Literature DB >> 24751681

Association study on ADAM33 polymorphisms in mite-sensitized persistent allergic rhinitis in a Chinese population.

Ruo-Xi Chen1, Wen-Min Lu1, Lu-Ping Zhu1, Mei-Ping Lu1, Mei-Lin Wang2, Yun-Li Wang1, Xin-Yuan Chen1, Xin-Jie Zhu1, Min Yin3, Zheng-Dong Zhang2, Lei Cheng3.   

Abstract

BACKGROUND: The ADAM33 gene has been identified as a potentially important asthma candidate gene and polymorphisms in this gene have been shown to be associated with asthma and seasonal allergic rhinitis.
OBJECTIVE: To assess whether the ADAM33 polymorphisms are associated with persistent allergic rhinitis (PER) due to house dust mites in a Chinese population.
METHODS: In a hospital-based case-control study of 515 patients with mite-sensitized PER and 495 healthy controls, we genotyped seven single nucleotide polymorphisms (SNPs) in ADAM33. Serum levels of eosinophil cationic protein, total IgE and allergen-specific IgE against Dermatophagoides pteronyssinus and Dermatophagoides farinae were measured by the ImmunoCAP assays.
RESULTS: In the single-locus analysis, three polymorphisms, rs3918392 (F1), rs528557 (S2) and rs2787093, were significantly associated with mite-sensitized PER. SNP S2 was associated with significantly increased risk both of asthmatic and nonasthmatic mite-sensitized PER. In the combined genotypes analysis, individuals with 2-4 risk alleles had a significantly higher risk of mite-sensitized PER (adjusted OR = 1.99, 95% CI = 1.50-2.62) than those with 0-1 risk alleles. Haplotype-based association analysis revealed that the ACAGCCT haplotype might have potential to protect against mite-sensitized PER (adjusted OR = 0.67; 95% CI = 0.49-0.90).
CONCLUSIONS: Polymorphisms in the ADAM33 gene may contribute to susceptibility of mite-sensitized PER in this Chinese population.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24751681      PMCID: PMC3994017          DOI: 10.1371/journal.pone.0095033

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Allergic rhinitis (AR) is defined as a nasal disorder induced by immunoglobulin E (IgE)-mediated immune response and characterized by nasal symptoms including rhinorrhoea, sneezing, nasal obstruction, and itching [1]. It is one of the most common atopic diseases throughout the world. In China, the prevalence of AR ranges from 8.7% to 24.1% [2]. Meanwhile, epidemiologic studies have consistently shown that rhinitis and asthma often coexist in one patient [3], [4], [5]. AR and asthma, respectively affecting upper and lower airway, where mucosa present similarities and complement in function, both manifest atopy symptoms and likely share a common genetic background [6], suggesting the concept of ‘one airway, one disease’ [7]. AR and asthma are both multi-factorial diseases with genetic as well as environmental factors influencing disease progression. A gene encoding a disintegrin and metalloprotease (ADAM) 33 located on chromosome 20p13 was identified by positional cloning as a putative candidate gene for the development of asthma and bronchial hyperresponsiveness (BHR) [8]. Selective expression of ADAM33 in lung mesenchymocytes suggests that alterations in its activity may underlie abnormalities in the function of airway smooth muscle cells and fibroblasts linked to BHR and airway remolding [9]. One possible explain is that ADAM33 may serve as a cell surface ‘sheddase’ to release growth factors such as transforming growth factor (TGF)-β and modify cell-surface receptor expression to induce the proliferation of airway mesenchymocyte [10]. Significant associations between single nucleotide polymorphisms (SNPs) of the ADAM33 gene and asthma in ethnically diverse populations have been reported [8], [11], [12], [13], [14], [15], [16], [17], [18], [19]; however, little attention was given to rhinitis. Six SNPs (F+1, L−1, S2, T1, T2 and T+1) in ADAM33 were reported to have significant association in seasonal allergic rhinitis (SAR) induced by Japanese cedar pollen [20], while three SNPs (T1, T+1 and V4) were reported to be associated with AR or concomitant AR and Asthma in a Chinese population [12], [21]. Recently, a study showed that haplotypes of ADAM33 polymorphisms exhibited significant association with AR among Jordanians [22]. To confirm the association between ADAM33 polymorphisms and AR induced by house dust mites (HDM), and to examine the association with clinical phenotypes including rhinitis severity, concomitant asthma, and serum total IgE levels, we genotyped and analyzed seven SNPs of the ADAM33 gene in a Chinese population.

Materials and Methods

Subjects

The 515 unrelated individuals (342 males and 173 females) with persistent allergic rhinitis (PER) were aged from 3 to 66 years with a mean age of 19.68±12.6 years. The 495 unrelated healthy controls (299 males and 196 females) were aged from 3 to 65 years with a mean age of 20.10±12.61 years. All the cases and controls were recruited from Jiangsu and Anhui provinces, eastern China. All patients were enrolled in the First Affiliated Hospital of Nanjing Medical University (Nanjing, China) from May 2008 to January 2013. PER was diagnosed according to the guidelines of Allergic Rhinitis and its Impact on Asthma (ARIA) 2008 update [1]. A questionnaire was used to obtain information of disease condition and status, including history, family history, symptoms and concomitant diseases from each PER case. In this study, control subjects were recruited from the hospital who seeking health care or doing routine health examinations, and were frequency matched with the cases by age (±5 years) and sex. Individuals selected for controls must meet all the following criteria: (i) no symptoms or history of rhinitis or other nasal diseases; (ii) no symptoms or history of asthma or other atopic disorders; (iii) have negative allergen-specific IgE in serum (Phadiatop<0.35 kUA/L); (iv) absence of first-degree relatives with a history of AR or other allergic diseases. Subjects of all only Han Chinese were included in this study and the participation rate was approximately 95%. The research protocol was approved by the ethical review board of Nanjing Medical University, and written informed consent was obtained from all participants.

Clinical Parameters

A visual analogue scales (VAS) ranging from 0 (not at all bothersome) to 10 cm (extremely bothersome) was used to assess the severity of total nasal symptoms (VAS score) as well as individual symptoms including rhinorrhoea, sneezing, nasal obstruction, and nose and eye itching. Patients with VAS score ≤5 were diagnosed as mild rhinitis and those with VAS score >5 as moderate/severe [23]. About 5 mL venous blood samples were obtained from each participant for in vitro allergy testing. The serum total IgE, specific IgE, and eosinophil cationic protein (ECP) levels were measured with ImmunoCAP100 assays (Phadia, Uppsala, Sweden), according to the manufacturer’s standard procedures. Total IgE and ECP were determined in all subjects. Specific IgE antibodies to common inhalant allergens including Dermatophagoides pteronyssinus (Der p; d1), Dermatophagoides farinae (Der f; d2), cat dander (e1), dog dander (e5), Blatella germanica (i6), Alternaria alternata (m6), Ambrosia elatior (w1), and Artemisia vulgaris (w6) were determined in patients with PER.

SNP Selection and Genotyping

Seven SNPs in the ADAM33 gene, including rs3918392 (F1), rs528557 (S2), rs2280091 (T1), rs2280090 (T2), rs3918400 (V2) rs2787094 (V4), and rs2787093 (located in 3′ near gene), were selected by using genotype data obtained from unrelated Han Chinese in Beijing (CHB) individuals in the HapMap (HapMap Data Rel 28 Phase II+III, August 10, on NCBI B36 assembly, dbSNP b126) and based on previously published studies [8], [12], [20], [21] identifying putative risk alleles. Genotyping was performed with the TaqMan SNP Genotyping Assay using the 384-well ABI 7900HT Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). More than 15% of the samples were randomly selected for confirmation, and the results were 100% concordant. The primers and TaqMan probes are shown in Table 1.
Table 1

Primers and probes for genotypes screening by TaqMan allelic discrimination.

NCBI rs No.Base changePrimers* Probes*
rs3918392A>GF: CTCAACCCACGAGATCTTTCG G allele: FAM-CCTGGAAAGGAGCCT-MGB
R: GGTCATGCCCGCTTTGTT A allele: HEX-CCTGGAAAGGAACC-MGB
rs528557C>GF: CTTCCTGCTGGCCATGCT G allele: FAM-TGCTCCCAGGGGC-MGB
R: CCTGGGAGTCGGTAGCAACA C allele: HEX-TGCTCCCAGGCGC-MGB
rs2280091A>GF: CCCAAAGATGGCCCACACA C allele: FAM-CACCCCACGGAGTT-MGB
R: GGCATGAGCCCTTCCCTTCT T allele: HEX- ACCCCATGGAGTTGG-MGB
rs2280090A>GF: CCCAAAGATGGCCCACACA C allele: FAM-TGGACAGCCCTGGC-MGB
R: GGCATGAGCCCTTCCCTTCT T allele: HEX-TGGACAGTCCTGGC-MGB
rs3918400C>TF: GCAGGCAGCTTGGAAGTTTC T allele: FAM-AGTGGAGCTTTGACC-MGB
R: TCTAATGTGGCTCTGGGTTCCT C allele: HEX-TGGAGCTTCGACCC-MGB
rs2787094C>GF: TGGCCAGAAGCTAGTGGTCCT C allele: FAM-CTCCCCTGCAGCCT-MGB
R: CAGGAAGGAAGGTCCCCAAA G allele: HEX-CTCCCCTGGAGCCT-MGB
rs2787093C>TF: GTGGGGTGGTGGCTGATG A allele: FAM-AGCCTAGATGGCAGC-MGB
R: AAAGAGGGTGTTCAAACTAGGCAA G allele: HEX-CCGAGCCTAGGTGG-MGB

*The alleles were arrayed as the location of the primers or probes from 5′to 3′.

*The alleles were arrayed as the location of the primers or probes from 5′to 3′.

Statistical Analysis

Differences in the distributions of demographic characteristics, selected variables, and frequencies of ADAM33 genotypes between the cases and controls were evaluated using Student’s t-test (for continuous variables) or the Chi-square test (for categorical variables). Serum levels of total IgE and ECP were transformed into logarithmic model for normalize the distribution. Percentiles were calculated based on all available subjects with existing total IgE measurements (n = 973) and logarithmic total IgE 90th percentile (999.9 kU/L) was used as dependent variable (above/below the 90th percentile) with two categories denoted as ‘high’ and ‘low’ total IgE levels, respectively [24]. Hardy-Weinberg equilibrium (HWE) of the genotype distribution among control groups was tested by a goodness-of-fit Chi-square test. Chi-square test and one-way ANOVA were used to assess the difference between the ADAM33 polymorphisms and clinical phenotypes. The crude and adjusted odds ratios (ORs) and 95% confidence intervals (CIs) were obtained to assess the association between the ADAM33 polymorphisms and risk of mite-sensitized PER using unconditional univariate and multivariate logistic regression models. The multivariate adjustment included age and sex. The combined genotypes were further stratified by subgroups of age, sex, asthma, history, VAS score, total IgE and HDM-specific IgE levels. The computation of linkage disequilibrium (LD) between SNPs was estimated using the normalized measure of allelic association D′ and r 2, and the characterization of these patterns was determined using Haploview 4.0 software [25]. EM algorithm (SAS 9.1.3 PROC HAPLOTYPE) was used to infer haplotype frequencies based on the observed ADAM33 genotypes. All of the statistical analyses were carried out with SAS software version 9.1.3 (SAS Institute, Cary, NC, USA), unless indicated otherwise. P-value <0.05 was considered statistically significant.

Results

Characteristics of the Study Subjects

The frequency distributions of selected characteristics of the PER cases and healthy controls are presented in Table 2. The cases and controls appeared to be well matched on age (P = 0.579) and sex (P = 0.086). Apparently, serum levels of ECP (14.3 [5.6–30.1] µg/L) and total IgE (256.0 [120.2–573.0] kU/L) in cases were significantly higher (P<0.001) than those in controls (4.8 [3.1–7.5] µg/L and 26.8 [11.1–52.2] kU/L, respectively). In patients with PER, the serum level of allergen-specific IgE against Der p and Der f was 27.4 (5.0–69.4) kUA/L and 23.1 (5.0–63.3) kUA/L, respectively. Of the patients, 277 (53.8%) cases were mild and 270 (52.4%) were moderate/severe according to VAS score, and 130 (30.1%) cases reported to have concomitant asthma and 306 (70.2%) cases had family history of allergic diseases. These variables were further adjusted in the multivariate logistic regression analysis for any residual confounding effect.
Table 2

Distribution of selected variables among cases and controls.

VariablesCases (n = 515)Controls (n = 495) P
N%N%
Age (years), mean ± SD19.68±12.620.10±12.610.597*
Sex
Male34266.429960.40.086*
Female17333.619639.6
Serum total IgE (kU/L), median (IQR)265.0 (120.2–573.0)26.8 (11.1–52.2)<0.001
Eosinophil cationic protein (µg/L), median (IQR)14.3 (5.6–30.1)4.8 (3.1–7.5)<0.001
Duration of rhinitis (years), mean ± SD6.62±5.87
Total nasal symptoms (VAS score), mean ± SD5.23±2.41
Concomitant asthma
Yes13030.1
No30470.0
Family history of allergic diseases
Yes30670.2
No13029.8
Specific IgE (kUA/L), median (IQR)
 Dermatophagoides pteronyssinus 27.4 (5.0–69.4)
 Dermatophagoides farinae 23.1 (5.0–63.3)

*Derived from two-sided χ2 test for comparison of discrete variables and unpaired Student’s t-test for continuous variables.

Selective variables were transformed into logarithmic model before unpaired Student’s t-test between cases and controls.

Some information of concomitant asthma or family history of allergic diseases was not available in cases.

IQR, interquartile range; VAS, visual analogue scales.

*Derived from two-sided χ2 test for comparison of discrete variables and unpaired Student’s t-test for continuous variables. Selective variables were transformed into logarithmic model before unpaired Student’s t-test between cases and controls. Some information of concomitant asthma or family history of allergic diseases was not available in cases. IQR, interquartile range; VAS, visual analogue scales.

Individual SNP Association Analysis

The primary information and allele frequencies observed are listed in Table 3. All genotype distributions of control subjects were consistent with those expected from the HWE (all P>0.05). As shown in Table 4, the individual SNP analyses revealed that the genotype frequencies of three SNPs (SNP F1, S2, and rs2787093) were significantly different between the cases and controls (P = 0.006 for F1, P = 0.002 for S2, and P = 0.011 for rs2787093). The homozygous genotype GG of SNP F1 was associated with a significantly increased risk of mite-sensitized PER compared with the wild-type genotype CC (adjusted OR = 4.03, 95% CI = 1.49–10.93). Similar associations were also found in SNP S2 and rs2787093 (adjusted OR = 2.56, 95% CI = 1.50–4.38 for S2 and 2.24, 1.26–4.00 for rs2787093, respectively). We also found that the dominant models (MW+MM/WW) of SNP F1 (AG+GG/AA), S2 (CG+GG/CC) and rs2787093 (CT+TT/CC) showing significant associations with mite-sensitized PER (adjusted OR = 1.53, 95% CI = 1.09–2.14 for F1; 1.32, 1.02–1.70 for S2 and 1.38, 1.07–1.78 for rs2787093).
Table 3

Primary information of seven genotyped SNPs in the ADAM33 gene.

SNPNo.NCBIrs No.Chromosomeposition* SNP namein ref. [8] LocationBaseMAF P forHWE Genotyped(%)
changeDatabase CaseControl
1rs39183923655219F1exonA>G0.0670.1190.0770.17598.6
2rs5285573651742S2exonC>G0.2500.2660.2060.91698.3
3rs22800913650234T1exonA>G0.0780.0930.0720.78296.6
4rs22800903650205T2exonG>A0.1000.1090.1020.33298.1
5rs39184003649463V23′-UTRC>T0.1590.1880.1630.30099.1
6rs27870943649161V43′-UTRC>G0.4100.5630.5470.25199.1
7rs278709336484623′near geneT>C0.2330.2820.2260.14598.0

*SNP position in NCBI dbSNP (http://www.ncbi.nlm.nih.gov/snp).

MAF for CHB from the HapMap databases (http://www.hapmap.org) or NCBI dbSNP (http://www.ncbi.nlm.nih.gov/snp).

HWE P value in the control group.

SNP, single nucleotide polymorphism; MAF, minor allele frequencies; HWE, Hardy-Weinberg equilibrium; CHB: Han Chinese in Beijing, China.

Table 4

Genotype and allele frequencies in ADAM33 polymorphisms among cases and controls.

SNPNo.NCBIrs No.GenotypesCasesControlsCrude ORAdjusted OR P
N%N%(95% CI)(95% CI)*
1rs3918392 n = 507 n = 489
AA40579.941985.71.00 (reference)1.00 (reference) 0.006
AG8316.46513.31.32 (0.93–1.88)1.34 (0.94–1.91)
GG193.851.0 3.93 (1.45–10.63) 4.03 (1.49–10.93)
AG/GG10220.17014.3 1.51 (1.08–2.10) 1.53 (1.09–2.14) 0.015
G allele 0.1190.077 0.001
2rs528557 n = 508 n = 485
CC28856.730663.11.00 (reference)1.00 (reference) 0.002
CG17033.515832.61.14 (0.87–1.50)1.15 (0.88–1.51)
GG509.8214.3 2.53 (1.48–4.32) 2.56 (1.50–4.38)
CG/GG22043.317936.9 1.31 (1.01–1.68) 1.32 (1.02–1.70) 0.040
G allele 0.2660.206 0.002
3rs2280091 n = 508 n = 468
AA41681.940386.11.00 (reference)1.00 (reference)0.190
AG9017.76313.51.38 (0.98–1.96)1.38 (0.97–1.96)
GG23.924.30.97 (0.14–6.91)0.91 (0.13–6.49)
AG/GG9117.96413.71.38 (0.97–1.95)1.37 (0.97–1.94)0.073
G allele0.0930.0720.093
4rs2280090 n = 505 n = 486
GG40680.439481.11.00 (reference)1.00 (reference)0.685
GA8817.48517.51.01 (0.72–1.40)1.00 (0.72–1.40)
AA112.271.41.53 (0.59–3.97)1.57 (0.60–4.10)
GA/AA9919.69218.91.04 (0.76–1.43)1.05 (0.76–1.43)0.788
A allele0.1090.1020.609
5rs3918400 n = 508 n = 493
CC33766.334269.41.00 (reference)1.00 (reference)0.175
CT15129.714128.61.09 (0.83–1.43)1.07 (0.81–1.40)
TT203.91022.03 (0.94–4.40)2.07 (0.95–4.50)
CT/TT17133.715130.61.15 (0.88–1.50)1.13 (0.87–1.48)0.305
T allele0.1880.1630.147
6rs2787094 n = 508 n = 493
CC8717.19519.31.00 (reference)1.00 (reference)0.674
CG27053.225752.11.15 (0.82–1.61)1.14 (0.81–1.60)
GG15129.714128.61.17 (0.81–1.69)1.18 (0.81–1.71)
CG/GG42182.939880.71.16 (0.84–1.59)1.15 (0.84–1.59)0.379
G allele0.5630.5470.462
7rs2787093 n = 506 n = 483
TT25951.228458.81.00 (reference)1.00 (reference) 0.011
CT20941.318037.31.27 (0.98–1.65)1.29 (0.99–1.67)
CC387.5193.9 2.19 (1.23–3.90) 2.24 (1.26–4.00)
CT/CC24748.819941.2 1.36 (1.06–1.75) 1.38 (1.07–1.78) 0.016
C allele 0.2820.226 0.004

*Adjusted for age and sex in logistic regression model.

Two-sided χ2 test for the distributions of genotype and allele frequencies.

Assumed risk alleles.

SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval.

*SNP position in NCBI dbSNP (http://www.ncbi.nlm.nih.gov/snp). MAF for CHB from the HapMap databases (http://www.hapmap.org) or NCBI dbSNP (http://www.ncbi.nlm.nih.gov/snp). HWE P value in the control group. SNP, single nucleotide polymorphism; MAF, minor allele frequencies; HWE, Hardy-Weinberg equilibrium; CHB: Han Chinese in Beijing, China. *Adjusted for age and sex in logistic regression model. Two-sided χ2 test for the distributions of genotype and allele frequencies. Assumed risk alleles. SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval.

Association and Stratification Analysis between the Individual SNP and AR-related Phenotypes

As shown in Table 5, significantly increased risk of mite-sensitized PER with asthma were found for SNP S2 (OR = 1.54, 95% CI = 1.11–2.14) and T1 (OR = 1.71, 95% CI = 1.12–2.61) under the dominant models. Comparing nonasthmatic PER patients with controls, we also found that the dominant models of F1 (OR = 1.70, 95% CI = 1.19–2.42), S2 (OR = 1.32, 95% CI = 1.01–1.74) and rs2787093 (OR = 1.39, 95% CI = 1.06–1.83) had a significantly higher risk of mite-sensitized PER than those with wild-type genotypes.
Table 5

Genotype frequencies of ADAM33 polymorphisms in dominant model in PER patients with and without asthma.

SNPNo.NCBIrs No.Case with asthma vs. controlCase without asthma vs. control
Adjusted OR (95% CI)* P Adjusted OR (95% CI)* P
1rs39183921.28 (0.83–2.00)0.258 1.70 (1.19–2.42) 0.003
2rs528557 1.54 (1.11–2.14) 0.011 1.32 (1.01–1.74) 0.048
3rs2280091 1.71 (1.12–2.61) 0.013 1.35 (0.93–1.95)0.118
4rs22800901.24 (0.83–1.85)0.2971.06 (0.75–1.49)0.748
5rs39184001.00 (0.70–1.42)1.0001.12 (0.84–1.50)0.426
6rs27870941.48 (0.94–2.23)0.0901.04 (0.74–1.47)0.818
7rs27870931.24 (0.89–1.72)0.208 1.39 (1.06–1.83) 0.018

Dominant model: MW+MM/WW; MW: heterozygotes; MM: mutation homozygotes; WW: wild homozygotes.

*Adjusted for age and sex in logistic regression model.

Two-sided χ2 test for the distributions of genotype frequencies.

PER, persistent allergic rhinitis; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval.

Dominant model: MW+MM/WW; MW: heterozygotes; MM: mutation homozygotes; WW: wild homozygotes. *Adjusted for age and sex in logistic regression model. Two-sided χ2 test for the distributions of genotype frequencies. PER, persistent allergic rhinitis; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval. Given the significant difference between cases and controls, the correlations between serum total IgE levels and individual locus in cases and controls were evaluated separately. No significant association was shown between total IgE levels and genotypes of each SNP in controls (all P>0.05). No significant difference was observed in total IgE levels among individuals with different genotypes of seven SNPs (all P>0.05). We also evaluated the association between other AR-related phenotypes and different genotypes of individual SNP; however, no statistical evidence was found for interactions between the different genotypes and the variables (i.e., rhinitis severity, serum specific IgE and ECP levels) (all P>0.05; data not shown).

Distribution of the ADAM33 Combined Genotypes among Cases and Controls

In Table 4, the frequencies in ADAM33 SNP F1 G (0.119 vs. 0.077), SNP S2 G (0.266 vs. 0.206), and rs2787093 C (0.282 vs. 0.226) alleles among the cases were significantly higher than those among the controls. Considering potential interactions of these three SNPs on the risk of mite-sensitized PER, we combined these three SNPs based on the numbers of variant (risk) alleles (SNP F1 G, S2 G and rs2787093 C). As shown in Table 6, the combined genotypes with 0–1 variant (risk) alleles were more common (28.9% and 46.6%, respectively) and those with 2–4 variant (risk) alleles were less common (19.7%, 4.5% and 0.4%, respectively) among the controls than among the cases (23.5%, 37.4%, 25.5%, 11.5%, and 2.4%, respectively). In our study, no individual carried the combined genotypes with 5 or 6 variant (risk) alleles, presumably due to the LD. When these combined genotypes were dichotomized into two groups (i.e., zero to one vs. two to four risk alleles), their distributions differed significantly between the cases and controls (P<0.0001).
Table 6

Distributions of the ADAM33 combined genotypes among cases and controls.

No. variant (risk) alleles ofthe combined alleles* Cases (n = 481)Controls (n = 443) P
N%N%
011723.513528.9 <0.0001
118637.421846.6
212525.59219.7
35711.5214.5
4122.420.4
Dichotomized groups
0–130361.035375.4 <0.0001
2–419439.011524.6

*The number represents the numbers of risk genotypes.

Two-sided χ2 test for the distributions of combined genotype frequencies.

*The number represents the numbers of risk genotypes. Two-sided χ2 test for the distributions of combined genotype frequencies.

Association and Stratification Analysis between the ADAM33 Combined Genotypes and AR-related Phenotypes

As shown in Table 7, we found that the individuals with 2–4 variant (risk) alleles had a significantly higher risk of mite-sensitized PER (adjusted OR = 1.99, 95% CI = 1.50–2.62) than those with 0–1 risk genotypes. Further stratification analysis showed that this increased risk was pronounced among subgroups of both age <18 years (adjusted OR = 1.72, 95% CI = 1.16–2.54) and age ≥18 years (adjusted OR = 2.30, 95% CI = 1.53–3.46). This increased risk was also pronounced among both male (adjusted OR = 1.87, 95% CI = 1.32–2.66) and female (adjusted OR = 2.29, 95% CI = 1.44–3.64) groups. However, no statistical evidence was observed for interactions between the combined genotypes and the variables (i.e., concomitant asthma, family history of allergic diseases, VAS score, and total IgE) (all P>0.05).
Table 7

Association and stratification analyses between the ADAM33 combined genotypes and risk of PER.

VariablesSubcategoryN (case/control)Combined genotypes (case/control)* Adjusted OR(95% CI)
0–12–4
N%N%
Total497/468303/35361.0/75.4194/11539.0/24.6 1.99 (1.50–2.62)
Age (years)
<18288/230180/17162.5/74.4108/5937.5/25.7 1.72 (1.16–2.54)
≥18209/238123/18258.9/76.586/5641.2/23.5 2.30 (1.53–3.46)
Sex
Male329/292207/22162.9/75.7122/7137.1/24.3 1.87 (1.32–2.66)
Female168/17696/13257.1/75.072/4442.9/25.0 2.29 (1.44–3.64)
Concomitant asthma
No294/468188/35363.9/75.4106/11536.1/24.61.00 (reference)
Yes126/46878/35361.9/75.448/11538.1/24.60.92 (0.59–1.42)
Family history of allergic diseases
No293/468188/35364.2/75.4105/11535.8/24.61.00 (reference)
Yes129/46879/35361.2/75.450/11538.8/24.60.87 (0.56–1.36)
VAS score
≤5277/468162/35358.5/75.4115/11541.5/24.61.00 (reference)
>5220/468141/35364.1/75.479/11535.9/24.61.34 (0.92–1.94)
Total IgE
Lower level403/468237/35358.8/75.4166/11541.2/24.61.00 (reference)
Higher level94/46866/35370.2/75.428/11529.8/24.61.14 (0.72–1.82)

*The number represents the numbers of risk genotypes.

Adjusted for age and sex in logistic regression model.

Lower level: below the 90th percentile of logarithmic total IgE; Higher level: above the 90th percentile of logarithmic total IgE.

PER, persistent allergic rhinitis; VAS, visual analogue scale; OR, odds ratio; CI, confidence interval.

*The number represents the numbers of risk genotypes. Adjusted for age and sex in logistic regression model. Lower level: below the 90th percentile of logarithmic total IgE; Higher level: above the 90th percentile of logarithmic total IgE. PER, persistent allergic rhinitis; VAS, visual analogue scale; OR, odds ratio; CI, confidence interval.

Association and Stratification Analysis between the Haplotypes and Risk of AR

The LD between each pair of SNPs in ADAM33 is presented in Fig. 1. Haplotype analysis including 7 SNPs was performed, there were >100 possible haplotypes derived from the known genotypes. Haplotypes with a frequency <0.01 in both the cases and controls were pooled into a single group, and the remaining 9 haplotypes were analyzed. As shown in Table 8, the frequency of ACAGCCT haplotype in controls was significantly higher than that in cases (P = 0.0001, adjusted OR = 0.67, 95%CI = 0.49–0.90) compared with the common haplotype ACAGCGT, and the association was also statistically significant after Bonferroni’s correction (P = 0.001), suggesting that ACAGCCT haplotype may have potential to protect against mite-sensitized PER. We also found AGAGCGT haplotype carrying the S2 G allele was associated with a significantly increased risk of mite-sensitized PER (adjusted OR = 2.03, 95% CI = 1.09–3.79), compared with the common haplotype ACAGCGT. However, the significance did not remain after the Bonferroni’s correction (P = 0.256).
Figure 1

Linkage disequilibrium of seven SNPs in the ADAM33 gene.

Linkage disequilibrium (LD) of 7 SNPs was determined using the solid spine of LD option of Haploview 4.1. D′ values are displayed in the squares. Empty red squares have a pairwise D′ of 1.00. Red squares indicate high pairwise LD, gradually coloring down to white squares of low pairwise LD.

Table 8

Associations between risk of PER and frequencies of inferred haplotypes on the basis of the observed genotypes among cases and controls.

Haplotypes* Haplotype frequencies P Adjusted OR (95% CI)
CasesControls
A-C-A-G-C-G-T0.2910.3120.31611.00 (reference)
A-C-A-G-C-C-C0.2090.1910.33051.17 (0.90–1.52)
A-C-A-G-C-C-T0.1020.162 0.0001 0.67 (0.49–0.90)
A-G-A-G-T-G-T0.0540.0590.60110.99 (0.65–1.49)
A-C-A-G-C-G-C0.0250.0190.42461.35 (0.72–2.55)
A-G-G-A-C-G-T0.0350.0370.85961.02 (0.62–1.70)
A-G-A-G-C-G-T0.0330.017 0.0284 2.03 (1.09–3.79)
A-G-A-G-C-C-T0.0270.0240.66211.21 (0.67–2.18)
A-C-A-G-T-G-T0.0160.0170.76470.95 (0.46–1.96)

*The alleles of haplotypes were arrayed as the location of the SNPs in ADAM33 from 5′to 3′.

Two-sided χ2 test for each haplotype vs. all others combined in cases and controls.

Adjusted for age and sex in logistic regression model.

PER, persistent allergic rhinitis; OR, odds ratio; CI, confidence interval.

Linkage disequilibrium of seven SNPs in the ADAM33 gene.

Linkage disequilibrium (LD) of 7 SNPs was determined using the solid spine of LD option of Haploview 4.1. D′ values are displayed in the squares. Empty red squares have a pairwise D′ of 1.00. Red squares indicate high pairwise LD, gradually coloring down to white squares of low pairwise LD. *The alleles of haplotypes were arrayed as the location of the SNPs in ADAM33 from 5′to 3′. Two-sided χ2 test for each haplotype vs. all others combined in cases and controls. Adjusted for age and sex in logistic regression model. PER, persistent allergic rhinitis; OR, odds ratio; CI, confidence interval.

Discussion

ADAM33 is a member of the ADAM protein family of zinc-dependent metalloproteinase superfamily [26]. We selected seven SNPs in the ADAM33 gene and conducted an association study in a Han Chinese Han population. The results showed that three polymorphisms (SNP F1, S2 and rs2787093) were significantly associated with mite-sensitized PER and nonasthmatic mite-sensitized PER. Moreover, associations of SNPs (S2 and T1) with asthmatic mite-sensitized PER were observed in the study. The normal structure of mucosa in nasal cavity is similar to that of bronchial mucosa, which characteristically manifests pseudostratified ciliated columnar epithelium [27]. Also, they both share the commonness of immunological process. Allergens and inflammation factors absorbed in nasal mucosa can influence lower part of airway and inflammatory infiltration of mucosa is resembled both in AR and asthma. Viewing as a whole, hyperresponsiveness present in upper airway contribute to AR and in lower airway represent asthma. ADAM33 protein has been proposed to contribute to the remodeling process present in asthma and BHR [8]. ADAM33 mRNA was seen in asthmatic subepithelial fibroblasts and smooth muscle [28] and was significantly higher in the epithelium, submucosal cells and airway smooth muscle in severe bronchial asthma [29], [30], [31]. Thus, we proposed that ADAM33 may also be implicated in the progression of PER and upper airway remodeling process. ADAMs were originally identified as membrane-anchored proteins on the cell surface that mediate adhesion and proteolysis, and play pivotal roles in cell-to-cell interactions, cell signaling and the remodeling of extracellular matrix components [32]. ADAMs include matrix metalloproteinases (MMPs), specifically regulated by tissue inhibitors of metalloproteinases (TIMPs) during tissue remodeling. ADAM33 may release growth factors (such as EGF, TGF-β and IGF) and modify cell-surface receptor expression to stimulate the proliferation of airway mesenchymocytes in response to injury. Besides, ADAM33 might act as a dominant negative regulator, fusagen or an enhancer of a mesenchymal cell migration in the progress of airway remodeling [33], [34]. As indicated above, SNPs located in functional domain of the ADAM33 gene may contribute to transcription and expression of ADAM33 mRNA and protein, and finally influence the function of ADAM33 in the pathogenesis of AR. For instance, F1 (Thr178Ala, in exon 6) may influence the gene expression and the composition and structure of protein. S2 is a polymorphism located in exon encoding the transmembrane domain, which is predicted to influence anchoring ADAM33 protein to the cell membrane. Although S2 encodes the synonymous exon (Gly717Gly) which does not change amino acid sequence or missense, it may alter the mRNA folding, mRNA stability and translation [35]. Further studies are warranted to reveal the influence of S2 variation to ADAM33 function. Additionally, the intracellular domain of ADAM33 is relatively short in comparison with its nearest homologues but it is very rich in prolines and has a putative SH3 binding site (PsWPLDP) where T2 is located and may affect function [9]. T1 is in the intracellular domain that may affect bi-directional signaling. V2 and V4 located in 3′UTR and rs2787093 located in 3′near gene may affect the mRNA transcription. Our result of the association of S2 and F1 polymorphisms in ADAM33 with mite-sensitized PER had been previously confirmed in SAR due to Japanese cedar pollen [20]. However, the significant association of other SNPs (T1 and T2) with cedar pollinosis was observed in the Japanese patients, but not in our patients with mite-sensitized PER. The S2 polymorphism in ADAM33 had also been reported to be associated with asthma in many case-control studies of diverse population, including Japanese [14], British [36], and Irish [13], but not American [16], Germany [37], Brazilian [38], and Colombians [24]. Several reasons can explain the variety results of association of S2 with Asthma. Firstly, it is important to consider the genetic diversity of the populations reflected in differences in the occurrence of polymorphisms and their allelic frequencies. The minor allele frequency (MAF) of S2 in Chinese may be similar to that of Japanese (MAF = 0.250 in CHB+JBT show in Table 3), yet different from that in European (MAF = 0.091 showed in the HapMap) or other populations. Secondly, environmental influence is also a crucial factor in the progression of allergic diseases. Numerous environmental exposures such as allergen, air pollution, smoking, diet, pet keeping, microbial exposure, moisture and dampness, and chemicals at the workplace have been related to the new onset of asthma [39]. Thereby, the gene effect may differ from various populations respect to their environmental exposure. Further studies should focus on the gene-environment interaction of AR and asthma to uncover the mechanism of onset and progression of the diseases. Three SNPs (T1, T+1 and V4), which have no association with mite-sensitized PER in our study, had been previously reported to be significantly associated with AR in population of northern China [12]. The controversial results may due to its small sample size (135 cases and 151 controls) that did not have enough statistical power to reveal any significant ORs and the environmental differences between northern and eastern part of China. Also, several studies have reported no significant difference in variant genotype distributions of SNPs in the ADAM33 gene between the asthmatics and controls [37], [40], [41], [42], [43]. More studies of larger sample size are necessary for further confirming the association between the ADAM33 polymorphisms and AR in diverse populations. In the analysis of the association of individual SNP with AR-related clinical phenotypes, we found that two SNPs (S2 and T1) were significantly associated with concomitant asthma in PER patients, supporting the previous findings about the relation between ADAM33 polymorphisms and asthma. The association between ADAM33 polymorphisms and asthma has been reported in American (T1, T2 and T+1) [8], British (S2) [15], Japanese (S2, T1 and T2) [14], and Chinese (S2, T1, T2, and V4) [12] population. Moreover, recently several meta-analysis showed that polymorphisms in the ADAM33 gene are risk factors for asthma in the Asian (T1, V4, F+1, T2, and T+1) [44], [45] and European (S2) [46] population. However, a genome-wide association studies (GWAS) of Spanish individuals revealed that among 19 selected tag SNPs of ADAM33, only one SNP (rs2787095) was associated with asthma [17]. No evidence of ADAM33 polymorphisms associated with either serum total IgE or allergen-specific IgE level was found in our study. It suggests that airway remodeling function due to activity of ADAM33 protein may not accompany with the increase of IgE production. Lack of association between ADAM33 polymorphisms and serum total IgE levels was also reported in Japanese patients with cedar pollinosis [20] and in German and Australian Caucasian populations [19], yet was contradicted by the data from asthmatics of Dutch (S2), US white (T1 and T2) and US hispantic (T1 and T2) [16], and Colombian (T1 and T2) [24] population, suggesting an existence of race and ethnic difference. As shown in Table 7, we found that the combined genotypes with 2–4 risk alleles were associated with a higher risk of mite-sensitized PER among subgroups of adult subjects (≥18 years old). The difference of nasal structure and development of immune system between children and adults contribute to the dissimilarity of allergic symptoms between them. Moreover, prenatal factors and early life exposures, coupled with genetically determined susceptibility from parents, have a major impact on the natural history of childhood allergy [47], [48]. According to our results, we suggested that compared with children, adults might be more susceptible to the genetic effect caused by ADAM33, and the effect caused by ADAM33, such as airway remolding. Thus, besides the discrepancy of exposure environment, pediatric allergy may differ from adult allergy in effect of genetic variation. However, lack of the analysis in the interaction of environment and genetic polymorphism may cause this finding due to chance. In addition, we also were looking for a dose-response effect as one might expect that gene variants associated with increased airway remodeling, as suggested by Jongepier et al. [49], to be likewise increased in more severe AR. Actually, we did not found such relation of ADAM33 polymorphism and rhinitis severity in patients with mite-sensitized PER. Coherent with the negative results of individual SNP with IgE, no evidence of an increased risk of PER associated with elevated serum total or specific IgE was found in combined genotypes. Nevertheless, since our sample size might not be large enough and the selected bias could not be excluded completely, the finding might be due to chance and should be interpreted with caution. As multiple SNPs may act in combination to increase the risk of AR, we further analyzed the ADAM33 haplotype structure and frequencies, and identified a haplotype (ACAGCCT), carrying wild-type alleles of each polymorphism, that might account for susceptibility to protect against mite-sensitized PER. Although the significance for AGAGCGT haplotype did not remain after the Bonferroni’s correction, consistent with our genotype analysis, AGAGCGT haplotype carrying S2 G allele was pronounced a borderline significantly increased risk of mite-sensitized PER. In conclusion, our data suggested that ADAM33 polymorphisms might play an important role in the pathogenesis of mite-sensitized PER in this Chinese population. However, functional studies are needed to elucidate the role of ADAM33 polymorphisms in the molecular mechanisms underlying nasal allergy, and more detailed environmental exposure data are needed to confirm the effect of gene-environment interaction on mite-sensitized PER.
  49 in total

Review 1.  The ADAM gene family: surface proteins with adhesion and protease activity.

Authors:  P Primakoff; D G Myles
Journal:  Trends Genet       Date:  2000-02       Impact factor: 11.639

2.  Association of STAT6 and ADAM33 single nucleotide polymorphisms with asthma bronchiale and IgE level and its possible epigenetic background.

Authors:  Marek Godava; Frantisek Kopriva; Jana Bohmova; Radek Vodicka; Ladislav Dusek; Michaela Cvanova; Jan Muzik; Marie Markova; Eva Schneiderova; Radek Vrtel
Journal:  Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub       Date:  2012-01-30       Impact factor: 1.245

3.  Association of IL-4 and ADAM33 gene polymorphisms with asthma in an Indian population.

Authors:  Mahdi Bijanzadeh; Nallur B Ramachandra; P A Mahesh; R Savitha Mysore; Pradeep Kumar; B S Manjunath; B S Jayaraj
Journal:  Lung       Date:  2010-06-04       Impact factor: 2.584

Review 4.  Evidence for common genetic elements in allergic disease.

Authors:  K C Barnes
Journal:  J Allergy Clin Immunol       Date:  2000-11       Impact factor: 10.793

Review 5.  ADAM metallopeptidase domain 33 (ADAM33): identification and role in airways disease.

Authors:  Stephen T Holgate
Journal:  Drug News Perspect       Date:  2010 Jul-Aug

Review 6.  A disintegrin and metalloprotease 33 (ADAM33) gene polymorphisms and the risk of asthma: a meta-analysis.

Authors:  Siqiao Liang; Xuan Wei; Chen Gong; Jinmei Wei; Zhangrong Chen; Jingmin Deng
Journal:  Hum Immunol       Date:  2013-02-01       Impact factor: 2.850

7.  Association between ADAM33 S2 and ST+4 polymorphisms and susceptibility to asthma: a meta-analysis.

Authors:  Gwan Gyu Song; Jae-Hoon Kim; Young Ho Lee
Journal:  Gene       Date:  2013-04-21       Impact factor: 3.688

8.  Association between ADAM33 T1 polymorphism and susceptibility to asthma in Asians.

Authors:  Young Ho Lee; Gwan Gyu Song
Journal:  Inflamm Res       Date:  2012-08-01       Impact factor: 4.575

9.  Increased expression of ADAM33 protein in asthmatic patients as compared to non-asthmatic controls.

Authors:  Priya Tripathi; Shally Awasthi; Nuzhat Husain; Rajendra Prasad; Vikas Mishra
Journal:  Indian J Med Res       Date:  2013-03       Impact factor: 2.375

10.  Assessing the validity of asthma associations for eight candidate genes and age at diagnosis effects.

Authors:  María Pino-Yanes; Almudena Corrales; José Cumplido; Paloma Poza; Inmaculada Sánchez-Machín; Anselmo Sánchez-Palacios; Javier Figueroa; Orlando Acosta-Fernández; Nisa Buset; José Carlos García-Robaina; Mariano Hernández; Jesús Villar; Teresa Carrillo; Carlos Flores
Journal:  PLoS One       Date:  2013-09-09       Impact factor: 3.240

View more
  4 in total

Review 1.  Chinese Society of Allergy Guidelines for Diagnosis and Treatment of Allergic Rhinitis.

Authors:  Lei Cheng; Jianjun Chen; Qingling Fu; Shaoheng He; Huabin Li; Zheng Liu; Guolin Tan; Zezhang Tao; Dehui Wang; Weiping Wen; Rui Xu; Yu Xu; Qintai Yang; Chonghua Zhang; Gehua Zhang; Ruxin Zhang; Yuan Zhang; Bing Zhou; Dongdong Zhu; Luquan Chen; Xinyan Cui; Yuqin Deng; Zhiqiang Guo; Zhenxiao Huang; Zizhen Huang; Houyong Li; Jingyun Li; Wenting Li; Yanqing Li; Lin Xi; Hongfei Lou; Meiping Lu; Yuhui Ouyang; Wendan Shi; Xiaoyao Tao; Huiqin Tian; Chengshuo Wang; Min Wang; Nan Wang; Xiangdong Wang; Hui Xie; Shaoqing Yu; Renwu Zhao; Ming Zheng; Han Zhou; Luping Zhu; Luo Zhang
Journal:  Allergy Asthma Immunol Res       Date:  2018-07       Impact factor: 5.764

2.  Association of VDR and CYP2R1 Polymorphisms with Mite-Sensitized Persistent Allergic Rhinitis in a Chinese Population.

Authors:  Hui-Qin Tian; Xin-Yuan Chen; Ying Lu; Wen-Min Lu; Mei-Lin Wang; Hai-Long Zhao; Mei-Ping Lu; Han Zhou; Ruo-Xi Chen; Zheng-Dong Zhang; Chong Shen; Lei Cheng
Journal:  PLoS One       Date:  2015-07-15       Impact factor: 3.240

3.  Association of Single Nucleotide Polymorphisms in the MD-2 Gene Promoter Region With Der p 2 Allergy.

Authors:  En Chih Liao; Ching Yun Chang; Chia Che Wu; Gou Jen Wang; Jaw Ji Tsai
Journal:  Allergy Asthma Immunol Res       Date:  2015-03-05       Impact factor: 5.764

4.  Genetic association of ADAM33 polymorphisms with childhood asthma in Chinese Han population: A case-control study.

Authors:  Xuecong Ning; Yunxia Zhang; Hongzhi Wu; Linlin Bai; Cuike Gong; Zhihua Wang
Journal:  Medicine (Baltimore)       Date:  2019-10       Impact factor: 1.817

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.