| Literature DB >> 24662091 |
Wei Wang1, Zhuo Li2, Yong Li3.
Abstract
Cotinus coggygria Scop. (Anacardiaceae) is a deciduous shrub or small tree that is native to a large area covering from southern Europe, east across central Asia, and the Himalayas in northern China. Shotgun 454 pyrosequencing was used to develop microsatellite markers from the genome of C. coggygria. In this study, 349 microsatellite loci were identified from 40,074 individual sequence reads produced by one-sixteenth run, and primer pairs were designed for these loci. To test the primer amplification efficiency, 50 microsatellite primer pairs were tested across 12 individuals from two C. coggygria populations (Wuzhi Mountain: 36°30'N, 113°39'E; Tianlong Mountain: 37°42'N, 112°26'E). Among the 50 tested primer pairs, eight were found to be polymorphic. The average allele number of the microsatellites was 3.5 per locus, with a range from two to five. The inbreeding coefficient ranged from -0.478 to 0.222. The observed and expected heterozygosities varied from 0.167 to 0.750 and from 0.163 to 0.743, respectively. This set of markers is potentially useful for assessing the genetic diversity, as well as for understanding the population structure and phylogeographical and landscape genetic patterns, of C. coggygria.Entities:
Mesh:
Substances:
Year: 2014 PMID: 24662091 PMCID: PMC6271902 DOI: 10.3390/molecules19033813
Source DB: PubMed Journal: Molecules ISSN: 1420-3049 Impact factor: 4.411
Primer sequences and characterization for eight microsatellite loci isolated from Cotinus coggygria.
| Primer | Primer sequence (5’-3’) | Repeat motif | Allele Size (bp) |
|
|
|
| GenBank Accession No. | |
|---|---|---|---|---|---|---|---|---|---|
| Cc004 | F:CCCCATTAGCTCACTCTCCAR:CGTTCCTATGGGTTCCTCAA | (CTC)7 | 52 | 350–381 | 3 | 0.301 | 0.333 | −0.114 | KJ398949 |
| Cc012 | F:AGCAGTGAAGAGCCAACTCCR:AGCTTGCAAAGAATGGGGTA | (TA)7 | 56 | 347–363 | 3 | 0.420 | 0.500 | −0.200 | KJ398957 |
| Cc024 | F:GCCCCACCAAGCAATAAAATR:TTCATGGCTCCTCCTTCTTC | (AT)6 | 56 | 399–409 | 4 | 0.685 | 0.667 | 0.028 | KJ398969 |
| Cc025 | F:CCAAACACCTTTGGGTCTGTR:GGGGAAATGAAACAAGGGTT | (TCT)6 | 54 | 123–147 | 5 | 0.651 | 0.667 | −0.026 | KJ398970 |
| Cc026 | F:TGCGCAAACTAATCCAAACAR:TTTCCGCAATAACACACCAA | (ATTT)5 | 52 | 246–266 | 2 | 0.290 | 0.333 | −0.158 | KJ398971 |
| Cc032 | F:GGATCAATTTGACCATCATATTCCR:CGGGATTGAGATTGGATTGT | (AT)6 | 50 | 333–353 | 3 | 0.518 | 0.750 | −0.478 | KJ398977 |
| Cc040 | F:ACCCTAACCCAAACCCAAACR:ATCGGAAACAACCTCCCTTT | (GAG)6 | 58 | 210–216 | 3 | 0.163 | 0.167 | −0.023 | KJ398985 |
| Cc047 | F:AATATCATCCTCCAGCGACGR:TGTTCAGATTCACGGCTGAG | (TTC)9 | 52 | 224–242 | 5 | 0.743 | 0.583 | 0.222 | KJ398992 |
Ta PCR annealing temperature; A number of alleles; HE expected heterozygosity; HO observed heterozygosity; FIS inbreeding coefficient.
Genetic diversity parameters for two populations of Cotinus coggygria.
| Primer | Wuzhi Mountain (
| Tianlong Mountain (
| ||||||
|---|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
|
|
| |
| Cc004 | 2 | 0.303 | 0.333 | −0.111 | 3 | 0.318 | 0.333 | −0.053 |
| Cc012 | 3 | 0.439 | 0.500 | −0.154 | 3 | 0.439 | 0.500 | −0.154 |
| Cc024 | 4 | 0.803 | 0.500 | 0.400 | 2 | 0.530 | 0.833 | −0.667 |
| Cc025 | 3 | 0.537 | 0.333 | 0.407 | 5 | 0.788 | 1.000 | −0.304 |
| Cc026 | 2 | 0.409 | 0.500 | −0.250 | 2 | 0.167 | 0.167 | _ |
| Cc032 | 2 | 0.530 | 0.833 | −0.667 | 3 | 0.530 | 0.667 | −0.290 |
| Cc040 | 3 | 0.318 | 0.333 | −0.053 | 1 | 0 | 0 | _ |
| Cc047 | 2 | 0.409 | 0.500 | −0.250 | 4 | 0.742 | 0.667 | 0.111 |
N Number of individuals tested; A number of alleles; HE expected heterozygosity; HO observed heterozygosity; FIS inbreeding coefficient.