genes (insB, yhcE, ybfD, c3113, cysH, ydcC, oppA, csrC, dnaK, hdeA and ssrS) in LSP cultures grown in the presence of LB+glycerol was calculated by ΔΔCT method which is based on product cycle threshold (CT). Expression of 16S rRNA gene was used as an internal standard for RT-PCR. All values reported represent the mean of at least three independent experiments.
Table 1

Primers used for Real-Time PCR analysis of a few genes of E. coli.

Sl.No.GenePrimerSequence (5′-3′)
1 insB insB-rtF GACTTTGTCATGCTGCTCCA
insB-rtR AGCGGCATAACCTGAATCTG
2 yhcE yhcE-rtF GGCCCGAATGGTTCATTAAA
yhcE-rtR TTGATGCTGTTCCTGTGCTG
3 ybfD ybfD-rtF TGCAGAAGGCTGGGAAGATA
ybfD-rtR TGGCAATGGTATCGTGAACA
4 C3113 C3113-rtF GTTGTTCCGTGTCAGTGGTG
C3113-rtR TGCCTGAAAAATGAGCGAAC
5 cysH cysH-rtF CTGAATGCCAAAGCTGGAAG
cysH-rtR AACGCCGAACTGGAAAAACT
6 ydcC ydcC-rtF AATAAGCTGCACTGGCGTCT
ydcC-rtR ATGTGCCGTATCCCTGAAAA
7 oppA oppB-rtF GCGTATTACCCGTGGCTCTA
oppB-rtR TAATGCGTGGCGTAAAATGA
8 csrC csrC-rtF GAGGCGAAGACAGAGGATT
csrC-rtR CGTGTTGATTCCATTTCCGT
9 dnaK dnaK-rtF GGCACTGGCAACCGTACTAT
dnaK-rtR CCGTCAACTTCGTCGATTTC
10 hdeA hdeA-rtF CAGCCAGGAAATCTTCACAG
hdeA-rtR CTGCTTCTTCTGCCAGTTGT
11 ssrS ssrS-rtF CTCTGAGATGTTCGCAAGC
ssrS-rtR GTGTCGTCGCAGTTTTAAGG
12 ryjA ryjA-rtF CTTTCTCTCTATCCCGCTGGT
ryjA-rtR ACGTGCTCGAATGAGGTGTG
13 aceB c4973-rtF TTGCTGACTGTAGGCCGGAT
c4973-rtR TTCGGCAACGGCTGTAGG
14 16S 16S-rtF GTGCAATATTCCCCACTGCT
16S-rtR CGATCCCTAGCTGGTCTGAG

Assignment of the Differentially Regulated Genes to Functional Pathways by DAVID

Genes identified by microarray analysis were analyzed to identify relevant functional pathways by DAVID (Database for Annotation, Visualization and Integrated Discovery). A cutoff p value of 0.05 was used for enriched geneontology functions by DAVID. The genes that coded for unknown function were not included in the analysis.

Results

Effect of Long-term Stationary Phase on Growth of E. coli in LB Medium and in LB Medium Supplemented with Glycerol

E. coli culture that was stored for 28 days (LSP) showed decreased growth rate compared to stationary phase (SP) culture which was sub-cultured for growth (Figure 1) and the generation times were 153 and 45 min respectively. The presence of 10% glycerol in the medium further decreased the growth rate both in LSP culture and the SP culture and the generation times were 174 and 55 min respectively. Thus generation time of E. coli is increased due to LSP and presence of glycerol.

Changes in Expression of Genes in LSP Cells of E. coli Cultured in LB Medium

Gene expression in E. coli that was stored for 28 days at room temperature (LSP) in LB broth and sub-cultured into a fresh medium was compared with stationary phase (SP) culture of E. coli which was sub-cultured for growth. Microarray analysis results indicated up regulation of twenty five genes and down regulation of one hundred and seventy nine genes in the LSP culture compared to the SP culture (Table S1 and S2 in File S1 and Figure 2). The up regulated genes included genes coding for transposase (insB, two insC, insD, insE, two insF, insH,and insL), for H repeat-containing protein (two ydcC and ybfD), for putative symporter (yidK), for nickel transporter subunit (nikD), for four hypothetical proteins (c3113, c4174, c4965 and ydiF), for a pseudogene (yhcE) and six unknown genes (Table S1 in File S1).
Figure 2

DNA microarray analysis of long-term stationary phase-induced gene expression in E. coli grown in LB broth.

The Volcano plot depicts gene expression in 28 days old E. coli culture at 0.8 OD (OD600nm) cultured in LB broth compared to the freshly grown stationary phase E. coli culture control. Genes that are represented on the right side of the volcano-axis are up regulated and those that are on left side of the axis are down regulated. Out of the 4377 genes (O) analysed, 25 genes were up-regulated (•) and 179 were down regulated (•). Only those genes that showed more than 2.0 fold change in expression and a P value <0.05 were identified as either up- or down-regulated. The X-axis represents the log2 fold change and the dark vertical lines represent cut-offs at 2.0 fold decrease and increase. The y-axis represents the p-values and the dark horizontal line indicates a –log10 p value cut-off of 0.05.

DNA microarray analysis of long-term stationary phase-induced gene expression in E. coli grown in LB broth.

The Volcano plot depicts gene expression in 28 days old E. coli culture at 0.8 OD (OD600nm) cultured in LB broth compared to the freshly grown stationary phase E. coli culture control. Genes that are represented on the right side of the volcano-axis are up regulated and those that are on left side of the axis are down regulated. Out of the 4377 genes (O) analysed, 25 genes were up-regulated (•) and 179 were down regulated (•). Only those genes that showed more than 2.0 fold change in expression and a P value <0.05 were identified as either up- or down-regulated. The X-axis represents the log2 fold change and the dark vertical lines represent cut-offs at 2.0 fold decrease and increase. The y-axis represents the p-values and the dark horizontal line indicates a –log10 p value cut-off of 0.05. The hundred and seventy nine down regulated genes comprised genes coding for metabolic pathways (29 genes), chaperons (3 genes), high pH media survival (9 genes), biofilm formation (1 gene), membrane components (5 genes) stationary phase survival proteins (5 genes), stress combating genes (6 genes) ribosomal protein synthesis (48 genes), DNA protecting (2 genes), non coding RNA genes (12 genes) hypothetical proteins (29 genes), other functional genes (22 genes) and unknown genes (9 genes) (Table S2 in File S1). DAVID was applied for the differentially expressed genes to get geneontology (GO) annotations and term enrichment categorisation for various biological processes (Figure 3A and 3B). GO terms enriched for more than 5% of genes are included in the figures. Based on DAVID, LSP E. coli cells grown in LB broth resulted in up regulation of two terms namely DNA metabolic process and transposition. While the down regulated genes resulted in enrichment of eleven terms, viz., carbohydrate catabolic process, energy derivation by oxidation of organic compounds, cellular respiration, tricarboxylic acid cycle, translation, organelle membrane, cell wall, intracellular non-membrane-bounded organelle, ribonucleoprotein complex, RNA binding and structural constituent of ribosome.
Figure 3

Genes up regulated (%) in E. coli LSP cells compared with SP cells of E. coli which were both sub-cultured in LB based on biological process classification reported by Gene ontology term functional categories using DAVID version 2.0 software (A).

Genes down regulated (%) in E. coli LSP cells compared with SP cells of E. coli which were both sub-cultured in LB based on biological process classification reported by Gene ontology term functional categories using DAVID version 2.0 software (B).

Genes up regulated (%) in E. coli LSP cells compared with SP cells of E. coli which were both sub-cultured in LB based on biological process classification reported by Gene ontology term functional categories using DAVID version 2.0 software (A).

Genes down regulated (%) in E. coli LSP cells compared with SP cells of E. coli which were both sub-cultured in LB based on biological process classification reported by Gene ontology term functional categories using DAVID version 2.0 software (B).

Changes in Expression of Genes in LSP Cells of E. coli Cultured in LB Medium Supplemented with Glycerol

In LSP culture of E. coli cultured in the presence of glycerol three hundred and twenty one genes (one hundred and thirty eight up-regulated and one hundred and eighty three down-regulated) were differentially regulated compared with overnight culture of E. coli which was cultured in the presence of glycerol (Table S3 and S4 in File S1 and Figure 4). The up-regulated genes included genes coding for transposases (7 genes), a pseudogene (1 gene), metabolic proteins (23 genes), other proteins (26 genes) hypothetical proteins (45 genes), non coding RNA (2 genes), pseudogenes (4 genes) and unknown genes (30 genes) (Table S3 in File S1).
Figure 4

DNA microarray analysis of long-term stationary phase-induced gene expression in E. coli grown in LB broth plus glycerol.

The Volcano plot depicts gene expression in LSP E. coli culture at 0.8 OD (OD600nm) cultured in LB broth compared to the freshly grown SP E. coli culture l. Genes that are represented on the right side of the volcano-axis are up-regulated and those that are on left side of the axis are down-regulated. Out of the 4377 genes (O) analysed, 138 genes were up-regulated (•) and 183 were down-regulated (•). Only those genes that showed more than 2.0 fold change in expression and a P value <0.05 were identified as either up- or down-regulated. The X-axis represents the log2 fold change and the dark vertical lines represent cut-offs at 2.0 fold decrease and increase. The y-axis represents the –log10 p-values and the dark horizontal line indicates a p value cut-off of 0.05.

DNA microarray analysis of long-term stationary phase-induced gene expression in E. coli grown in LB broth plus glycerol.

The Volcano plot depicts gene expression in LSP E. coli culture at 0.8 OD (OD600nm) cultured in LB broth compared to the freshly grown SP E. coli culture l. Genes that are represented on the right side of the volcano-axis are up-regulated and those that are on left side of the axis are down-regulated. Out of the 4377 genes (O) analysed, 138 genes were up-regulated (•) and 183 were down-regulated (•). Only those genes that showed more than 2.0 fold change in expression and a P value <0.05 were identified as either up- or down-regulated. The X-axis represents the log2 fold change and the dark vertical lines represent cut-offs at 2.0 fold decrease and increase. The y-axis represents the –log10 p-values and the dark horizontal line indicates a p value cut-off of 0.05. The down regulated genes included genes coding for metabolic pathways (46 genes), high pH survival (6 genes), membrane components (6 genes), stationary phase survival (7 genes), other proteins (29 genes), ribosomal protein synthesis (11 genes), non coding RNA (10 genes), hypothetical proteins (59 genes) and eight unknown proteins (Table S4 in File S1). Based on DAVID analysis LSP E. coli cells grown in LB broth supplemented with glycerol resulted in up-regulation of five gene ontology terms namely cell wall, organelle inner membrane, transposition, nitrogen compound biosynthetic process and ion transport (Figure 5A). Nine GO terms were enriched for the down-regulated genes, viz., structural molecule activity, cell wall, organelle membrane, intracellular non-membrane-bounded organelle, nitrogen compound biosynthetic process, generation of precursor metabolites and energy, amine biosynthetic process, ion transport and organic acid biosynthetic process (Figure 5B).
Figure 5

Genes up regulated (%) in E. coli LSP cells grown in LB + glycerol compared with stationary phase cells of E. coli which was sub-cultured in LB based on biological process classification reported by Gene ontology term functional categories using DAVID version 2.0 software (A).

Genes down regulated (%) in E. coli LSP cells grown in LB + glycerol compared with stationary phase cells of E. coli which was sub-cultured in LB based on biological process classification reported by Gene ontology term functional categories using DAVID version 2.0 software (B).

Genes up regulated (%) in E. coli LSP cells grown in LB + glycerol compared with stationary phase cells of E. coli which was sub-cultured in LB based on biological process classification reported by Gene ontology term functional categories using DAVID version 2.0 software (A).

Genes down regulated (%) in E. coli LSP cells grown in LB + glycerol compared with stationary phase cells of E. coli which was sub-cultured in LB based on biological process classification reported by Gene ontology term functional categories using DAVID version 2.0 software (B).

Validation of the Expression of Genes by Real-Time PCR (RT-PCR)

Expression of thirteen genes (insB, yhcE, ybfD, c3113, cysH, ydcC, oppA, csrC, dnaK, hdeA, ssrS, ryjA and aceB) in LSP cultures grown in LB broth (Figure 6A) and eleven genes (insB, yhcE, ybfD, c3113, cysH, ydcC, oppA, csrC, dnaK, hdeA and ssrS) in LSP cultures grown in the presence of LB+glycerol (Figure 6B) were validated by RT-PCR and compared with the respective SP cells grown in the corresponding media. The expression of the genes was calculated based on the product Cycle threshold (CT) value. Statistical analysis of the data using ANOVA (Prism 3.0 software) indicated that the genes were either significantly up-or down regulated (P<0.05) in accordance with the DNA microarray results. The primers used for validation are given in Table 1.
Figure 6

Real-Time PCR validation of the expression of insB, yhcE, ybfD, c3113, cysH, ydcC, oppA, csrC, dnaK, hdeA, ssrS, ryjA and aceB using RNA of LSP E. coli grown in LB broth (□) compared to stationary phase culture in LB broth (▪) (A).

Real-Time PCR validation of the expression of insB, yhcE, ybfD, c3113, cysH, ydcC, oppA, csrC, dnaK, hdeA, ssrS, ryjA and aceB using RNA of LSP E. coli grown in LB+glycerol (□) compared to stationary phase culture grown in LB+glycerol (▪) (B).

Real-Time PCR validation of the expression of insB, yhcE, ybfD, c3113, cysH, ydcC, oppA, csrC, dnaK, hdeA, ssrS, ryjA and aceB using RNA of LSP E. coli grown in LB broth (□) compared to stationary phase culture in LB broth (▪) (A).

Real-Time PCR validation of the expression of insB, yhcE, ybfD, c3113, cysH, ydcC, oppA, csrC, dnaK, hdeA, ssrS, ryjA and aceB using RNA of LSP E. coli grown in LB+glycerol (□) compared to stationary phase culture grown in LB+glycerol (▪) (B).

Discussion

Bacterial cells survive and live beyond stationary phase when kept for many days (long-term stationary phase) at room temperature. This adaptability is achieved by changes in cell envelope [13], metabolism [1] and the concurrent regulation of genes. With this in view, in the present study, effect of long-term stationary phase on growth and global gene expression was monitored in E. coli using DNA microarray analysis. Both the stationary phase sub-cultured cells and LSP sub-cultured cells exhibited similar growth patterns but in LSP cells the lag phase is delayed and the growth rate is retarded (Figure 1). Pin and Baranyi, [14] had suggested that the length of the lag phase varies depending on the bacterial species, the new environment and importantly the length of time that the cells have starved prior to the new environment created due to sub culturing in to a fresh medium [14]. Thus it is possible that since the LSP cells were retained in the stationary phase for 28 days prior to sub culturing (the new environment) they required a longer period to adjust to the changed media conditions compared to the stationary phase cells. Subsequently both the LSP and SP cells entered the exponential phase of growth but the LSP cells exhibited a longer generation time (153 min) compared to the SP cells (45 min). The medium used for sub culturing was LB therefore the slow generation time in LSP may not be attributed to the nutrient status of the medium as indicated earlier that the generation time is slower in nutrient-poor conditions compared to nutrient-rich conditions [2]. We are not aware of similar comparisons in growth characteristics of SP cells and LSP sub-cultured cells in literature. Several studies have indicated that E. coli in long-term stationary phase for 10 days yield cells that express the growth advantage in stationary phase (GASP) phenotype due to a mutation in rpoS, which encodes a putative stationary phase-specific sigma factor [3], [15]–[17]. These cells with GASP phenotype (LSP) when mixed with fresh cultures either transiently or permanently- outnumber the younger population with time or aged cells are unable to compete with younger strains [1]. In these earlier experiments LSP and fresh cells were mixed to ascertain the advantage if any due to GASP by monitoring the number of viable cells (Colony forming units) and not the growth characteristics as in the present study. Thus the two experiments should not be strictly compared but what could be deduced is that at least the LSP cells did not exhibit any growth advantage for a short period of the experiment (24 h). Presence of glycerol in the LB medium further decreased the growth rate in both the SP sub-cultured cells and LSP sub-cultured cells. Previous studies have indicated that gene expression is influenced by growth rate [18]–[20], growth rate-dependent gene copy number, abundance of RNA polymerase and ribosomes [21]. Further, Klump et al., [11] demonstrated that mRNA abundance is a good candidate for measurement of gene expression and it does not show growth rate dependence. Hence, in the present study, to assess global gene expression changes occurring due to LSP, DNA microarray analysis was compared between SP sub-cultured cells and LSP grown cells that were cultured in two different media, LB and LB supplemented with glycerol (10% v/v).

Changes in Expression of Genes in E. coli due to Long-term Stationary Phase Effect in LB Medium

LSP E. coli cells when grown in LB broth resulted in differential expression of 204 genes (25 genes were up-regulated and 179 genes were down regulated) (Table S1 and S2 in File S1 and Figure 2). None of the up-regulated genes coded for genes associated with stress. At the same time, as anticipated, it was observed that the down-regulated genes comprised genes which would prolong the lag phase and increase the generation time like genes pertaining to metabolic pathways (29 genes), ribosomal protein synthesis (47), DNA protecting (2), genes required for high pH media survival (9), stationary phase survival proteins (5), stress combating genes (6), chaperon functional activity (3), biofilm formation (1) and membrane components (5). It was also observed that a significant number of the up and down regulated genes were categorised as hypothetical protein coding genes and unknown genes (Table S1 and S2 in File S1). DAVID gene ontology (GO) term enrichments for LSP cells grown in LB broth also confirmed down regulation in enrichments for carbohydrate catabolic process, energy derivation by oxidation of organic compounds, cellular respiration, tricarboxylic acid cycle (corresponding to metabolic pathway genes), translation, ribonucleoprotein complex, RNA binding and structural constituent of ribosome (corresponding to ribosomal protein synthesis genes), organelle membrane, cell wall, intracellular non-membrane-bounded organelle (corresponding to genes coding for membrane components) (Figure 3B) thus providing justification for the observed lag phase delay and slower growth rate in LSP cells.

Changes in Expression of Genes in E. coli due to Long-term Stationary Phase Effect in LB Medium Supplemented with Glycerol

LSP E. coli cells when grown in LB broth supplemented with glycerol (10% v/v) resulted in differential expression of 321 genes (138 genes were up-regulated and 183 genes were down regulated) (Table S3 and S4 in File S1). The presence of glycerol in the LB medium appeared to up regulate genes coding for metabolic proteins in addition to the genes coding for transposases, hypothetical proteins, a pseudogene and unknown genes as in LSP cells grown in the absence of glycerol. This up-regulation of metabolic genes was not sufficient to restore the growth phenotype observed in SP sub-cultured cells. Presence of glycerol also down regulated the genes that were down regulated in the absence of glycerol in the LSP cells except it did not down regulate genes coding for stress genes, DNA protection and chaperones. Nevertheless the growth phenotype indicated a prolonged lag phase and decreased generation time. DAVID analysis of LSP E. coli cells grown in LB broth supplemented with glycerol resulted in down-regulation of gene ontology terms such as nitrogen compound biosynthetic process, generation of precursor metabolites and energy, amine biosynthetic process, ion transport and organic acid biosynthetic process which may adversely affect the growth as observed.

Effect of Glycerol on Expression of Genes in LSP Cells of E. coli

In our previous investigations it was observed that E. coli cells when grown in LB broth, the pH of the medium increased from 7 to 8.2 when the cells reached the stationary phase. But when the cells were grown in LB broth supplemented with glycerol the pH of the medium in the stationary phase decreased to 4.6. Thus growth rate and media pH are the other parameters that would influence the LSP cells. A more detailed discussion on the genes which are up- or down-regulated due to LSP irrespective of whether the medium is LB or LB supplemented with glycerol is given and interpreted with respect to the possible role of these genes in influencing the growth phenpotype. A total of 95 genes showed significantly up or down regulation due to LSP effect irrespective of the medium used (LB or LB plus glycerol) (Table 2 and 3). The 22 up regulated genes included genes coding for insertion sequences (insB, two insC, insD, insE, two insF, insH, and insL), for H repeat-containing protein (two ydcC and ybfD), for putative symporter (yidK), for nickel transporter subunit (nikD), for three hypothetical proteins (c3113, c4174 and ydiF), for a pseudogene (yhcE) and four unknown genes (Table 2). The 73 down regulated genes included, genes coding for stress and stationary phase response (9 genes), ribosomal protein synthesis and related genes (14 genes), membrane bound and transport related genes (6 genes), non coding RNA genes (11 genes), hypothetical proteins (16 genes), metabolic other functional genes (12 genes) and unknown genes (5 genes) (Table 3).
Table 2

List of up-regulated genes in Escherichia coli due to long-term stationary phase effect.

Sl. NoProbe set IDGeneGene function
Genes coding for insertion sequences
11762495_s_at insB IS1 transposase InsAB’
21761145_s_at insC KpLE2 phage-like element; IS2 insertion element repressor InsA
31766261_x_at insC KpLE2 phage-like element; IS2 insertion element repressor InsA
41759674_s_at insD insertion element IS2 transposase InsD
51766923_s_at insE IS3 element protein InsE
61764530_s_at insF IS3 element protein InsF
71766257_s_at insF IS3 element protein InsF
81765954_s_at insH IS5 transposase and trans-activator
91768300_s_at insL IS186/IS421 transposase
Other up-regulated genes
101766930_s_at ydcC H repeat-containing protein
111767281_s_at ydcC H repeat-containing protein
121763291_x_at ybfD H repeat-containing protein
131765969_s_at yidK putative symporter YidK
141759669_s_at nikD nickel transporter subunit
151766017_s_at ydiF fused predicted acetyl-CoA:acetoacetyl-CoA transferase: alpha subunit/beta subunit
161767447_s_at yhcE Pseudogene
171768337_s_at c3113 hypothetical protein
181761612_s_at c4174 hypothetical protein
191762957_s_at-Unknown
201765228_s_at-Unknown
211764872_s_at-Unknown
221766610_s_at-Unknown

Genes that showed fold change greater than 2.0 (P<0.05).

Table 3

List of down-regulated genes in Escherichia coli due to long-term stationary phase effect.

Sl. NoProbe set IDGeneGene function
Genes coding for stress and stationary phase response
11766431_s_at argH argininosuccinate lyase
21764240_s_at talA transaldolase A
31765284_s_at raiA translation inhibitor protein RaiA
41759918_s_at clpA ATPase and specificity subunit of ClpA-ClpP ATP-dependent serine protease, chaperone activity
51761735_s_at wrbA TrpR binding protein WrbA
61765321_s_at hdeA stress response protein acid-resistance protein
71761492_s_at ihfA integration host factor subunit alpha
81760008_s_at rmf ribosome modulation factor
91768544_at papD_2 PapD protein
Ribosomal protein synthesis and related genes
101761999_s_at fusA elongation factor G
111768334_s_at infC translation initiation factor IF-3
121767807_s_at rpmF 50S ribosomal protein L32
131765214_s_at rpsB 30S ribosomal protein S2
141760241_s_at rpsF 30S ribosomal subunit protein S6
151760745_s_at rpsL 30S ribosomal subunit protein S12
161763008_s_at rpsN 30S ribosomal protein S14
171767590_s_at rpsV 30S ribosomal subunit S22
181763891_s_at rrfA, rrfB, rrfC, rrfD, rrfE, rrfF, rrfG, rrfH 5S ribosomal RNA of rrnA, rrnB, rrnC, rrnD, rrnE, rrnG, rrnH operon
191760713_s_at rrlA, rrlB, rrlC, rrlC, rrlD, rrlE, rrlG, rrlH 23S ribosomal RNA of rrnA rrnB, rrnC, rrnD, rrnE, rrnG, rrnH operon
201766157_s_at rrsA, rrsB, rrsC, rrsD, rrsE, rrsG 16S ribosomal RNA of rrnA, rrnB, rrnC, rrnD, rrnE, rrnG, operon
211763456_s_at rrsA, rrsB, rrsC, rrsD, rrsE, rrsG rrsH 16S ribosomal RNA of rrnH operon
221767883_s_at rimM 16S rRNA-processing protein RimM
231767263_s_at eno phosphopyruvate hydratase
Genes coding for transporters
241765595_s_at ompA outer membrane protein A
251768937_at ompC outer membrane porin protein C
261759780_s_at lpp murein lipoprotein
271764969_s_at oppA oligopeptide transport periplasmic binding protein
281765506_s_at livM leucine/isoleucine/valine transporter permease subunit
291761034_at aefA potassium efflux protein KefA
Non coding RNA genes
301763312_at csrB ncRNA
311768835_at csrC ncRNA
321766397_s_at csrC ncRNA
331762278_at rybA ncRNA
341760679_at ryjA ncRNA
351763985_s_at ffs misc_RNA
361762699_at micF misc_RNA
371767680_at gcvB ncRNA
381762568_s_at ssrA misc_RNA
391763089_s_at ssrS ncRNA
401760716_s_at rnpB ncRNA
Other functional genes
411765424_at nikE nickel transporter ATP-binding protein NikE
421766199_at agaS putative tagatose-6-phosphate ketose/aldose isomerise
431764443_s_at gatB galactitol-specific PTS system component IIB
441760076_at glpC sn-glycerol-3-phosphate dehydrogenase subunit C
451761419_s_at speB Agmatinase
461769115_s_at fabG 3-ketoacyl-(acyl-carrier-protein) reductase
471767961_s_at ahpC alkyl hydroperoxide reductasesubunit C
481760565_at c0336 PTS system, mannitol (Cryptic)-specific IIA component
491759877_at c3406 phosphosugar isomerise
501764975_s_at ycjU putative beta-phosphoglucomutase
511768861_s_at ECs1203 antitermination protein Q
521763881_s_at cydA cytochrome d terminal oxidase, polypeptide subunit I
Hypothetical/unknown functional genes
531762658_s_at yeaG hypothetical protein
541764346_at ECs4566 hypothetical protein
551767843_s_at ECs0302 hypothetical protein
561766612_at c0339 hypothetical protein
571761825_at c1191 hypothetical protein
581761672_at c2430 hypothetical protein
591765596_at c2814 hypothetical protein
601768188_at c3657 hypothetical protein
611768540_at c4419 hypothetical protein
621768600_s_at c5154 hypothetical protein
631764543_at chuY hypothetical protein
641763144_at yedK hypothetical protein
651765109_at yggR hypothetical protein
661767797_at yhjX hypothetical protein
671768987_at yjeF hypothetical protein
681768179_at Z5095 hypothetical protein
691760017_at - Unknown
701759110_s_at - Unknown
711765325_s_at - Unknown
721762413_s_at - Unknown
731764615_s_at - Unknown

Genes that showed fold change greater than 2.0 (P<0.05).

Genes that showed fold change greater than 2.0 (P<0.05). Genes that showed fold change greater than 2.0 (P<0.05).

Genes Coding for Insertion Sequences

Out of the eight different insertion sequence elements that are present in E. coli K-12, genes belonging to four of them IS1, IS2, IS3 and IS5 were up regulated due to LSP effect in E. coli. This may be attributed to the physiological status of the cell [22] and to the fact that such insertion sequences confer beneficial effects during starvation than during growth [23].

Other Up-regulated Genes in LSP Cells

ydcC and ybfD code for H repeat-containing proteins. The functions of these two genes is not known but both are putative transposases. The YidK protein encoded by yidK is a sodium dependent solute transporter and may function as a sodium-driven metabolite uptake system. Gene yhcE is a pseudogene which codes for an uncharacterised protein YhcE. Pseudogenes are disabled copies of functional genes but are known to exhibit differential expression [24].

Genes Related to Stress and Stationary Phase Response

A total of 9 genes coding for stress and stationary phase response are down regulated in LSP cells. Two of these genes argH which codes for argininosuccinate lyase function [25] and talA which codes for transaldolase, a key enzyme in the non-oxidative pentose phosphate pathway [26] are regulated by the general stress regulator sigmaS (or RpoS) subunit of RNA polymerase. The down-regulation of argH and talA may be due to the down regulation of Rpos gene which was seen in LSP cells (Table 3). The end products of argH and talA genes are also important for optimum growth of the cells. The other stress induced genes that are down-regulated include raiA coding for translation inhibitor protein RaiA and rmf coding for ribosome modulator factor gene which are required for translation and thus down-regulation would affect growth during starvation. RaiA is a stress induced protein produced during stationary phase [27] and the other protein ribosomal modulator factor (rmf) expression is influenced by the growth phase and is inversely related to the growth rate [26]. rmf gene may be involved in modulating the ribosomes to form dimers during stationary phase for the long term survival of cells [28]. These dimers would be converted to 70S ribosomes upon transferring of stationary phase cells to fresh medium [29], [30], thus helping in resuming the normal translational process. It was experimentally demonstrated that rmf was silent in rapidly growing exponential phase cells but high level of transcription occurs concomitantly with the growth transition to stationary phase [28]–[30]. Gene clpA codes for ClpATPases that are implicated in the stress tolerance of many microorganisms [31], [32] since they perform the chaperon function of DnaK and GroEL under stress [33]. The gene wrbA codes for the tryptophan repressor- binding protein WrbA and this protein is a stationary phase induced protein. But the gene was down regulated in LSP cells. It has been proposed that the WrbA protein functions as an accessory element in blocking tryptophan repressor-specific transcriptional processes [34]. Gene ihfA is down regulated in LSP cells and may thus be responsible for the growth phenotype of LSP cells because this gene encodes for integration host factor, which is a global regulatory protein that helps to maintain DNA architecture by influencing DNA supercoiling, DNA duplex destabilization, DNA replication, recombination and the expression of many genes [35]–[37]. Gene papD2 encodes for PapD protein that functions as putative chaperone-usher fimbrial operon in E. coli K12 [38]. Transcription of PapD is regulated by gene ihfA which is also down-regulated in LSP cells. HdeA is the most abundant protein in the periplasmic space of E. coli during stationary phase when grown in a nutrient rich media [39] thus implying its importance in stationary phase of growth. The down-regulation of hdeA gene observed in LSP cells would thus affect the growth. All these stress and stationary phase response genes showed down-regulation in LSP cells compared to SP cells; however from literature it is apparent that these genes are also down regulated during stationary phase [25]–[39]. Therefore, the observed down regulation in majority of the stress and stationary phase response genes could be attributed both to stationary phase and LSP. In addition these results imply that during re-growth of LSP and SP cells the transcripts for stress and stationary phase response genes are more lowered in LSP cells compared to SP cells and this could be the reason for the observed retardation of growth in LSP cells compared to SP cells.

Genes Coding for Ribosomal Protein Synthesis and Related Genes

The gene encoding for translation initiation factor IF-3, gene fusA, some of the 50S and 30S ribosomal protein synthesizing genes and rrn operons for 5S, 16S and 23S ribosomal RNA were down-regulated in LSP cells than in SP cells. Other genes that belong to this group of down-regulated genes include infC which codes for the protein, translation initiation factor IF-3, plays a crucial role in functional interaction of mRNA with 30S ribosome [40], gene fusA that encodes for elongation factor G which is an essential protein that facilitates the translocation of the ribosome by one codon along the mRNA molecule [41]. Further, genes coding for 30S ribosomal proteins (rpsB, rpsF, rpsL, rpsN and rpsV) and 50S ribosomal proteins (rpmF) were also down regulated. Thus compared to the SP cells, in LSP cells genes required for initiation and elongation of translation and genes coding for ribosomal proteins are down regulated thus affecting the growth of LSP cells. Further, redundancy in rrn operon, as seen in LSP cells reduces the ribosomal number in the cell, thus decreasing cell proliferation [42]. Earlier studies have shown that deletion of the trmD gene or rimM resulted in five to seven folds reduction in the growth of the cells [43]. The low abundance of these transcripts also contributes to the slow growth rate in LSP cells of E. coli. Gene eno encoding for phosphopyruvate hydratase is a component of RNA degradosome and plays a vital role in RNA processing and messenger RNA degradation [44]. The down-regulation of this degradosome may be an adaptive strategy employed by LSP cells to facilitate the growth of the cells.

Genes Coding for Transporters

Several genes coding for transport related proteins such as OmpC, OmpA, Lpp, OppA, LivM and AefA were down-regulated. As a consequence the diffusion of small hydrophilic molecules across the membrane [45] would be affected. It is also known that in E. coli the expression of porins OmpF and OmpC are regulated under certain stress conditions including changes in osmotic pressure, temperature and pH [45]. This study indicates down regulation of these genes due to long-term stationary phase. Earlier studies have also indicated that ompC gene expression is regulated depending on the pH conditions of the extracellular medium [46]–[48]. Thomas and Booth [46] also demonstrated under acidic pH conditions ompC gene regulation depends on the carbon source used in the medium with glycerol repressing the expression of ompC as observed in the present study. However, it was reported that the expression of ompA is decreased due to sigma E factor envelope stress response [49] indicating its role in response to long-term stationary phase effect. For the optimum growth and functioning, the cell requires various other transport proteins like the permeases that help the cell in regulating cell volume [50] by adjusting the ion and water transport across the cell membrane [51], and thereby protecting the DNA and protein structure. These permeases include the oligopeptide transporter permease coding gene oppA which mediates uptake of both dipeptides and oligopeptides [52], the aefA gene that codes for potassium efflux protein KefA which functions as a mechano-sensitive channel [53] and the gene livM that codes for branched chain aminoacid (leucin/isoleucine/valine) transporter permeases [54]. Down regulation of these proteins would have a negative effect on the growth of the cells as observed in LSP cells. In the present situation, since the general stress regulator is showing down regulation in its gene expression, thus, the transcripts pertaining to certain permeases have showed low abundance.

Non-coding RNA Genes

Several genes coding for non-coding RNA like csrB and csrC genes showed decreased expression in LSP cells. This was anticipated since earlier studies had indicated that in E. coli csrB and csrC genes were down regulated in medium like LB which contains casaminoacids [55]. The other non coding RNA gene ssrS was also down regulated in LSP cells. SsrS plays an important role in sigma 70 dependant transcription [56], [57] and is thus important for growth. The other non-coding RNA genes which were down regulated are also important since they are involved in varies functions such as rybA which acts as a manganese chaperon [58], ffs gene which is essential for protein synthesis [59], GcvB which is a small regulatory RNA involved in the regulation of amino acid availability [60] and ryjA gene which codes for novel small RNA with an unknown function.

Genes Coding for Nickel Transporter Subunit (nikD), a Number of Hypothetical Genes and Unknown Genes are Both Up or Down Regulated in LSP

In the present study two genes nikD and nikE that encode for the NikABCDE ATP-dependent nickel (II) uptake system are contradictingly differentially regulated. Gene nikD has shown up-regulation while gene nikE is down-regulated in LSP cells. The reason for this is difficult to explain but it is known that these genes code for ATP-dependent nickel (II) uptake which may be needed for a variety of enzymatic reactions in prokaryotes. It is also known that high intracellular concentrations of nickel are toxic since they catalyze the formation of reactive forms of oxygen that can damage cellular constituents. In addition it has also been observed that several genes coding for hypothetical proteins and genes whose functions are unknown are either up-or down- regulated in the LSP cells and only functional characterisation of these genes would shed light on their role with respect to LSP effect on cells (Table 3).

Others Differentially Down-regulated Genes

It is indeed not surprising to find that several metabolic genes are down regulated and these include agaS (that codes for putative tagatose-6-phosphate ketose/aldose isomerise required for galactosamine utilization) [61], gene gatB (that codes for galactitol-specific PTS system component IIB) and gene glpC (that codes for anaerobic glycerol 3-phosphate dehydrogenase). glpC expression is influenced by dps [62] gene, which codes for a non specific DNA-binding protein which is abundant during stationary phase and protects the cells from oxidative stress, UV and gamma irradiation, iron and copper toxicity, thermal stress and pH stress. The other metabolic genes that are down-regualted in LSP cells include speB gene, which codes for the putrescine-biosynthetic enzyme agmatinase [63] and fabG gene coding for 3-oxoacyl-[acyl-carrier-protein] reductase which is involved in fatty acid synthesis [64].

Conclusions

The study confirms and reiterates the importance of genes involved in stress, ribosomal protein synthesis and transport as crucial for growth in LSP cells. It also provides evidence for a positive role for insertion sequences and transposaes in LSP cells. Down-regulation of gene ihfA a global regulatory protein that helps to maintain DNA architecture and the expression of many genes is a very important observation which would help to understand the molecular basis of retarded growth in LSP cells. Further down-regulation of genes involved in degradosome may be an adaptive strategy employed by LSP cells to facilitate the growth of the cells. An interesting observation of the study is the differentially regulation of several genes coding for hypothetical proteins, pseudogenes and unknown genes which need to be characterised to get a better insight into the molecular basis of survival and growth of LSP cells. Supplementary tables. Table S1. Up-regulation of genes in long-term stationary phase cells in LB medium. DNA microarray analysis of LSP E. coli cells grown in the presence of LB broth showed up regulation of 25 genes with a fold change >2.0 (P<0.05). Table S2. Down-regulation of genes in long-term stationary phase cells in LB medium. DNA microarray analysis of LSP E. coli cells grown in the presence of LB broth showed down regulation of 179 genes with a fold change >2.0 (P<0.05). Table S3. Up-regulation of genes in long-term stationary phase cells in LB medium supplemented with glycerol. DNA microarray analysis of LSP E. coli cells grown in the presence of LB broth supplemented with glycerol showed up regulation of 138 genes with a fold change >2.0 (P<0.05). Table S4. Down-regulation of genes in long-term stationary phase cells in LB medium supplemented with glycerol. DNA microarray analysis of LSP E. coli cells grown in the presence of LB broth supplemented with glycerol showed down regulation of 183 genes with a fold change >2.0 (P<0.05). (DOCX) Click here for additional data file.
  56 in total

Review 1.  Life after log.

Authors:  D A Siegele; R Kolter
Journal:  J Bacteriol       Date:  1992-01       Impact factor: 3.490

2.  Growth phase-regulated expression of bolA and morphology of stationary-phase Escherichia coli cells are controlled by the novel sigma factor sigma S.

Authors:  R Lange; R Hengge-Aronis
Journal:  J Bacteriol       Date:  1991-07       Impact factor: 3.490

Review 3.  The Clp proteins: proteolysis regulators or molecular chaperones?

Authors:  C Squires; C L Squires
Journal:  J Bacteriol       Date:  1992-02       Impact factor: 3.490

4.  Microbial competition: Escherichia coli mutants that take over stationary phase cultures.

Authors:  M M Zambrano; D A Siegele; M Almirón; A Tormo; R Kolter
Journal:  Science       Date:  1993-03-19       Impact factor: 47.728

5.  Expression of Escherichia coli infC: identification of a promoter in an upstream thrS coding sequence.

Authors:  A Pramanik; S J Wertheimer; J J Schwartz; I Schwartz
Journal:  J Bacteriol       Date:  1986-11       Impact factor: 3.490

6.  Cloning, expression, and nucleotide sequence of livR, the repressor for high-affinity branched-chain amino acid transport in Escherichia coli.

Authors:  T K Antonucci; L M Wagner; D L Oxender
Journal:  Proteins       Date:  1986-10

7.  The regulation of expression of the porin gene ompC by acid pH.

Authors:  A D Thomas; I R Booth
Journal:  J Gen Microbiol       Date:  1992-09

Review 8.  The role of integration host factor in gene expression in Escherichia coli.

Authors:  M Freundlich; N Ramani; E Mathew; A Sirko; P Tsui
Journal:  Mol Microbiol       Date:  1992-09       Impact factor: 3.501

9.  A stationary-phase protein of Escherichia coli that affects the mode of association between the trp repressor protein and operator-bearing DNA.

Authors:  W Yang; L Ni; R L Somerville
Journal:  Proc Natl Acad Sci U S A       Date:  1993-06-15       Impact factor: 11.205

10.  Regulation of the Escherichia coli rmf gene encoding the ribosome modulation factor: growth phase- and growth rate-dependent control.

Authors:  M Yamagishi; H Matsushima; A Wada; M Sakagami; N Fujita; A Ishihama
Journal:  EMBO J       Date:  1993-02       Impact factor: 11.598

View more
  4 in total

1.  Impact of DNA extraction on whole genome sequencing analysis for characterization and relatedness of Shiga toxin-producing Escherichia coli isolates.

Authors:  Stéphanie Nouws; Bert Bogaerts; Bavo Verhaegen; Sarah Denayer; Denis Piérard; Kathleen Marchal; Nancy H C Roosens; Kevin Vanneste; Sigrid C J De Keersmaecker
Journal:  Sci Rep       Date:  2020-09-04       Impact factor: 4.379

2.  Transcriptome analysis of Escherichia coli K1 after therapy with hesperidin conjugated with silver nanoparticles.

Authors:  Abdulkader Masri; Naveed Ahmed Khan; Muhammad Zarul Hanifah Md Zoqratt; Qasim Ayub; Ayaz Anwar; Komal Rao; Muhammad Raza Shah; Ruqaiyyah Siddiqui
Journal:  BMC Microbiol       Date:  2021-02-17       Impact factor: 3.605

Review 3.  Endurance of extremely prolonged nutrient prevention across kingdoms of life.

Authors:  Ronen Hazan; Miriam Schoemann; Michael Klutstein
Journal:  iScience       Date:  2021-06-19

4.  Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure.

Authors:  Stephen P LaVoie; Anne O Summers
Journal:  BMC Genomics       Date:  2018-01-16       Impact factor: 3.969

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.