Literature DB >> 24714200

Tools for gene-regulatory analyses in the marine annelid Platynereis dumerilii.

Benjamin Backfisch1, Vitaly V Kozin2, Stephan Kirchmaier3, Kristin Tessmar-Raible1, Florian Raible1.   

Abstract

The advent of high-throughput sequencing technology facilitates the exploration of a variety of reference species outside the few established molecular genetic model systems. Bioinformatic and gene expression analyses provide new ways for comparative analyses between species, for instance, in the field of evolution and development. Despite these advances, a critical bottleneck for the exploration of new model species remains the establishment of functional tools, such as the ability to experimentally express genes in specific cells of an organism. We recently established a first transgenic strain of the annelid Platynereis, using a Tc1/mariner-type Mos1 transposon vector. Here, we compare Mos1 with Tol2, a member of the hAT family of transposons. In Platynereis, Tol2-based constructs showed a higher frequency of nuclear genome insertion and sustained gene expression in the G0 generation. However, in contrast to Mos1-mediated transgenes, Tol2-mediated insertions failed to retain fluorescence in the G1 generation, suggesting a germ line-based silencing mechanism. Furthermore, we present three novel expression constructs that were generated by a simple fusion-PCR approach and allow either ubiquitous or cell-specific expression of a reporter gene. Our study indicates the versatility of Tol2 for transient transgenesis, and provides a template for transgenesis work in other emerging reference species.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24714200      PMCID: PMC3979674          DOI: 10.1371/journal.pone.0093076

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The selection of a few species as “molecular model systems” has helped researchers to gain deep insight into the molecular processes underlying cell biology and development of these organisms. The wealth of data and the power of molecular tools available for these species strongly contrast with the experimental amenability of most other organisms for molecular investigation, even where such organisms exhibit biological phenomena not covered by the standard models. It has therefore been argued that biologists need to start selecting and exploring new model systems [1], [2]. One step into this direction has been enabled by the development of cost-effective massive sequencing technology. This technology has facilitated the deciphering of an increasing number of genomes and transcriptomes of potential new model systems. More than 150 eukaryotic genomes and an even greater number of transcriptomes already provide a valuable resource for phylogenetic or comparative genomic analyses (see e.g. refs. [3], [4], [5], [6]). Besides their value for bioinformatics approaches, such sequence resources also provide gene sets for expression analyses, thereby allowing insight into the dynamics and/or spatial specificity of transcription during development. Systematic gene expression data have been generated for conventional model species (see e.g. refs. [7], [8]), and also serve as a basis for the comparison of gene expression patterns with and between emerging model species, thereby providing insight into the evolution of tissues and cell types (reviewed in ref. [9]). Despite these advances, the functional amenability of many emerging model systems is still limited. One limitation concerns the capacity of new model species to generate insight into gene or cell functions that may differ from those functions established in conventional model species. This is especially relevant where new model species are phyletically distant from well-studied models, and significantly differ in their genetic repertoire. Likewise, this limitation also applies where new models display distinct biological traits that can simply not be studied in traditional systems. In such cases, it is necessary to develop, along with genomic and transcriptomic resources, also tools that allow to use these resources for functional studies in the respective organism itself. DNA transposons are mobile genetic elements that can transport DNA inserts of varying length. Their mobilization typically relies on the presence of an enzyme (transposase) acting on a characteristic flanking DNA sequence containing transposon-specific inverted repeats. Transposon-based transgenesis forms the basis of various functional approaches, ranging from targeted expression of candidate genes or functional reporters to insertional mutagenesis (reviewed in ref. [10]). The establishment of transgenic technology has therefore strongly contributed to the transition of other species to molecular model systems, for instance the ascidian Ciona intestinalis [11], [12]. Moreover, whereas more widely used techniques like immunohistochemistry, whole-mount in situ hybridization or transcriptomic approaches only provide “snapshots” of development, transgenesis with fluorescent reporter constructs allows continuous observation of organelles and cells, and specific manipulation also at later stages of development. Lophotrochozoans constitute a large superphylum of protostome animals that are distinct from the ecdysozoans [13], [14]. Ecdysozoans include species like the nematode Caenorhabditis elegans or the fruitfly Drosophila melanogaster that are well-established functional model systems with a large panel of functional tools. Several lophotrochozoans have become prominent developmental model systems, including leeches and planarians, but given the large number of species in this superphylum, and the relevance of lophotrochozoan groups such as mollusks and annelids for marine biology, the amount of molecular data for lophotrochozoans is rather sparse, with the first genomes just becoming available [6], [15], [16]. Among the lophotrochozoans, Platynereis dumerilii has gained relevance as an annelid reference species for eye and brain development and evolution (see e.g. refs. [17], [18], [19]). Strains for Platynereis can be easily bred in the lab, and various molecular resources and techniques facilitate analyses of its cell types and tissues, and their comparison with other animal models [18], [20], [21], [22]. Whereas reports on transgenic lophotrochozoans were previously limited to planarians [23] and platyhelminths [24], we have recently obtained a first transgenic Platynereis strain, after microinjecting zygotes with a Tc1/mariner-type vector harboring an r-opsin::egfp reporter construct [25]. Despite this positive example, several fundamental aspects of transgenesis in Platynereis have so far not been addressed. This includes the question if the delivered constructs are excised from donor DNA and inserted into the host genome, or maintained by other mechanisms such as epichromosomal arrays. The mode of transmission is expected to impact on the stability of transgene expression throughout subsequent generations. Moreover, there is currently no estimate of the efficiency of Mos1-mediated transgenesis, and how this compares to the efficiency of other classes of transposons in Platynereis. Such estimates will be important for deciding on the best transgenesis strategy to explore for future and larger-scale experiments. Here, we present a detailed analysis of transposase-mediated transgenesis in Platynereis. We provide evidence that reporters are cleaved in a transposase-dependent fashion, and inserted in the host genome. To address if there are differences between the applicability of different transposon classes in Platynereis transgenesis, we compared the Mos1 system with Tol2, a member of the hAT family of transposons used in a wide variety of model systems. Whereas we find Tol2 to be around threefold more efficient for transient transgenesis than Mos1, Tol2-mediated insertions appeared to be silenced in the germ line. This is in contrast to Mos1, for which we were able to generate another stable transgenic strain. Assays for Mos1-mediated excision and a study of integration sites suggests that in the bristle worm, Mos1 transposition is impaired in its efficiency, and accompanied by non-homologous repair. Our data indicate that each of the two delivery systems has individual advantages for Platynereis transgenesis, and that transient transgenesis efficiencies are not necessarily a suitable proxy for efficiencies of stable germline transgenesis.

Results

Cleavage and Excision of Transposon-based Reporter Constructs Delivered by Microinjection

To maximize compatibility between the Mos1 and Tol2 systems, we used re-engineered target vectors of both transposon systems that carried the same restriction sites. We chose a head-to-head arrangement of two I-SceI target sites. As the I-SceI target site is 18 nucleotides long, it will theoretically occur every 7×1010 nucleotides, or once per 70 haploid Platynereis genomes, using the recent genome size estimate of 1 Gbp [26]. We therefore expect that the vectors we generated should be compatible with cloning of most or all desirable genomic fragments of Platynereis, as well as many other species, making these vectors a useful resource for the community. The I-SceI recognition sites can be easily inserted into flanking primers designed to amplify a given expression construct. Furthermore, if needed, reporters can also be released by co-injected I-SceI meganuclease. In Platynereis, meganuclease has so far only led to mosaic expression of a tested reporter (Kristin Tessmar-Raible, unpublished), but in fishes, amphibians, ascidians, or cnidarians, meganuclease-mediated transgenesis is an alternative to transposon-based approaches (see refs. [27] and [28] and references therein). As exemplified in this study, simple expression constructs can be generated by fusion PCR, a technique also used for the generation of nematode expression constructs [29]. For more complex regulatory regions, an alternative is the recombineering of larger genomic clones to insert a reporter cassette, followed by transfer of the recombineered locus into the target vector [25], [30]. For the determination of transgenesis efficiency, we decided to first generate a ubiquitous reporter construct. For this, we focused on Platynereis rps9, a gene encoding the ubiquitously expressed ribosomal protein Rps9. Using a thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) approach [11], [31], we isolated around 3 kB of DNA covering the 5′UTR and upstream sequence of the rps9 gene. A 1.6 kB fragment of this piece was fused to the enhanced green fluorescent protein (egfp) gene by fusion PCR. This rps9::egfp construct was inserted into both the Tol2 and Mos target vector, yielding the constructs pTol2{rps9::egfp}frkt868 ( ) and pMos{rps9::egfp}frkt1074 ( ), respectively.
Figure 1

Excision of a microinjected Tol2-based construct.

(A) Scheme of donor vector pTol2{rps9::egfp}frkt868; the rps::egfp cassette is flanked by inverted Tol2 repeats (Tol2IR) that serve as recognition site for Tol2 transposase co-injected as mRNA along with the vector DNA. (B, C) PCR using vector-specific primers (black arrows) yields a 200 bp PCR fragment specifically from embryos co-injected with tol2 transposase mRNA (left lane), but not from controls (right lane). (D) Precise cleavage of the reporter construct at the end of the Tol2 IRs is evidenced by sequencing of the 200 bp fragment.

Figure 2

Excision of a microinjected Mos-based construct.

(A) Scheme of donor vector pMos{rps9::egfp}frkt1074; in analogy to pTol2{rps9::egfp}frkt868 (Figure 1A), the rps::egfp cassette is flanked by inverted Mos repeats (MosIR) that serve as recognition site for Mos1 transposase. (B, C) PCR using vector-specific primers (black arrows) yields a variety PCR fragment from embryos co-injected with mos1 transposase mRNA (left lanes), but not controls (right lanes). (D) Sequencing of 21 individual PCR product reveals imprecise breakpoints caused by impaired excision of reporter constructs and/or subsequent modification of DNA ends in the context of non-homologous end repair. See and for details.

Excision of a microinjected Tol2-based construct.

(A) Scheme of donor vector pTol2{rps9::egfp}frkt868; the rps::egfp cassette is flanked by inverted Tol2 repeats (Tol2IR) that serve as recognition site for Tol2 transposase co-injected as mRNA along with the vector DNA. (B, C) PCR using vector-specific primers (black arrows) yields a 200 bp PCR fragment specifically from embryos co-injected with tol2 transposase mRNA (left lane), but not from controls (right lane). (D) Precise cleavage of the reporter construct at the end of the Tol2 IRs is evidenced by sequencing of the 200 bp fragment.

Excision of a microinjected Mos-based construct.

(A) Scheme of donor vector pMos{rps9::egfp}frkt1074; in analogy to pTol2{rps9::egfp}frkt868 (Figure 1A), the rps::egfp cassette is flanked by inverted Mos repeats (MosIR) that serve as recognition site for Mos1 transposase. (B, C) PCR using vector-specific primers (black arrows) yields a variety PCR fragment from embryos co-injected with mos1 transposase mRNA (left lanes), but not controls (right lanes). (D) Sequencing of 21 individual PCR product reveals imprecise breakpoints caused by impaired excision of reporter constructs and/or subsequent modification of DNA ends in the context of non-homologous end repair. See and for details. For delivering these constructs into animals, we microinjected freshly fertilized Platynereis zygotes. To monitor transposase activity in the living worms, we used a plasmid excision strategy that tests if the reporter construct flanked by transposon repeats is excised from the donor plasmid when co-injected with synthetic transposase mRNA [32]. We designed primers matching the flanking regions of the Tol2-based donor vector, outside of the inverted transposon repeats ( ). Upon release of the insert, these primers should amplify a distinct fragment of about 200 bp in an mRNA-dependent fashion. Indeed, only zygotes co-injected with tol2 mRNA gave rise to a PCR amplicon of the expected size ( ). Subcloning and sequencing of this amplicon confirmed that it is identical to the expected donor fragment, and precisely lacks the inverted transposon repeats ( ). These results establish that no significant endogenous Tol2 transposase activity is present in Platynereis zygotes, and that injected tol2 transposase mRNA yields sufficient enzyme activity to excise the reporter in vivo from the donor cassette during the first rounds of cell divisions. Similar to the case of Tol2, co-injection of mos1 transposase mRNA with Mos1 ITR-flanked rps9::egfp reporter, followed by PCR amplification with vector-specific primers, resulted in the recovery of shorter donor DNA amplicons ( ). However, in contrast to the case of Tol2, these assays yielded various fragment sizes, differing between injected individuals ( ). Consistent with this observation, sequencing of 21 amplicons resulting from Mos1 excision assays indicated various deletions along the vector and insert, both comprising and excluding the full ITR sequences ( , ). Moreover, in 7 of the 21 amplicons, we detected additional small insertions between the respective breakpoints, varying in length between 1 and 24 nucleotides. The observed products appear incompatible with a regular Mos1-mediated excision, but rather resemble our observations for products generated by non-homologous end joining repair (see discussion). Even though the observed amplicons appeared to be irregular, their occurrence was dependent on co-injection of mos1 mRNA ( ). This indicates that there is no endogenous transposase activity that can act on Mos1 ITRs in Platynereis, but hints at an impairment of efficient Mos1 excision and/or transposition in the worms.

Robust Tol2-mediated Transgenesis in G0

Next, we tested if Tol2 transposase also catalyzed stable genomic integration of the excised fragment. As a first indication, we compared fluorescence of animals 3 days after zygote injection. When we investigated EGFP fluorescence in larvae that received only the pTol2{rps9::egfp}frkt868 donor construct with larvae co-injected with tol2 mRNA, the co-injected larvae showed a stronger and less mosaic expression of EGFP, whereas plasmid-injected larvae only showed mosaic fluorescence, in addition to autofluorescence signal around the adult eyes ( ). Moreover, whereas individuals only injected with plasmid typically lost EGFP signal by three days of development, several co-injected zygotes gave rise to fully fluorescent adults ( ). These findings establish that co-injection of tol2 mRNA enhances the stable inheritance of constructs throughout cell divisions.
Figure 3

Tol2-mediated transgenesis with pTol2{rps9::egfp} yields robust, ubiquitous expression of EGFP in G0 animals.

(A, B) pTol2{rps9::egfp}frkt868-injected animals co-injected with tol2 mRNA (A) show significantly stronger EGFP fluorescence (green arrows) than those without transposase (B) (ae: autofluorescence around the adult eyes). (C, D) Stable ubiquitous EGFP expression (green arrows) two months after co-injection of donor DNA and tol2 mRNA (C) compared to a non-injected animal (D). Labels indicate autofluorescence of the jaws (j) as well as the iridophore pigments (p) in both the head and trunk.

Tol2-mediated transgenesis with pTol2{rps9::egfp} yields robust, ubiquitous expression of EGFP in G0 animals.

(A, B) pTol2{rps9::egfp}frkt868-injected animals co-injected with tol2 mRNA (A) show significantly stronger EGFP fluorescence (green arrows) than those without transposase (B) (ae: autofluorescence around the adult eyes). (C, D) Stable ubiquitous EGFP expression (green arrows) two months after co-injection of donor DNA and tol2 mRNA (C) compared to a non-injected animal (D). Labels indicate autofluorescence of the jaws (j) as well as the iridophore pigments (p) in both the head and trunk. In other species such as the nematode Caenorhabditis elegans or the mouse, exogenous DNA can be inherited in an extrachromosomal fashion [33], [34]. Therefore, we assessed next if injected individuals integrated copies of the reporter construct in their nuclear genomes. A radiolabeled egfp probe detected specific bands in a Southern hybridization with genomic DNA isolated from injected individuals ( ). Moreover, we could amplify by TAIL-PCR non-vector sequence flanking one of the Tol2 repeats from the same samples ( ). The non-vector sequence was precisely juxtaposed next to the Tol2 repeat where integration into the genome would be expected to occur. Together, these findings establish that Tol2 mediates excision and integration of reporter constructs into the Platynereis genome. The recovery of fully fluorescent adults shows that integration of reporter constructs can occur early enough during development to generate transgenic animals with little or no mosaicism in the injected (G0) generation.
Figure 4

Genomic integration and inheritance of Tol2-mediated constructs.

(A) Genomic Southern blot with an egfp probe reveals genomic integrations of pTol2{rps9::egfp}frkt868 in tested G0 individuals (arrows). (B) Precise genomic integration of a the reporter construct at the end of the IR as revealed by sequencing of an amplicon including neighboring genomic DNA, generated using Tol2IR-specific TAIL-PCR primers. (C) Integration and inheritance of egfp in individual G0 and G1 animals: PCR amplicons specific for egfp (arrowheads) can be detected in genomic DNA of both G0 (lanes 9–18) and G1 (lanes 1–8) individuals. Controls: no DNA (lane 19), wild-type gDNA (lane 20), gDNA extracted from a tuba::egfpvbci1 transgenic individual (lane 21), reporter construct plasmid DNA (lane 22).

Genomic integration and inheritance of Tol2-mediated constructs.

(A) Genomic Southern blot with an egfp probe reveals genomic integrations of pTol2{rps9::egfp}frkt868 in tested G0 individuals (arrows). (B) Precise genomic integration of a the reporter construct at the end of the IR as revealed by sequencing of an amplicon including neighboring genomic DNA, generated using Tol2IR-specific TAIL-PCR primers. (C) Integration and inheritance of egfp in individual G0 and G1 animals: PCR amplicons specific for egfp (arrowheads) can be detected in genomic DNA of both G0 (lanes 9–18) and G1 (lanes 1–8) individuals. Controls: no DNA (lane 19), wild-type gDNA (lane 20), gDNA extracted from a tuba::egfpvbci1 transgenic individual (lane 21), reporter construct plasmid DNA (lane 22).

Stable Expression after Germ-line Transmission of Mos1-, but not Tol2-mediated Insertions

Whereas Tol2-mediated transgenes showed robust expression in the injected generation of animals, we were unable to retrieve fluorescent offspring of Tol2-transposon-injected animals, even if they were pre-screened for fluorescence in larval stages (n = 168 tested parents). We hypothesize that this discrepancy between fluorescence in the two generations reflects a permanent silencing of the reporter, possibly by a mechanism residing in the germ line, which is known to be able to counteract transposons in other species [35], [36]. In line with this hypothesis, egfp coding sequence could still be amplified from 3 of 18 non-fluorescent batches derived from pre-screened parents ( ). Co-injection of mos1 RNA with pMos{rps9::egfp}frkt1074 only leads to a moderate frequency (5%) of green larvae when tested at 7 dpf, significantly lower than for Tol2 (18%, ). Similar to Tol2, we observe genomic integration of Mos1-based constructs (see below, ) Together with the excision assay, these findings indicate that Mos1 cleaves co-injected DNA constructs, and that these constructs can integrate into the Platynereis genome, even though excision and/or transposition mechanisms seem to occur with reduced efficiency, and expression rates are consistently lower than the ones observed for Tol2-mediated transgenesis. Notwithstanding this lower efficiency, however, Mos1-mediated transgenes are both heritable and functional in subsequent generations (ref. [25] and see below).
Table 1

Efficiency of Tol2 and Mos1 transposon-mediated transient transgenesis.

Tol2Mos1
injected1089496
survivors603339
fluorescence107 (18%)16 (5%)

Efficiency is based on the detection of broad Egfp expression 7 days after injection of either pTol2{rps9::egfp}frkt868 (left column) or pMos{rps9::egfp}frkt1074 (right column). Percentages are calculated as the fraction of Egfp-expressing animals of total survivors for each of the constructs.

Efficiency is based on the detection of broad Egfp expression 7 days after injection of either pTol2{rps9::egfp}frkt868 (left column) or pMos{rps9::egfp}frkt1074 (right column). Percentages are calculated as the fraction of Egfp-expressing animals of total survivors for each of the constructs.

Novel Reporters Targeting Distinct Platynereis Cell Types

Whereas cis-regulatory regions of ubiquitously expressed genes are useful to globally misexpress genes, an important application of transgenic reporters for evolutionary and developmental studies is also to label specific cell types. In addition to the ubiquitous rps9 gene (this study) and the specific r-opsin gene [25], [30], we therefore selected two genes expressed in distinct subpopulations of cells: a specific alpha-tubulin gene (tuba) characteristic for larval cells bearing motile cilia, and the gene maf that demarcates specific neurons in the larval brain that are distinct from the r-opsin-positive photoreceptors. To generate expression constructs for these genes, a 3.6 kB fragment upstream of the maf start codon was fused to the egfp coding sequence, and the resulting fragment cloned into the transposon target vectors. Likewise, 4.4 kB of the tuba locus upstream of the first coding exon were fused to the egfp coding sequence, and the resulting fragment cloned into the target vectors. For maf::egfp, we report here on the transient expression from the Tol2-based construct pTol2{maf::egfp}frkt1208 ( ). For tuba::egfp, we describe a stable strain that carries an integration of pMos{tuba::egfp}frkt707 ( ).
Figure 5

The maf locus drives EGFP in putative neurosecretory brain cells

. (A) Scheme of donor vector pTol2{maf::egfp}frkt1208 containing a 3.6 kB upstream of the maf start codon (compare to Figure 1A). (B) Expression of endogenous maf RNA (arrowhead) in the medial central brain of early metatrochophore larvae. (C) Synexpression of the insulin-like peptide 2/ilp2 mRNA in the same region (arrowhead), suggesting that maf demarcates neurosecretory cells. (D–F) EGFP expression driven by pTol2{maf::egfp}frkt1208 demarcates cells in the same region as endogenous maf.

Figure 6

EGFP expression at the trochophore stage reflects endogenous tuba expression in tuba::egfpvbci1 animals.

(A) Scheme of donor vector pMos{tuba::egfp}frkt707 containing 4.4 kB of DNA upstream of the alpha-tubulin (tuba) start codon (compare to Figure 2A). (B, C) Expression of endogenous tuba in the prototroch (pt; arrows), apical ciliary tuft (at) and paratrochs (pat; arrowheads) of Platynereis larvae at the trochophore (B) and metatrochophore (C) stages. (D, E) Expression of egfp RNA (D) and EGFP protein in tuba::egfpvbci1 trochophore larvae perfectly reflects endogenous tuba expression. (F) egfp expression in tuba::egfpvbci1 metatrochophore larvae remains restricted to the prototroch (arrow); (G) Stable inheritance of the construct, as evidenced by Southern blots of carriers from three different generations, probed with a labeled egfp fragment.

The maf locus drives EGFP in putative neurosecretory brain cells

. (A) Scheme of donor vector pTol2{maf::egfp}frkt1208 containing a 3.6 kB upstream of the maf start codon (compare to Figure 1A). (B) Expression of endogenous maf RNA (arrowhead) in the medial central brain of early metatrochophore larvae. (C) Synexpression of the insulin-like peptide 2/ilp2 mRNA in the same region (arrowhead), suggesting that maf demarcates neurosecretory cells. (D–F) EGFP expression driven by pTol2{maf::egfp}frkt1208 demarcates cells in the same region as endogenous maf.

EGFP expression at the trochophore stage reflects endogenous tuba expression in tuba::egfpvbci1 animals.

(A) Scheme of donor vector pMos{tuba::egfp}frkt707 containing 4.4 kB of DNA upstream of the alpha-tubulin (tuba) start codon (compare to Figure 2A). (B, C) Expression of endogenous tuba in the prototroch (pt; arrows), apical ciliary tuft (at) and paratrochs (pat; arrowheads) of Platynereis larvae at the trochophore (B) and metatrochophore (C) stages. (D, E) Expression of egfp RNA (D) and EGFP protein in tuba::egfpvbci1 trochophore larvae perfectly reflects endogenous tuba expression. (F) egfp expression in tuba::egfpvbci1 metatrochophore larvae remains restricted to the prototroch (arrow); (G) Stable inheritance of the construct, as evidenced by Southern blots of carriers from three different generations, probed with a labeled egfp fragment. Platynereis maf encodes a transcription factor orthologous to Drosophila Traffic-jam and vertebrate c-Maf, Maf-A and Maf-B. When tested at 52 hpf, we detect 1–3 maf-expressing cells in a cluster in the medial larval brain, located below the apical tuft ( ). By position, these maf-positive cells likely co-express ilp2, a Platynereis insulin-like peptide precursor ( ). This constellation is reminiscent of the role of vertebrate large Maf members in the regulation of insulin in pancreatic beta cells [37], and suggests that the maf-positive Platynereis brain cells are neurosecretory. Consistent with the endogenous expression of maf, embryos co-injected with pTol2{maf::egfp}frk1208 plasmid and tol2 mRNA displayed EGFP in cells of the central larval brain. Detailed analyses of EGFP fluorescence by confocal microscopy (performed at around 55 hpf) in three independent specimens consistently revealed a cluster of cells in the central medial brain that by position correlates to the medial cells observed in the maf in situ hybridization ( ). These analyses also reveal projections of the EGFP-labeled cells. The observation of these projections is consistent with the notion that the reporter demarcates neurosecretory cells. Together with our observations for the r-opsin::egfp strain [25], these data attest to the ability of cell-specific reporters to highlight cellular processes in Platynereis. For the analysis of tuba::egfp, we raised zygotes co-injected with pMos{tuba::egfp}frkt707 and mos1 RNA to adults, and investigated offspring of these animals for fluorescent expression. 2 of 23 analyzed adults yielded fluorescent batches. One of these could be propagated further. Together with the respective figures for the r-opsin::egfp strain, this leads to an average rate of fluorescent offspring of 5% ( ), compatible with the rate of Mos1-mediated transgenesis observed in our transient expression assays ( ). We refer to the analyzed tuba::egfp strain as tuba::egfpvbci1.
Table 2

Survival and transmission rates for the injection of Mos1-based fluorescent reporter constructs.

reporter constructinjectedmature G0 transgenic G1
tuba::egfp409232
r-opsin::egfp363391
total77262 (8% of injected)3 (5% of mature)

Data are shown for both pMos{tuba::egfp}frkt707 and pMos{r-opsin::egfp}frkt890 injections. Injected zygotes (left column) were raised to mature animals (G0; middle column), and EGFP expression in the offspring (G1; right column) was monitored. Survival rate and transgenic founder rate are given as percentage of injected animals and mature animals, respectively.

Data are shown for both pMos{tuba::egfp}frkt707 and pMos{r-opsin::egfp}frkt890 injections. Injected zygotes (left column) were raised to mature animals (G0; middle column), and EGFP expression in the offspring (G1; right column) was monitored. Survival rate and transgenic founder rate are given as percentage of injected animals and mature animals, respectively. In trochophore larvae, endogenous tuba is prominently expressed in the prototroch cells, and also shows a specific expression in the cells of the apical ciliary tuft ( ). Subsequently, tuba is also expressed in the emerging posterior ciliary bands, referred to as paratrochs ( ). In tuba::egfpvbci1 trochophore larvae, egfp mRNA expression as well as protein fluorescence precisely matches the tuba expression in prototroch and apical ciliary tuft ( ). EGFP protein also labels the ciliary extensions of the prototroch, underlining the suitability of transgenic strains for the analysis of subcellular structures. In contrast to endogenous tuba mRNA, egfp mRNA is not observed in the paratroch cells, and expression in the prototroch is diminished over the course of metatrochophore development ( ). As the expression of maf::egfp as well as r-opsin::egfp [25] attest to, fluorescence is not generally restricted to early stages of Platynereis development. We therefore hypothesize that the tuba::egfp reporter only contains a subset of the regulatory elements required to maintain the full expression pattern, or that it is integrated in the vicinity of a repressor element impeding the enhancer’s late larval expression. Finally, to investigate the stability of the integrated construct, we outbred G1 animals for additional two generations, selecting for carriers based on their EGFP expression at 24 hpf. Trochophores in the G3 generation still showed expression in the same pattern. Likewise, Southern analysis on digested genomic DNA from G1, G2, and G3 carriers of the tuba::egfpvbci1 strain revealed a single egfp-positive bands of the unchanged size in each specimen ( ). Together, this argues that construct DNA is inserted in a single locus, inherited in a stable fashion, and does not re-mobilize on its own from the integration locus. To investigate the nature of the integration further, we used TAIL-PCR with construct-specific primers to isolate neighboring DNA. Consistent with the Southern analysis, we were able to isolate at least one stretch of genomic DNA from the tuba::egfpvbci1 strain ( and ), and confirmed the presence of this genomic DNA next to the reporter by specific PCR. The junction between reporter and genome, however, was offset by 40 bp from the proper 3′ITR (), consistent with the notion that the inserted fragment was target of exonuclease activity, similarly to the conclusions for the excision assay. It therefore also seems unlikely that this arm of the construct was inserted by a canonical transposition mechanism, even though the detected genomic sequence is compatible with the characteristic TA signature found in Mos1 insertions (). In further support of a non-canonical insertion mechanism, we find evidence for multiple insertions in both tested strains: From the same tuba::egfpvbci1 individuals that yielded the reporter-to-genome junction, additional amplicons can be recovered that contain the 3′ITR and flanking vector sequence instead of genomic DNA, thus revealing the presence of at least one additional copy of the 3′ arm of the construct. Given the results of the Southern analysis, the most plausible explanation is that there are at least two reporter fragments that are integrated in close proximity to each other. Similarly, one of the fragments recovered from the 3′ arm of the rops::egfpvbci2 strain reveals a juxtaposition of 3′ vector sequence with dsRed coding sequence. As dsRed is included as an internal marker gene in the 5′ end of the reporter, these data support the notion that two reporter fragments are juxtaposed in the genome (). Together, our data reveal an unexpected impairment of the Tc1/mariner type Mos1 transposon system, both on the level of excision and integration. The reason of this impairment is still unclear. Despite its low efficiency, however, Mos1-mediated transgenesis appears to be a suitable tool for generating stable transgenic strains in Platynereis, whereas Tol2 represents the most efficient tool for transient transgenic applications.

Discussion

Over the past years, Platynereis has become an important reference species for evolution and development. Our study extends the functional toolkit available for Platynereis, by establishing a second transposon system, Tol2, that yields more than threefold higher rates of transgenesis than the Mos1 system used to generate the first transgenic Platynereis strain [25]. Moreover, we demonstrate that Tol2-mediated transgenesis yields precise excision products and integrates in a canonical fashion, whereas co-injection of mos1 mRNA with pMos donor constructs generates a panel of excision products that appear inconsistent with a standard cut-and-paste mechanism. The reasons for this discrepancy are currently unclear. One contributing factor could be the difference in the excision mechanisms of Tol2 and Mos1: hAT transposases like Tol2 generate donor products whose 5′ and 3′ ends are chemically linked as hairpins, whereas Mos1 generates double-strand breaks with open 5′ and 3′ ends [38]. Possibly, the chemical protection of the hairpin intermediates results in more faithful repair than the open double strand breaks produced by Mos1. Consistent with this notion, Mos1-triggered non-homologous end-joining can lead to insertions and deletions in Caenorhabditis elegans [39]; likewise, our recent work indicates that in Platynereis genomic DNA, open double-strand breaks generated by engineered TALE nucleases can lead to insertions and deletions, presumably also by non-homologous end-joining repair [40]. Such repair-induced artifacts might explain the observed insertions, and part of the observed deletions, in the donor amplicons recovered from injected animals. However, non-homologous end joining repair alone cannot explain the recovery of donor amplicons in which parts of the Mos1 ITRs are still included. We speculate that these events may rather reflect some abandoned transposon intermediates, possibly after nicking at individual ITRs without complete paired-end complex formation. The occurrence of such intermediates has been proposed to occur in Mos1 transposition [41], even though the order of cleavage and complex formation remains debated (see e.g. ref. [42]). Adding to this, it is known that Mos1 as well as other Tc1 transposons are sensitive to large cargo sizes (see ref. [43] and references therein). The current design of the pMos donor [25] still contains around 1.5 kbp of sequence relevant for expression of a dsRed marker [44] that is not used in the Platynereis system. The resulting larger insert sizes may therefore favor such abandoned reactions over paired end complex formation and canonical excision. Because the ubiquitous Tol2 construct we studied failed to express after germline transmission, we currently regard the two transposon systems as complementary approaches for Platynereis transgenesis, with Mos1 being the preferred system for stable transgenesis. Given the evidence that Mos1 only possesses low efficiency in Platynereis, decrease of cargo sizes, and additional changes that are known to enhance Mos1 efficiency, such as optimization of the inverted terminal repeats [45], could be useful to implement. Concerning the apparent silencing of the Tol2 construct, we have not yet addressed if its severity depends on specific properties of the pTol2{rps9::egfp} vector, such as its strong and ubiquitous expression, or on the proximity of the Tol2 inverted terminal repeats, and would therefore be relieved when using larger inserts. Of note, Tol2 is less sensitive to cargo sizes than Tc1 elements [43]. Future re-engineering might therefore be able to combine the advantages of both systems. Our results have three additional implications. First, transient transgenic technology as pioneered in this study is a critical step towards the systematic assessment of the cis-regulatory activity of DNA fragments. Cis-regulatory assays are key for dissecting gene-regulatory networks [46], and are well established in other models in which experimental gene regulatory analyses are routinely being performed (see e.g. refs. [47], [48] and references therein). As an annelid representative, Platynereis is phyletically well positioned to allow cross-comparisons with other animals. Moreover, previous results argue that Platynereis has conserved ancient-type genome features and cell types, leading to the hypothesis that regulatory analyses in this species might be particularly useful to reconstruct the evolution of gene-regulatory networks [9]. Our data indicate that Tol2-mediated transgenesis is more effective than Mos1-mediated transgenesis for transient expression studies. However, the transient transgenesis efficiency of around 18% that we observe is still below the ones reported for established systems in which transient gene-regulatory analyses are performed, such as zebrafish (30–50%; [49]), medaka (47%; [50]) or Ciona (20–36%; [51]). Therefore, additional optimization of the current protocol will be useful to improve the throughput that can be achieved by the method. For instance, if the availability of functional transposase protein in the early cleavage stages is limiting transgenesis efficiency, it could be advantageous to generate a stable transgenic strain expressing tol2 in the Platynereis oocyte to enhance the frequency of integration events. Such a strain might also be useful for remobilization of Tol2-inserted elements, as a potential strategy for enhancer detection [52]. Moreover, preliminary experiments have shown that phiC31 integrase can efficiently mobilize reporter constructs from co-injected DNA, but a suitable strain with a landing site to probe insertion frequencies has not yet been established (Backfisch and Raible, unpublished). Second, whereas molecular research into larval Platynereis development is well advanced and allows gene expression studies with cellular resolution [18], [53], both transient and stable transgenic animals provide unprecedented access also to postlarval stages. Both of the novel cell-specific reporters presented in our study (tuba::egfp and maf::egfp) followed a simple design that could be achieved by fusion PCR. The versatility of the engineered vectors, as well as the growing genome resources for Platynereis [26] provide a good basis for the generation of additional constructs targeting different cell types. For more complex loci, a high-coverage genomic BAC library [20] is available that can be used for the generation of reporters by a recombineering approach [25]. Combined with molecular fingerprinting [9] or specific ablation [30], [54] of labeled cells, stable transgenic strains will enable future research into the characterization of specific cell types, and will help to test their requirement for physiology or development. Finally, the results presented here do not only improve research in Platynereis itself, but also have potential impact on research in other animals. On the one hand, due to the scarcity of molecularly accessible species among annelids and other lophotrophozoans, Platynereis may serve as a reference organism in which genes of related species could be expressed and analysed, similar to the role that a conventional molecular model like Drosophila melanogaster takes on for the larger group of dipterans. On the other hand, we anticipate that the protocols developed here will also guide other researchers to pioneer transgenesis in their respective models. In particular, the contrast in transposon system efficiency for transient vs. stable transgenesis that we report may serve as an important caveat for researchers interested in pioneering transgenesis in other emerging model species. Our data suggest that the most efficient systems for transient transgenesis do not necessarily yield the best results for stable transmission of functional reporter constructs, and that therefore various systems should be considered.

Materials and Methods

Animal Culture

Animals were raised and bred in the MFPL marine facility according to established procedures [55]. Animal research and transgenic work followed applicable legislation, as also approved by the Max F. Perutz Laboratories committee for biological safety (session from Feb 19, 2009).

Generation of Reporter Constructs

In analogy to the pMos-based vector pMosScefrkt318 [25], the vector pTol2Scefrkt761 was generated by introducing two SceI sites in head-to-head orientation next to the XhoI and KpnI cloning sites of pDestTol2pA [56]. To generate the rps9::egfp reporter constructs pMos{rps9::egfp}frkt1074 and pTol2{rps9::egfp}frkt868, the sequence upstream of the Platynereis rps9 coding sequence was determined by sequencing fragments generated by rps9-specific TAIL-PCR (see below) on genomic DNA. A 1.6 kbp fragment upstream of the start codon of rps9 was amplified using primers rF and rL (for all primer sequences see ). The resulting amplicon was linked by fusion PCR to the egfp coding sequence derived from pEGFP-N1 (Clontech) using primers gF and gL, and subcloned into the SceI sites of the pMosScefrkt318 and pTol2Scefrkt761 destination vectors. To generate the tuba::egfp reporter construct pMos{tuba::egfp}frkt707, a 4.4 kb fragment of the Platynereis tuba gene upstream of the putative start codon was PCR-amplified from purified BAC-DNA (CH305_105D17) [20] using primers tF and tL. Fusion to egfp and further subcloning followed the same procedure as outlined for rps9::egfp. To generate the maf::egfp reporter construct pTol2{maf::egfp}frkt1208, a 3.6 kB fragment upstream of the maf start codon was amplified by PCR using primers mF and mL, linked by fusion PCR to egfp coding sequence amplified using gF2 and gL, and subcloned into pTol2Scefrkt761 as outlined above.

Microinjection of Zygotes

Freshly fertilized eggs were incubated for 45 minutes at 18°C. Zygotes were prepared for microinjection by washing off the jelly coat with sea water followed by Proteinase K treatment (Merck, 50 μg/ml final concentration) for 25 seconds to soften the egg envelope. After extensive washing with sea water, zygotes were transferred to an injection stage made of 1.5% agarose submerged in sea water. Microinjections were performed using a Leica LC2 microscope, a Transferman NK2 micromanipulator, a Femtojet express microinjector, and Femtotips II microcapillaries (all from Eppendorf). A detailed account of the microinjection protocol and the used stage will appear elsewhere (Tosches et al., in preparation). Zygotes were injected with a solution containing 0.2 μg/μl of endotoxin-free DNA, 0.2 μg/μl synthetic transposase mRNA, and 0.6% (w/v) TRITC-Dextrane (MW 70 k, Invitrogen). Injected zygotes were transferred into fresh sea water and incubated at 18°C for the indicated periods.

Stainings and Microscopy

Whole-mount in-situ hybridizations of Platynereis larvae were performed after established protocols (ref. [21] and references therein). For improved staining, 10% (w/v) polyvinylalcohol was used in NBT-BCIP staining buffers. For imaging of live animals, Platynereis juvenile or adult worms were paralyzed by adding dropwise 1 M MgCl2 into sea water until no movement of the animals occurred. A Zeiss Axioplan2 microscope with a 40x oil immersion objective and a Zeiss Axiocam MR5 camera was used for documentation of stainings from whole-mount in-situ-hybridisations. For live imaging, low magnification fluorescence images were taken with a Zeiss Lumar.V12 stereomicroscope with FITC fluorescence filter. Confocal images were taken using a Zeiss LSM 510 confocal microscope with a 488 nm excitation wavelength of an Argon laser. Images were processed using the ImageJ software package (http://imagej.nih.gov/ij/), to generate z-projections of scans.

Transposase-activity Assay and TAIL-PCR

Primers T2f and T2r () were designed to bind the pTol2Scefrkt761 backbone at 138/96 nt distance to the Tol2 inverted repeats. Primers M1f and M1r and nested primers M1nf and M1nr were designed to bind the pMosScefrkt318 backbone at 542/223 nt and 245/96 nt distance to the Mos1 repeats, respectively. Experimental zygotes were injected as described, controls received only DNA and TRITC-Dextrane. Four hours after injection, three embryos per sample were collected in 1 μl of sea water and transferred into PCR mix containing 1xCl buffer (Qiagen), 0.4 nM/μl dNTP-mix, 1.25 U Hot star Taq DNA Polymerase (Qiagen), 0.25 pM/μl of each of the two primers corresponding to the injected vector. PCR for excision assays was performed under following conditions: 95°C - 5 min, 35× (95°C - 30 s, 60°C - 30 s, 72°C - 1 min), 72°C - 10 min. Amplicons were separated by gel electrophoresis, cut out, subcloned and sequenced. Thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) was performed as described [11], [31]. The sequences of the specific primers are given in , with the following identities: RT1–RT3: primers for rps9; TL1-3, TR1-3: primers located close to the left and right terminal repeats of the Tol2 vector, respectively; ML1-3, MR1-3: primers located close to the left (3′ITR) and right (5′ITR) terminal repeats of the Mos1 construct, respectively. VL1-3: primers located in the donor vector outside the Mos1 3′ITR. Recovery of the genomic DNA displayed in / was independently validated by specific PCR with primers gDf and ML1.

Southern Hybridization

Genomic DNA from samples was extracted using the Nucleospin tissue kit (Macherey-Nagel). 8 μg of genomic DNA per sample were digested at 37°C for 16 h using HindIII, analyzed on 0.8% agarose/1xTAE gel and subsequently blotted on nylon membrane (Peqlab). An egfp fragment was excised from pEGFP-N1 (Clontech) and radiolabeled with alpha-32P dCTP using the Radprime DNA labeling System (Invitrogen) for use as a probe in Southern blot hybridization. Blots were hybridized in Rapid Hyb buffer (GE Healthcare) at 65°C overnight. Membranes were washed once in 2xSSC/0.1%SDS for 20 min and twice in 0.2xSSC/0.1%SDS for 20 min before exposure on Phosphoimager screens. Evidence for reporter fragmentation and genomic integration in GFP-expressing strains. Schematized alignments representing TAIL-PCR amplicons recovered from tuba::egfpvbci1 (A) and rops::egfpvbci2 (B) in comparison with the respective donor plasmids pMos{tuba::egfp} and pMos{rops::egfp}. Consistent with representation in and , red arrows demarcate position of 5′ and 3′ITRs; blue arrows show position of TAIL PCR primers; (i) and (ii) demarcate two alternative 3′ regions recovered from tuba::egfpvbci1 worms, indicative of multiple local integrations or partial duplications; yellow boxes indicate regions juxtaposed to the amplified vector sequence: genomic DNA (A) or dsred coding sequence (B) that is normally located in the 5′ region of the reporter sequence. (TIF) Click here for additional data file. Sequences of primers used in this study. The table shows the sequences for all primers used in this study, along with the primer names. (DOCX) Click here for additional data file. Donor sequences recovered from -injected worms (3′ arm). Multiple sequence alignment showing sequences of fragments recovered from the excision assay in comparison to the pMos{rps9::egfp}frkt1074 donor reference sequence (bottom). Mos1 3′ Inverted Terminal Repeats (3′ITR) are indicated with red arrows; see for overview. The alignment does not show the following insertions that lie between the displayed regions of the amplicons and the regions in and cannot be aligned to the reference sequence: 13_14-1_M13: GTCCCTT (7 bp); 7_12.2-2_M13: TGGA (4 bp); 11_12.2-1_M13: AACCCGGAATGACCATGCGCATCC (24 bp); 8_20.1-1_M13: AA (2 bp); 9_6.5-4_M13: A (1 bp); 5_6.5-3_M13: GGCTCC (6 bp); 10_7.2-2_M13: TAATTAGACAAAGTGAAG (18 bp). (PDF) Click here for additional data file. Donor sequences recovered from -injected worms (5′ arm). Multiple sequence alignment showing sequences of fragments recovered from the excision assay in comparison to the pMos{rps9::egfp}frkt1074 donor reference sequence (bottom). Mos1 5′ Inverted Terminal Repeats (5′ITR) are indicated with red arrows. See for overview. (PDF) Click here for additional data file. TAIL-PCR amplicon recovered from stable tuba::egfp Multiple sequence alignment showing the sequence of a fragment recovered by TAIL-PCR from the stable tuba::egfpvbci1 strain. The Mos1 5′ITR is indicated by a red arrow; blue arrows demarcate position of TAIL-PCR primers. (PDF) Click here for additional data file. TAIL-PCR amplicons recovered from stable tuba::egfp Multiple sequence alignment showing the sequences of three fragment recovered by TAIL-PCR from the stable tuba::egfpvbci1 strain. The Mos1 3′ITR is indicated by a red arrow; blue arrows demarcate position of TAIL-PCR primers as well as the gDf primer used to independently confirm the recovered integration; yellow box indicates Platynereis genomic DNA at transition between reporter and genomic DNA. (PDF) Click here for additional data file. TAIL-PCR amplicons recovered from stable rops::egfp Multiple sequence alignment showing the sequences of five fragments recovered by TAIL-PCR from the stable rops::egfpvbci2 strain. The Mos1 3′ITR is indicated by a red arrow; blue arrows demarcate position of TAIL-PCR primers (two sets were used); yellow box indicates dsred cDNA that it present at a different region of the donor plasmid, indicative of fragmentation of the donor prior to integration. (PDF) Click here for additional data file.
  53 in total

1.  Transposition of hAT elements links transposable elements and V(D)J recombination.

Authors:  Liqin Zhou; Rupak Mitra; Peter W Atkinson; Alison Burgess Hickman; Fred Dyda; Nancy L Craig
Journal:  Nature       Date:  2004-12-23       Impact factor: 49.962

2.  High-resolution in situ hybridization to whole-mount zebrafish embryos.

Authors:  Christine Thisse; Bernard Thisse
Journal:  Nat Protoc       Date:  2008       Impact factor: 13.491

Review 3.  The evolution of cell types in animals: emerging principles from molecular studies.

Authors:  Detlev Arendt
Journal:  Nat Rev Genet       Date:  2008-11       Impact factor: 53.242

4.  Functional cis-regulatory genomics for systems biology.

Authors:  Jongmin Nam; Ping Dong; Ryan Tarpine; Sorin Istrail; Eric H Davidson
Journal:  Proc Natl Acad Sci U S A       Date:  2010-02-08       Impact factor: 11.205

5.  Conserved sensory-neurosecretory cell types in annelid and fish forebrain: insights into hypothalamus evolution.

Authors:  Kristin Tessmar-Raible; Florian Raible; Foteini Christodoulou; Keren Guy; Martina Rembold; Harald Hausen; Detlev Arendt
Journal:  Cell       Date:  2007-06-29       Impact factor: 41.582

Review 6.  Small silencing RNAs: an expanding universe.

Authors:  Megha Ghildiyal; Phillip D Zamore
Journal:  Nat Rev Genet       Date:  2009-02       Impact factor: 53.242

7.  Stable transgenesis in the marine annelid Platynereis dumerilii sheds new light on photoreceptor evolution.

Authors:  Benjamin Backfisch; Vinoth Babu Veedin Rajan; Ruth M Fischer; Claudia Lohs; Enrique Arboleda; Kristin Tessmar-Raible; Florian Raible
Journal:  Proc Natl Acad Sci U S A       Date:  2013-01-02       Impact factor: 11.205

8.  Regulation of mariner transposition: the peculiar case of Mos1.

Authors:  Jérôme Jaillet; Murielle Genty; Jeanne Cambefort; Jacques-Deric Rouault; Corinne Augé-Gouillou
Journal:  PLoS One       Date:  2012-08-14       Impact factor: 3.240

Review 9.  Technology transfer from worms and flies to vertebrates: transposition-based genome manipulations and their future perspectives.

Authors:  Lajos Mátés; Zsuzsanna Izsvák; Zoltán Ivics
Journal:  Genome Biol       Date:  2007       Impact factor: 13.583

10.  TALENs mediate efficient and heritable mutation of endogenous genes in the marine annelid Platynereis dumerilii.

Authors:  Stephanie Bannister; Olga Antonova; Alessandra Polo; Claudia Lohs; Natalia Hallay; Agne Valinciute; Florian Raible; Kristin Tessmar-Raible
Journal:  Genetics       Date:  2014-03-20       Impact factor: 4.562

View more
  6 in total

1.  Cell lineage and cell cycling analyses of the 4d micromere using live imaging in the marine annelid Platynereis dumerilii.

Authors:  B Duygu Özpolat; Mette Handberg-Thorsager; Michel Vervoort; Guillaume Balavoine
Journal:  Elife       Date:  2017-12-12       Impact factor: 8.140

2.  Vasa, PL10, and Piwi gene expression during caudal regeneration of the polychaete annelid Alitta virens.

Authors:  Vitaly V Kozin; Roman P Kostyuchenko
Journal:  Dev Genes Evol       Date:  2015-03-15       Impact factor: 0.900

3.  A Go-type opsin mediates the shadow reflex in the annelid Platynereis dumerilii.

Authors:  Thomas Ayers; Hisao Tsukamoto; Martin Gühmann; Vinoth Babu Veedin Rajan; Kristin Tessmar-Raible
Journal:  BMC Biol       Date:  2018-04-18       Impact factor: 7.431

4.  PdumBase: a transcriptome database and research tool for Platynereis dumerilii and early development of other metazoans.

Authors:  Hsien-Chao Chou; Natalia Acevedo-Luna; Julie A Kuhlman; Stephan Q Schneider
Journal:  BMC Genomics       Date:  2018-08-16       Impact factor: 3.969

5.  SANA: cross-species prediction of Gene Ontology GO annotations via topological network alignment.

Authors:  Siyue Wang; Giles R S Atkinson; Wayne B Hayes
Journal:  NPJ Syst Biol Appl       Date:  2022-07-20

Review 6.  Genetic and genomic tools for the marine annelid Platynereis dumerilii.

Authors:  Juliane Zantke; Stephanie Bannister; Vinoth Babu Veedin Rajan; Florian Raible; Kristin Tessmar-Raible
Journal:  Genetics       Date:  2014-05       Impact factor: 4.562

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.