Literature DB >> 24725913

Prevalence and distribution of Aggregatibacter actinomycetemcomitans and its cdtB gene in subgingival plaque of Chinese periodontitis patients.

Xiaoqian Wang, Lu Li, Mifang Yang, Ying Geng, Huiping Chen, Yan Xu1, Ying Sun.   

Abstract

BACKGROUND: Aggregatibacter actinomycetemcomitans (A.actinomycetemcomitans) is an important periodontal pathogen that can participate in periodontitis and other non-oral infections. The cytolethal distending toxin (Cdt) is among the virulence factors produced by this bacterium. This study was to elucidate the distribution of A.actinomycetemcomitans and the prevalence of its cdtB gene in Chinese subjects.
METHODS: A total of 255 subgingival samples were obtained from 30 subjects. Samples were collected from periodontal healthy sites as well as shallow, moderate and deep pockets. The absolute quantity of A.actinomycetemcomitans and cdtB gene were determined by real-time polymerase chain reaction.
RESULTS: A.actinomycetemcomitans was detected in 92 of 105 (87.6%) samples of aggressive periodontitis (AgP) patients, in 73 of 79 (92.4%) samples of chronic periodontitis ( CP) patients and in 5 of 71 (7.0%) samples of periodontal healthy subjects. The cdtB gene was detected in 72 sites (78.3%) with AgP infected with A.actinomycetemcomitans, 54 sites (74.0%) with CP infected with A.actinomycetemcomitans and none in healthy sites infected with A.actinomycetemcomitans. In addition, quantity of A.actinomycetemcomitans and cdt gene in samples from deep pockets were significant larger than moderate, shallow and healthy sites (P < 0.05). In comparison to CP, AgP patients were infected with increased numbers of cdt genotype in deep pockets (P < 0.05).
CONCLUSION: This study suggests that the cdtB gene are prevalent in A.actinomycetemcomitans, and the distribution of cdt genotype strain may be correlated with AgP and serious periodontal inflammation.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24725913      PMCID: PMC4002197          DOI: 10.1186/1472-6831-14-37

Source DB:  PubMed          Journal:  BMC Oral Health        ISSN: 1472-6831            Impact factor:   2.757


Background

Periodontitis is a chronic inflammatory disease leading to the loss of periodontal tissues, which is highly prevalent and is the major cause of tooth loss in adults. Aggressive periodontitis (AgP) is characterized with rapid development and serious bone resorption, generally affects younger patients than does the chronic form. A.actinomycetemcomitans is a Gram-negative, non motile rod, facultative anaerobic and commensal bacterium, which has long been strongly associated with AgP and may also contribute to chronic periodontitis (CP). Apart from oral infection, this bacterium has also been responsible for some systemic infectious diseases, such as endocarditic, meningitis, osteomyelitis, glomerulonephritis and arthritis [1]. This microorganism expresses several potential virulence factors that are involved in the colonization in oral cavity, inhibition of regeneration of periodontal tissues and interference with host defense mechanisms. In 1998, Ohguchi [1] revealed that A.actinomycetemcomitans could produce cytolethal distending toxin (CDT), which was secreted into the bacterial culture supernatant. It is clear that CDT is encoded by three genes designated cdtA, cdtB, and cdtC, which are arranged as an apparent operon. These three genes specify three polypeptides designated CdtA, CdtB and CdtC with apparent molecular masses of 28, 32 and 20 kDa respectively, which form a heterotrimeric holotoxin [2-5]. CdtA and CdtC are necessary for the secretion of the toxin, while CdtB is responsible for the biologic activity [6]. CdtB has a sequence homology with mammalian DNase I, indicating a critical role for nuclease activity in host parasite interactions [7]. Among periodontal pathogenic bacteria, A.actinomycetemcomitans is the unique bacterium that can produce CDT. Accumulating evidences show that CDT is associated with the persistence of infection in animal models [7], increased expression of RANKL (receptor activation of nuclear factor-κB ligand) and the consequent osteoclastogenesis [3]. There was report showing that cdtABC was absent [8] in A.actinomycetemcomitans isolated in Japan [9], but Kawamoto confirmed that cdtABC was frequently found in the genome of A.actinomycetemcomitans[10]. Till now, there have been few reports on the prevalence of cdt genotype strain of A.actinomycetemcomitans in Chinese periodontitis patients. Accumulating evidences show that CDT is associated with the persistence of infection in animal models [7], increased expression of RANKL (receptor activation of nuclear factor-κB ligand) and the consequent osteoclastogenesis [3]. The association of CDT genetic diversity within A.actinomycetemcomitans should be better evaluated. In this study, we detected the distribution of A.actinomycetemcomitans and the prevalence of its putative virulence factor CDT encoding gene cdtB in subgingival plaque obtained from Chinese patients suffering from CP and AgP by real-time PCR, to evaluate the association of A.actinomycetemcomitans CDT genetic diversity and clinical features.

Methods

Subjects

This study was approved by the Ethical Committee of Stomatological Hospital affiliated to Nanjing Medical University, Nanjing, China. The purposes and procedures of the study were explained and informed consents were obtained from all recruits. Participants included in the present study were recruited at the Stomatological Hospital affiliated to Nanjing Medical University, from December 2008 to March 2009. 10 CP patients, 10 AgP patients and 10 healthy subjects were recruited in this study. The criteria for patient inclusion were as follows: (i) ethnic Han and<40 years old; (ii) no history of periodontal therapy; (iii) no systemic antibiotics or anti-inflammatory drugs taken within 3 months; (iv) healthy systemic conditions; (v) no pregnancy , and (vi) were not current users of tobacco products or nicotine replacement medication [10]. The periodontal healthy subjects had no sites with probing depth (PD) >3 mm or clinical attachment loss (CAL) >1 mm, and no more than 10% of sites with bleeding on probing (BOP).The diagnoses of CP and AgP were made based on criteria defined at the workshop sponsored by the American Academy of Periodontology (AAP) in 1999 [11-13]. Sample sites were classified as shallow, moderate or deep according to the levels of PD and CAL. The level of PD was about 3 mm or the level of CAL was 1–2 mm in shallow group; and 4–6 mm of PD or 3–4 mm of CAL in moderate group. In deep group, the level of PD was over 6 mm or CAL ≥ 5 mm [12].

Clinical measurements

Before sampling, a complete periodontal examination was conducted to record clinical periodontal parameters by using FP32 probe (Florida probe, USA), including PD, CAL and BOP. All measurements were performed by a calibrated examiner. To avoid any contaminations that might result from bleeding on probing, clinical probing and measurement were carried out at least 7 days in advance of bacteria sampling [14].

Sampling of subginginval bacteria plaque

8–10 samples were taken from shallow, moderate and deep sites of each enrolled patients suffering from CP and AgP, as well as from gingival sulci of healthy controls. After careful removal of supragingival plaque deposits, the sampling site was isolated with cotton rolls and gently air-dried. Then, a 30# paper point [15,16] was inserted into the pockets/gingival sulci and left in place for 30s. The paper point from each sampling site was immediately placed into an empty 1.5 ml microfuge tube. Samples for PCR analysis were stored at -80°C.

Positive control bacterial strains

A.actinomycetemcomitans ATCC 29522, ATCC 29523, ATCC 24523 were grown anaerobically (75% N2, 10% CO2, 15% H2) at 37°C on 5% sheep blood agar plates (Oxoid, UK) enriched with haemin (5 mg/l) and menadione (1 mg/l) for 3–5 days, and then inoculated into brain heart infusion broth until grown to the late logarithmic phase of growth. The bacteria were harvested by centrifugation, washed in PBS, and re-suspended at a concentration with optical density at 690 nm of 1, corresponding to approximately 1 × 108 colony-forming units (CFU)/ml [17].

Oligonucleotide primers and TaqMan probes

Identification of conserved regions was done by multiple sequence alignment with ClustalW software based on the published 16S rDNA and cdtB sequences. The fluorescent dyes at the 5′ and 3′ ends of the probe were FAM (6-carboxyfluorescein; reporter) and TAMRA (6-carboxytetramethylrhodamine; quencher), respectively. All primers and probes were checked for possible cross-hybridization with bacterial genes using the database similarity search program BLAST. Primers and probes used for quantification of A actinomycetemcomitans 16S rDNA and cdt gene were shown in Table  1.
Table 1

Primers and TaqMan probes sequences

PrimerSequenceProducts size
Aa-F
GCTGGTCTGAGAGGATGGC
 
Aa-R
CGAAAGAACTTTACAACCCGA
153 bp
Aa-P
CCTACGGGAGGCAGCAGTGG
 
cdtB-F
ATTCTTCTGTGCTTCAATCTCG
 
cdtB-R
GGTGATGATGGTGATGAGGTAA
151 bp
cdtB-PCACAGGTGGTTCTGATGCGGTAA 

Aa-F, Aa-R and Aa-P stand for primers and TaqMan probe for A.actinomycetemcomitans 16 s rDNA; cdtB-F, cdtB-R and cdtB-P stand for primers and TaqMan probe for A.actinomycetemcomitans cdtB.

Primers and TaqMan probes sequences Aa-F, Aa-R and Aa-P stand for primers and TaqMan probe for A.actinomycetemcomitans 16 s rDNA; cdtB-F, cdtB-R and cdtB-P stand for primers and TaqMan probe for A.actinomycetemcomitans cdtB.

Standard curves construction

In order to establish the quantitative assay, plasmids containing the target sequences of A.actinomycetemcomitans 16S rDNA and cdt gene were cloned using the pMD 19 T-Vector (Takara, Japan). PCR products for A.actinomycetemcomitans 16S rDNA and cdt gene were inserted into plasmid vectors respectively, and the recombinant vectors were transformed into E. coli. Then, the plasmids were purified with Mini BEST Plasmid Purification Kit (Takara, Japan). The purified plasmids were quantified by spectrophotometry. Standard curves were constructed by using serial diluted purified plasmids with predetermined concentrations on the basis of the linear relationship between the Ct and the logarithm of the starting gene amount. Sensitivity of the developed real-time PCR assay was evaluated by using 107–10° plasmid copies of A. actinomycetemcomitans and cdtB gene (data not shown), limit of approximately 10 cells was established in the PCR reaction mixture.

DNA extraction and Real-time PCR

Each sample was diluted in 500 μl distilled water, dispersed in vortex for 1 min, took out the paper points before DNA extraction. Then, DNA was purified by the Mini BEST Bacteria Purification Kit (Takara, Japan), and eluted in 60 μl elution buffer. TaqMan Universal PCR Master Mix (Applied Biosystems, USA) was used for PCR analysis. The final concentration was used in a total volume of 10 μl contained 5 μl of 2 × Master Mix, 3 μl of DNA template, 0.9 mM of each primer and 0.25 mM of probe. Real-time PCR was carried out in duplicates in ABI 7900 HT system (Applied Biosystems, USA) with the following sequence: 2 min at 50°C, 10 min at 95°C and 40 cycles of 15 s at 95°C and 1 min at 60°C.

Statistical analysis

Descriptive analysis was performed for all variables. Quantitative variables were described by mean values, standard deviations, as well as minimum and maximum values. Qualitative variables were described by absolute and relative frequencies. Comparisons were made between groups (AgP, CP and healthy subjects) for independent variables (PD) by applying analysis of variance (ANOVA). All tests were performed using SPSS for Windows Release 12.0 (USA) and P values less than 0.05 were considered significant.

Results

Clinical analysis

We analyzed plaque samples collected from 30 subjects following the protocols described above. This study consisted of 255 subgingival plaque samples, which were collected from 10 AgP patients, 10 CP patients and 10 periodontal healthy subjects. The study population had no previous history of smoking or periodontal treatment. The mean values of PD, CAL and BOP (%) of all sampling sites were shown in Table  2. These results revealed that there were no statistical differences in these parameters between CP and AgP groups, while there were significant differences between either CP group or AgP group and periodontal healthy subjects.
Table 2

Clinical characteristics of periodontitis patients and healthy controls

 HCPAgP
Subjects
10
10
10
Sampling sites
71
79
105
Age(years-old, mean ± SD)
27.5 ± 2.1
32.5 ± 1.8
29.7 ± 2.1
Gender(male/female)
5/5
5/5
5/5
PD(mm, mean ± SD)
2.4 ± 0.8
4.1 ± 2.0 *
4.9 ± 1.9 *
CAL(mm, mean ± SD)
0
4.8 ± 2.0 *
4.5 ± 1.9 *
BOP(%, mean ± SD)15.8 ± 0.930.8 ± 5.5 *30.6 ± 7.2 *

AgP, CP and H stand for aggressive periodontitis, chronic periodontitis and periodontal healthy, respectively.

The mean probing depth, clinical attachment loss and bleeding on probing (%) were recorded in 255 sampling sites from 30 patients. * There were significant differences for mean probing depth, clinical attachment loss and bleeding on probing (%) between AgP or CP and H (P < 0.05), but there was no significant difference between AgP and CP.

Clinical characteristics of periodontitis patients and healthy controls AgP, CP and H stand for aggressive periodontitis, chronic periodontitis and periodontal healthy, respectively. The mean probing depth, clinical attachment loss and bleeding on probing (%) were recorded in 255 sampling sites from 30 patients. * There were significant differences for mean probing depth, clinical attachment loss and bleeding on probing (%) between AgP or CP and H (P < 0.05), but there was no significant difference between AgP and CP.

Occurrence and distribution of A.actinomycetemcomitans

Using real-time PCR, we examined 255 subgingival plaque samples to evaluate the levels of A.actinomycetemcomitans in different status of periodontal sites. Among all of the 255 subgingival samples, A.actinomycetemcomitans was detected from 170 (66.7%) samples. Only 5 samples (7.0%) out of the 71 subgingival samples from the periodontally healthy individuals were A.actinomycetemcomitans 16 s rDNA positive (Table  3). 73 of the 79 subgingival plaque samples (92.4%) from CP patients were A.actinomycetemcomitans 16 s rDNA positive. And among the 105 subgingival plaque samples from AgP patients, 92 (87.6%) were A.actinomycetemcomitans 16 s rDNA positive. There was no statistical difference of A.actinomycetemcomitans positive rates between CP (92.4%) and AgP (87.6%) (P > 0.05) (Table  3).
Table 3

Prevalence of and in all sampling sites

 AgPCPH
Total
105
79
71
Aa(+)
92
73
5
Aa(+)/Total(%)
87.6
92.4
7.0
cdt(+)
72
54
0
cdt(+)/Aa(+)(%)
78.3
74.0
0
Quantity-Aa
2.3 ± 1.1*
2.1 ± 0.9*
0.8 ± 0.5
Quantity-cdt1.6 ± 0.8**1.3 ± 0.8***0.4 ± 0.3

Aa, AgP, CP and H stand for A.actinomycetemcomitans, aggressive periodontitis samples, chronic periodontitis samples and periodontal healthy samples, respectively.

*There were significant differences for quantity of A.actinomycetemcomitans between AgP or CP and H (P < 0.05) and no significant differences between AgP and CP (P > 0.05). **Quantity of cdt genotype of A.actinomycetemcomitans from AgP samples were significantly higher than that of CP and H (P < 0.05). ***Quantity of cdt genotype of A.actinomycetemcomitans from CP samples were significantly higher than H (P < 0.05).

Prevalence of and in all sampling sites Aa, AgP, CP and H stand for A.actinomycetemcomitans, aggressive periodontitis samples, chronic periodontitis samples and periodontal healthy samples, respectively. *There were significant differences for quantity of A.actinomycetemcomitans between AgP or CP and H (P < 0.05) and no significant differences between AgP and CP (P > 0.05). **Quantity of cdt genotype of A.actinomycetemcomitans from AgP samples were significantly higher than that of CP and H (P < 0.05). ***Quantity of cdt genotype of A.actinomycetemcomitans from CP samples were significantly higher than H (P < 0.05). Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA in healthy subjects, CP patients and AgP patients were 0.8 ± 0.5, 2.1 ± 0.9 and 2.3 ± 1.1 (Table  3), respectively. Higher numbers of A.actinomycetemcomitans were detected in samples from periodontitis sites in contrast to those from healthy subjects (P < 0.05). However, there were no significant differences between these two periodontitis groups (P > 0.05).

Prevalence and distribution of A.actinomycetemcomitans cdtB gene

Out of 255 subgingival samples, A.actinomycetemcomitans cdtB was detected in 126 (49.4%) samples. In the 71 subgingival samples from periodontal healthy individuals, none of the samples were cdtB positive (Table  3). While 54 of the 73 (74.0%) A.actinomycetemcomitans positive subgingival plaque samples from CP patients were cdtB positive. Among the 92 A.actinomycetemcomitans positive subgingival plaque samples from AgP patients, 72 (78.3%) samples were A.actinomycetemcomitans cdtB positive. There was no statistical difference for the A.actinomycetemcomitans cdtB positive rates between CP (74.0%) and AgP (78.4%) (P > 0.05). None of the A.actinomycetemcomitans 16 s rDNA negative samples were positive for cdtB. Levels of cdtB gene were also detected in 255 samples. Mean log-transformed numbers of cdtB in CP and AgP were 1.3 ± 0.8 and 1.6 ± 0.8 (Table  3). Samples of AgP group showed the higher numbers of cdtB genotype A.actinomycetemcomitans contrast to CP group and periodontal healthy subjects (P < 0.05).

Association of A.actinomycetemcomitans and cdt distribution with different periodontal status

Mean log-transformed numbers of A.actinomycetemcomitans and cdtB gene in shallow, moderate and deep pockets were 1.8 ± 0.9, 2.2 ± 0.8, 3.1 ± 1.2 and 1.3 ± 0.8, 1.5 ± 0.8, 2.1 ± 1.1 (Table  4), respectively. Higher quantity of A.actinomycetemcomitans and cdtB gene in deep periodontal pockets were detected than moderate and shallow pockets (P < 0.05).
Table 4

Prevalence and distribution of and in periodontitis sampling sites by probing depth

 ShallowModerateDeep
Total
100
49
35
Quantity-Aa
1.8 ± 0.9
2.2 ± 0.8*
3.1 ± 1.2**
Quantity-cdt1.3 ± 0.81.5 ± 0.82.1 ± 1.1**

*Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA from moderate pockets samples were significantly higher than that from shallow pockets (P < 0.05).

**Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA and cdt genotype of A.actinomycetemcomitans from deep pockets samples were significantly higher than that from moderate and shallow pockets (P < 0.05).

Prevalence and distribution of and in periodontitis sampling sites by probing depth *Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA from moderate pockets samples were significantly higher than that from shallow pockets (P < 0.05). **Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA and cdt genotype of A.actinomycetemcomitans from deep pockets samples were significantly higher than that from moderate and shallow pockets (P < 0.05). With respect to the various periodontal statuses, mean log-transformed numbers of A.actinomycetemcomitans and cdtB gene from CP and AgP in shallow, moderate and deep pockets were shown in Figure  1 respectively. The quantity of A.actinomycetemcomitans and cdtB gene in deep periodontal pockets from AgP was higher than CP (P < 0.05).
Figure 1

Mean log-transformed numbers of A.actinomycetemcomitans 16s rDNA and cdtB in shallow, moderate and deep periodontal pockets. a. Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA in shallow (n = 48), moderate (n = 20), deep (n = 11) periodontal pockets from CP subjects were 1.9 ± 0.8, 2.1 ± 0.8 and 2.5 ± 1.0, respective. Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA in shallow (n = 52), moderate (n = 29), deep (n = 24) periodontal pockets from AgP subjects were 1.7 ± 0.8, 2.3 ± 0.8 and 3.4 ± 1.1, respective. * The quantity of A.actinomycetemcomitans in deep periodontal pockets from AgP was higher than CP (P < 0.05). b. Mean log-transformed numbers of A.actinomycetemcomitans cdtB in shallow (n = 48), moderate (n = 20), deep (n = 11) periodontal pockets from CP subjects were 0.8 ± 0.1, 1.5 ± 0.8 and 1.3 ± 0.7, respective. Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA in shallow (n = 52), moderate (n = 29), deep (n = 24) periodontal pockets from AgP subjects were 0.8 ± 0.1, 1.6 ± 0.8 and 2.6 ± 1.0, respective. * The quantity of A.actinomycetemcomitans cdtB in deep periodontal pockets from AgP was higher than CP (P < 0.05).

Mean log-transformed numbers of A.actinomycetemcomitans 16s rDNA and cdtB in shallow, moderate and deep periodontal pockets. a. Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA in shallow (n = 48), moderate (n = 20), deep (n = 11) periodontal pockets from CP subjects were 1.9 ± 0.8, 2.1 ± 0.8 and 2.5 ± 1.0, respective. Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA in shallow (n = 52), moderate (n = 29), deep (n = 24) periodontal pockets from AgP subjects were 1.7 ± 0.8, 2.3 ± 0.8 and 3.4 ± 1.1, respective. * The quantity of A.actinomycetemcomitans in deep periodontal pockets from AgP was higher than CP (P < 0.05). b. Mean log-transformed numbers of A.actinomycetemcomitans cdtB in shallow (n = 48), moderate (n = 20), deep (n = 11) periodontal pockets from CP subjects were 0.8 ± 0.1, 1.5 ± 0.8 and 1.3 ± 0.7, respective. Mean log-transformed numbers of A.actinomycetemcomitans 16 s rDNA in shallow (n = 52), moderate (n = 29), deep (n = 24) periodontal pockets from AgP subjects were 0.8 ± 0.1, 1.6 ± 0.8 and 2.6 ± 1.0, respective. * The quantity of A.actinomycetemcomitans cdtB in deep periodontal pockets from AgP was higher than CP (P < 0.05).

Discussion

This research we employed TaqMan real-time PCR to direct target quantification A.actinomycetemcomitans and cdtB gene in different severity of periodontitis sites of AgP or CP patients.and it is effective for detecting pathogen species that are extremely difficult to culture. Therefore, we chose different periodontal sites as targets to explore the occurrence and quantity of A.actinomycetemcomitans and its CDT encoding gene in Chinese subjects and different periodontal status. A.actinomycetemcomitans might not be present in all oral sites in an untreated periodontitis patient [18]. Taking subgingival samples from all teeth would be the most reliable way to detect A.actinomycetemcomitans. However, this method is money- consuming and time-consuming which is not suitable to be used in daily practice. Sampling from the deepest pocket of each quadrant has been demonstrated to be quite reliable for detecting the subgingival presence of periodontal pathogens in untreated patients [18]. This technique was based on individual level. While one suffered from periodontitis, aggressive or chronic mode, severity of periodontal disease might differ from site to site. So we evaluated relevance of A.actinomycetemcomitans and its CDT encoding gene with periodontitis stuates base on “site”. The primers chosen for detection of A.actinomycetemcomitans and cdt gene were based on A.actinomycetemcomitans 16 s rDNA gene and cdtB gene respectively. The 16 s rDNA gene has been reported to be highly conserved and this pattern for detection of A.actinomycetemcomitans has been well preserved [19,20]. Moreover, recent data have shown that CdtB is the main component and indispensable for the expression of CDT holotoxin activity [6,8], and the sequence of cdtB was also highly conserved among A.actinomycetemcomitans species [21]. Thus, the prevalence of CDT encoding genes was evaluated using cdtB specific primers and probes. Standard curves were used in this study to evaluate the absolute quantification of A.actinomycetemcomitans and cdt gene in samples. Plasmids containing cloned target sequences were used as standard substances in quantitative PCR, which enabled the measurements more precise and steady compared to using PCR amplicon as standard substances directly [22]. Some studies have examined the prevalence of A.actinomycetemcomitans in some different populations [4,13,18]. Our work is the first report on the analysis of both positive rate and absolute quantity of A.actinomycetemcomitans and its cdtB gene in Chinese periodontitis patients, and the association of the distribution of A.actinomycetemcomitans and cdtB with various periodontal status. We found that A.actinomycetemcomitans and its cdtB gene were significantly more prevalent and with higher quantity in samples from patients suffering from AgP or CP than periodontal healthy subjects, and A.actinomycetemcomitans and its cdt gene were also more prevalent and with higher quantity in deep periodontal pockets than in moderate and shallow periodontal pockets. Although A.actinomycetemcomitans is linked to the etiology of AgP, this bacterium is also found in subjects who are healthy or have other forms of periodontal disease [8]. Our results showed that only 7.0% periodontal healthy sites were A.actinomycetemcomitans positive; 92.4% CP samples and 87.6% AgP samples exhibited A.actinomycetemcomitans positive, demonstrating that the presence of A.actinomycetemcomitans was correlated with periodontitis. Quantitative data showed that the amount of A.actinomycetemcomitans in CP and AgP samples were observably higher than in healthy samples, while no difference between CP and AgP. But the amount of cdtB genotype strain of A.actinomycetemcomitans in AgP samples were remarkablly higher than in CP and healthy samples (Table  3). These data may indicate quantitative results were more suitable to analyse the distribution of A.actinomycetemcomitans and its cdtB genotype strains. The cdtB genotype strain of A. actinomycetemcomitans may be more relevant with aggressive periodontitis. Tan and his coworkers found A.actinomycetemcomitans with the cdt genotype were at a higher frequency from sites obtained from patients diagnosed with aggressive periodontitis [23]. Our study showed the cdtB genotype A.actinomycetemcomitans were at a higher quantity from sites obtained from deep pockets. The higher occurrence and amount of this bacterium in samples with severe periodontitis status was not a surprising observation. A.actinomycetemcomitans CDT toxin may be similar to H.ducreyi CDT toxin, which may contribute to the pathogenicity of bacteria at a higher concentration [7]. In vivo studies are still needed to explore the exact pathogenic role of A.actinomycetemcomitans CDT in the future. Our data showed A.actinomycetemcomitans and its cdt genotype strain were prevalent in deep and moderate periodontal pockets. To move forward a single step, quantitative analysis showed cdtB genotype strain of A.actinomycetemcomitans were more prevalent in deep periodontal pockets. The quantities of cdt genotype strain of A.actinomycetemcomitans were correlated with severe forms of periodontitis (CP or AgP). Numerous studies have considered A.actinomycetemcomitans as an important etiological microorganism involved in AgP [24-26], however, from a new perspective, our data showed that cdtB genotype strain of A.actinomycetemcomitans was mainly found among sites with severe forms of periodontitis. A.actinomycetemcomitans with cdtB genotype may be more virulent to human periodontium. As expected, none of the A.actinomycetemcomitans 16 s rDNA negative samples were positive for cdtB. This result confirmed that A.actinomycetemcomitans was the exclusive member in the oral microbial flora identified to carry and express the cytolethal distending toxin locus. Besides, there were 5 of healthy samples in our study which were positive for A.actinomycetemcomitans while negative for cdt. This may be results of minute quantity of cdt genotype strain of A. actinomycetemcomitans in this 5 subgingival plaque samples, while may be a new supporting proof for the exist of cdt-negative genotype strain of A.actinomycetemcomitans in oral cavity. The cdt gene as well as lktA (leukotoxin A) of A.actinomycetemcomitans is a single copy gene [21]. However, 16 s rDNA gene may generally have 4 to 6 copies per cell (e.g., 6 copies for E. coli) [22]. Our results showed that within the same sample the absolute quantity of A.actinomycetemcomitans 16 s rDNA were 1–10 times over that of cdtB gene, which indicated that one periodontal site might be infected with two or even more genotypes of A.actinomycetemcomitans simultaneously. Some genotypes of A.actinomycetemcomitans possess cdt gene, which could express CDT activity; while other genotypes of A.actinomycetemcomitans are cdt-negative, which would be less virulent than cdt-positive strains. Yamano [9] reported that 89% of A.actinomycetemcomitans strains possessed the cdt gene. Another study [4] discovered that 86% of A.actinomycetemcomitans isolates presented complete operon of cdt gene and its characteristic cytotoxic activity. Tan and his coworkers showed a close association between AgP and cdt-positive genotype A.actinomycetemcomitans strains [23]. These findings suggested that not all the strains of A.actinomycetemcomitans possessed cdt gene, in other words, not every A.actinomycetemcomitans strains presented cytotoxic CDT activity. Similar to A.actinomycetemcomitans strains, Campylobacter spp., C.jejuni, H.ducreyi and other CDT-producing bacteria don’t express CDT activity or contain all of the cdtABC genes in all strains [4].

Conclusion

Our study investigated the prevalence and distribution of A.actinomycetemcomitans and its cdt gene in subgingival plaque from Chinese periodontitis patients. The significantly increased quantities of cdt-positive genotype A.actinomycetemcomitans were found in AgP periodontal sites and in deep pockets of both CP and AgP patients, which indicated that cdt gene might be a potential virulence-associated gene involved in the pathogenesis of AgP and severe periodontal destruction. Our results suggested the importance of obtaining both A.actinomycetemcomitans titer and genotype identification in periodontitis microbiological diagnosis. Extensive studies are necessary for providing more information about the molecular pathophysiological role of A.actinomycetemcomitans and its CDT.

Transparency declaration

This study is supported by grants from the National Natural Science Foundation of China (Grant No. 81170962), Project of Science and Technology Department of Jiangsu Province (Grant No. BK2011763) and Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (Grant No. PAPD2011-2013).

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

XW and LL carried out the samples collection, periodontal examination, participated in the DNA extraction and Real-time PCR and drafted the manuscript. YG and HC participated in the sequence alignment. YX, YS participated in the design of the study. MY participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1472-6831/14/37/prepub
  26 in total

Review 1.  Development of a classification system for periodontal diseases and conditions.

Authors:  G C Armitage
Journal:  Ann Periodontol       Date:  1999-12

2.  A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein.

Authors:  M Lara-Tejero; J E Galán
Journal:  Science       Date:  2000-10-13       Impact factor: 47.728

3.  Prevalence of cdtABC genes encoding cytolethal distending toxin among Haemophilus ducreyi and Actinobacillus actinomycetemcomitans strains.

Authors:  H J Ahmed; L A Svensson; L D Cope; J L Latimer; E J Hansen; K Ahlman; J Bayat-Turk; D Klamer; T Lagergård
Journal:  J Med Microbiol       Date:  2001-10       Impact factor: 2.472

4.  Necessity of quality-controlled 16S rRNA gene sequence databases: identifying nontuberculous Mycobacterium species.

Authors:  C Y Turenne; L Tschetter; J Wolfe; A Kabani
Journal:  J Clin Microbiol       Date:  2001-10       Impact factor: 5.948

5.  Enumeration of Porphyromonas gingivalis, Prevotella intermedia and Actinobacillus actinomycetemcomitans in subgingival plaque samples by a quantitative-competitive PCR method.

Authors:  S Doungudomdacha; A Rawlinson; C W Douglas
Journal:  J Med Microbiol       Date:  2000-10       Impact factor: 2.472

6.  Parameter on aggressive periodontitis. American Academy of Periodontology.

Authors: 
Journal:  J Periodontol       Date:  2000-05       Impact factor: 6.993

7.  DNase I homologous residues in CdtB are critical for cytolethal distending toxin-mediated cell cycle arrest.

Authors:  C A Elwell; L A Dreyfus
Journal:  Mol Microbiol       Date:  2000-08       Impact factor: 3.501

8.  Occurrence of Aggregatibacter actinomycetemcomitans in Brazilians with chronic periodontitis.

Authors:  José Roberto Cortelli; Caio Vinícius Gonçalves Roman-Torres; Davi Romeiro Aquino; Gilson Cesar Nobre Franco; Fernando Oliveira Costa; Sheila Cavalca Cortelli
Journal:  Braz Oral Res       Date:  2010 Apr-Jun

9.  Genetic diversity and toxic activity of Aggregatibacter actinomycetemcomitans isolates.

Authors:  D Kawamoto; E S Ando; P L Longo; A C R Nunes; M Wikström; M P A Mayer
Journal:  Oral Microbiol Immunol       Date:  2009-12

10.  Prevalence of Actinobacillus actinomycetemcomitans in Chinese chronic periodontitis patients and periodontally healthy adults.

Authors:  Shu Meng; Lei Zhao; He Yang; Yafei Wu; Yuling Ouyang
Journal:  Quintessence Int       Date:  2009-01       Impact factor: 1.677

View more
  7 in total

1.  Host Chromatin Regulators Required for Aggregatibacter actinomycetemcomitans Cytolethal Distending Toxin Activity in Saccharomyces cerevisiae Model.

Authors:  Siriyod Denmongkholchai; Keiko Tsuruda; Motoyuki Sugai; Skorn Mongkolsuk; Oranart Matangkasombut
Journal:  Infect Immun       Date:  2021-07-15       Impact factor: 3.441

2.  Breaking the Gingival Epithelial Barrier: Role of the Aggregatibacter actinomycetemcomitans Cytolethal Distending Toxin in Oral Infectious Disease.

Authors:  Joseph M DiRienzo
Journal:  Cells       Date:  2014-05-23       Impact factor: 6.600

3.  A Cytolethal Distending Toxin Variant from Aggregatibacter actinomycetemcomitans with an Aberrant CdtB That Lacks the Conserved Catalytic Histidine 160.

Authors:  Davor Obradović; Rok Gašperšič; Simon Caserman; Adrijana Leonardi; Maja Jamnik; Zdravko Podlesek; Katja Seme; Gregor Anderluh; Igor Križaj; Peter Maček; Matej Butala
Journal:  PLoS One       Date:  2016-07-14       Impact factor: 3.240

4.  Assessing the progression of chronic periodontitis using subgingival pathogen levels: a 24-month prospective multicenter cohort study.

Authors:  E Kakuta; Y Nomura; T Morozumi; T Nakagawa; T Nakamura; K Noguchi; A Yoshimura; Y Hara; O Fujise; F Nishimura; T Kono; M Umeda; M Fukuda; T Noguchi; N Yoshinari; C Fukaya; S Sekino; Y Numabe; N Sugano; K Ito; H Kobayashi; Y Izumi; H Takai; Y Ogata; S Takano; M Minabe; A Makino-Oi; A Saito; Y Abe; S Sato; F Suzuki; K Takahashi; T Sugaya; M Kawanami; N Hanada; S Takashiba; H Yoshie
Journal:  BMC Oral Health       Date:  2017-01-16       Impact factor: 2.757

5.  Impact of polyols on Oral microbiome of Estonian schoolchildren.

Authors:  Jelena Štšepetova; Jaak Truu; Riina Runnel; Rita Nõmmela; Mare Saag; Jana Olak; Hiie Nõlvak; Jens-Konrad Preem; Kristjan Oopkaup; Kaarel Krjutškov; Eino Honkala; Sisko Honkala; Kauko Mäkinen; Pirkko-Liisa Mäkinen; Tero Vahlberg; Joan Vermeiren; Douwina Bosscher; Peter de Cock; Reet Mändar
Journal:  BMC Oral Health       Date:  2019-04-18       Impact factor: 2.757

6.  Prevalence of target anaerobes associated with chronic periodontitis.

Authors:  Ameerah M Alazemi; W Jamal; A Al Khabbaz; V O Rotimi
Journal:  Access Microbiol       Date:  2020-11-16

Review 7.  Impact of CDT Toxin on Human Diseases.

Authors:  Tiphanie Faïs; Julien Delmas; Arnaud Serres; Richard Bonnet; Guillaume Dalmasso
Journal:  Toxins (Basel)       Date:  2016-07-15       Impact factor: 4.546

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.