Literature DB >> 23434866

Development and molecular characterization of 55 novel polymorphic cDNA-SSR markers in faba bean (Vicia faba L.) using 454 pyrosequencing.

Sundan Suresh1, Jong-Hyun Park, Gyu-Taek Cho, Ho-Sun Lee, Hyung-Jin Baek, Sok-Young Lee, Jong-Wook Chung.   

Abstract

Faba bean (Vicia faba L.) is a major food source and fodder legume, popularly known for its high content of seed-protein. Its role is critical in crop rotation, and for fixing nitrogen effectively. Polymorphic simple sequence repeat markers from transcript sequences (cDNA; simple sequence repeat [SSR]) were developed for faba bean (Vicia faba). We found that 1,729 SSR loci from 81,333 individual sequence reads and 240 primer pairs were designed and synthesized. In total, 55 primer pairs were found to be polymorphic and scorable consistently when screened in 32 accessions. The number of alleles ranged from 2 to 15, frequency of major alleles per locus varied from 0.17 to 0.91, the genotypes number ranged from 2 to 17, observed and expected heterozycosity values ranged from 0.00 to 0.44 and 0.17 to 0.89 and overall PIC values ranged from 0.16 to 0.88 respectively. These markers will be a useful tool for assessing the genetic diversity, understanding the population structure, and breeding patterns of faba bean.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23434866      PMCID: PMC6270484          DOI: 10.3390/molecules18021844

Source DB:  PubMed          Journal:  Molecules        ISSN: 1420-3049            Impact factor:   4.411


1. Introduction

Faba bean (Vicia faba L.) is currently the third most important winter season food legume globally. Faba bean represent an important source for dietary protein to human beings, edible oil and animal feed. Its critical role in crop rotation, effective nitrogen fixation, soil improvement abilities, and contribution to reducing energy input costs have long been recognized. Faba bean is a diploid with 2n = 2x = 12 chromosomes, is partially cross pollinated (ranging from 4 to 84%) and possesses one of the largest genomes among crop legumes (~13,000 Mb) [1,2]. Despite being an alternative source of protein for human and effective in nitrogen fixation, the number of molecular markers available for faba bean is still scarce, with only 100 microsatellite (simple sequence repeat; SSR) markers [3,4] and only 32 EST–SSR markers [5,6] having been reported. The development of more reliable and informative molecular markers needs to be improved to enhance our understanding about the faba bean. Next-generation transcriptome sequencing is an efficient means to generate superior resources for the development of cDNA–simple sequence repeat (SSR) markers. cDNA-SSR markers present some intrinsic advantages over genomic SSRs in their direct association with transcribed genes, low expense for development cost, and higher level of transferability to related species [7] and cDNA-SSRs, are highly polymorphic, rather than EST-derived SSR markers [8]. In a recent study, the authors sequenced faba bean transcriptomes using 454 pyrosequencing technologies and found that 1,729 SSR loci from 81,333 individual sequence reads and limited number of sequence 240 were submitted to GenBank, which paved the way for microsatellite marker development. In our study, we developed and characterized polymorphic cDNA-SSR markers based on these sequences for V. faba to facilitate the studies on molecular diversity of this species.

2. Results and Discussion

The V. faba transcriptome sequencing yielded 29.61 Mb and GS De Novo yielded 81,333 raw sequencing reads, based on the GS-FLX sequencer. SSR is one of the most popular marker systems, consisting of varying numbers of tandem repeated di-, tri-, or tetra-nucleotide DNA motifs. To identify SSR markers, we used the ARGOS program with default settings for the V. faba unigene collections. In total, 1,729 potential SSR motifs were identified, and the majority belonged to trinucleotide (67.61%) and dinucleotide (19.08%) repeats. All other types of SSRs such as tetra-, penta-, and hexa- nucleotide motifs were relatively low (13.3%), and the majority of trinucleotide SSRs had the GAA/AAG/AGA motif, followed by those with the TGG/CGT/GGT motif, and others with the CTT/TTC/TCT motif. The GA/AG, AT/TA, and GT/TG motifs were identified among the dinucleotide cDNA-SSRs. The relative proportion of SSR motif types in faba bean [9] were observed as similar to that of other plant species [10,11,12]. Among the identified SSR loci, we selected 240 sequences that were deposited in GenBank (GenBank accession number: KC218573–KC218812). Of the 240 primer pairs, only 55 primer pairs produced consistently amplified (Table 1). These 55 cDNA-SSR loci were screened in 32 accessions. The number of alleles (N) per locus varied widely among the markers (Table 2), ranged from 2 to 15, with an average of 6.0 alleles. The frequency of major alleles (M) per locus varied from 0.17 to 0.91 with an average of 0.563, the genotypes number (N) ranged from 2 to 17, with an average of 6.3. The H values were ranged from 0.00 to 0.44 with an average of 0.074, the H values were ranged from 0.17 to 0.89 with an average of 0.587 and overall PIC values ranged from 0.16 to 0.88, with an average of 0.550 respectively. Similar observation was also found in the Vicia faba [6]. These cDNA-SSR markers were developed in our study are found to be a useful tools for further studies on molecular diversity and population structure of faba bean.
Table 1

Characteristics of the 55 cDNA-SSR markers for faba bean (Vicia faba L.).

LocusPrimer sequences (5′–3′)Product SizeModifGenBank Accession No.Ta (°C)BLAST top hit accession no.Description E-value
GBSSR-VF-8F:TAAAGCAGCTCCGGATGAR:TCGGTGGAGGAGTTGTTG242(TTG)5KC21858058NoneNoneNone
GBSSR-VF-19F:TCCATCAACCTCAAATCCA R:CCGTACTTGTCCACGGAA201(CAA)5KC21859158XP_003637109.1hypothetical protein MTR_072s1002 [Medicago truncatula] 1.00E-41
GBSSR-VF-20F:TCCACCAAGTCCACCTGAR:AATAAGGGCGCAGGAGAG198(GTG)6KC21859258NoneNoneNone
GBSSR-VF-21F:CGAAGCCTCCTCCTCTTCR:TGGTGTTGTATTCGGGGA199(CCT)4 KC21859358ABF66654.1EBP1 [Ammopiptanthus mongolicus]3.00E-37
GBSSR-VF-22F:CGAAGCCTCCTCCTCTTCR:CAAGTGGCCGTTTTTCAA271(CCT)4KC21859458NoneNoneNone
GBSSR-VF-32F:CGAAGCCTCCTCCTCTTCR:GGTGTTGATTCGGGGAGT197(CCT)4KC21860458XP_003614315.1hypothetical protein MTR_5g048060 [Medicago truncatula]5.00E-44
GBSSR-VF-34F:CGGGAACCAACTCAACAAR:CCACCACCGCAACTATGT186(CGA)4KC21860658NoneNoneNone
GBSSR-VF-38F:ACCATTTGGCCTGTTCCTR: CGCTACCCAAATGCTGAA226(GTG)6KC21861058CAA61492.1phloem specific protein [Vicia faba]7.00E-18
GBSSR-VF-52F:GGTTTCTTGTCCAAATAAGACGR:TGCGATTCTGGAAATTGG261(CAG)5KC21862458AFW76468.1putative protein phosphatase 2A family protein [Zea mays]5.00E-27
GBSSR-VF-84F:CGGCGTCTAGAACGTTTGR:AACTAGCGCAGCTCATCG243(GCG)5KC21865658XP_003555733.1PREDICTED: ammonium transporter 1 member 1-like isoform 1 [Glycine max]1.00E-40
GBSSR-VF-113F:TGGTGGTGCTTCTTTCCAR:TGGTGAGCTTGGAACTGC213(CTT)5KC21868559XP_002524296.1Abscisic stress ripening protein, putative [Ricinus communis] 4.00E-05
GBSSR-VF-115F:TGCTGCTTTTCCAACCATR:GTGCATGCCATAACAAAA177(AT)7KC21868757XP_003600578.1NAD(P)H-quinone oxidoreductase subunit N [Medicago truncatula] 0.018
GBSSR-VF-119F:GTGGCCTGTACTGGTGGAR: ACTCGTTGGGGCTAGGAA225(GAA)5KC21869158AFK37381.1unknown [Medicago truncatula]1.00E-80
GBSSR-VF-131F:CCGTACTAAATGAAGCCTTTR:GGCAATCAAGTCCGGTAA238(TA)6KC21870357XP_003546500.1RNA polymerase-associated protein CTR9 homolog [Glycine max]1.00E-05
GBSSR-VF-149F:ACGACATGGTGATGAATCCTR:ACGTGACCGAGTGACGAC211(CAA)8KC21872158XP_003610732.1hypothetical protein MTR_5g006400 [Medicago truncatula] 1.00E-58
GBSSR-VF-153F:TCCCGACGCTACTTCTCAR:CCGAGATCTGCAAACAGC225(CCA)5KC21872558AFK44330.1unknown [Medicago truncatula]3.00E-44
GBSSR-VF-154F:ACACCAATGTTTTTGCGGR:TCCTGACTTTGCTGAGGC247(GAA)5KC21872658XP_003522646.1uncharacterized protein LOC100777431 [Glycine max]1.00E-22
GBSSR-VF-159F:GTGCCATCATCCTCGAAAR:CAGCTGCTAGGTTGCCTG235(TCT)4KC21873158ABD32307.2Nuclear factor related to kappa-B-binding protein, related [Medicago truncatula]3.00E-61
GBSSR-VF-164F:ACCATTTGGCCTGTTCCTR:CAAGGAGGGTTGTTTACGA199(GTG)6KC21873657CAA61492.1phloem specific protein [Vicia faba]3.00E-11
GBSSR-VF-168F:TCTCCAAACCCTCCTCGTR:TCAGCCACAAAATCAGCA250(TGT)6KC21874057XP_003605197.1GRAS family transcription factor [Medicago truncatula] 9.00E-05
GBSSR-VF-172F:CGGTTTCTAAATCTGGCGR:GCTCCATTGAAACCAATTCT232(TTG)5KC21874457XP_003552039.1uncharacterized protein LOC100790537 [Glycine max]1.00E-15
GBSSR-VF-173F:CACAGACAGGTTTCGGGAR:TTGGGTGCAACATCATCA247(CAC)6KC21874558XP_003607781.1Low-temperature inducible [Medicago truncatula] 7.00E-10
GBSSR-VF-175F:TGCCATTCCATCTGAACCR:CCAGGCAATGGAATCTGA256(TCC)7KC21874758ABN08705.1DDT; Homeodomain-related [Medicago truncatula]1.00E-16
GBSSR-VF-180F:TTGGGTGCAACATCATCAR:CGGGAAAGAATCAGAGGC230(GTG)4KC21875258XP_003607781.1Low-temperature inducible [Medicago truncatula] 0.002
GBSSR-VF-184F:CCATCAACGGAGGACTCAR:TAGGGGAAACAGGGGCTA183(TGC)4KC21875658XP_003594716.1Prefoldin subunit [Medicago truncatula] 2.00E-56
GBSSR-VF-185F:GTTTCTTGTCCAAATAAGACGR:CCTGACACTACACGAAAGAC184(CAG)5KC21875758ACJ83506.1unknown [Medicago truncatula]0.47
GBSSR-VF-190F:TTTTATGAAAGCGAAACCGR:TGGACAAAGGCAACAATCA156(TCT)5KC21876258XP_003608427.1Myocyte-specific enhancer factor 2B [Medicago truncatula] 3.00E-17
GBSSR-VF-203F:TTCCCTGACCTTTCAGCAR:TGTTGGGCACCTCAAGTT231(CTC)4KC21877558XP_003555847.1CAX-interacting protein 4-like [Glycine max]2.00E-14
GBSSR-VF-209F:CCATCAACGGAGGACTCAR:GGGAACAGGGGCTAGAGA181(TGC)4KC21878158XP_002519249.1prefoldin subunit, putative [Ricinus communis] 3.00E-28
GBSSR-VF-213F:CCAGGTTTCTTCCTCCGAR:TTTAATTTTGGGCCGGAT271(TC)7KC21878558NoneNoneNone
GBSSR-VF-215F:ACAAACTGAGTCCAACCATGTR:TGCCACTGCTTCTCTTGG279(CAA)4KC21878758XP_003638360.1Cytochrome b reductase [Medicago truncatula] 1.00E-79
GBSSR-VF-216F:CCCATTCAGAACGTGGAAR:GGCTGCAATCTACCACCA194(ACA)4KC21878858ACM50914.1aquaporin [Medicago falcata]9.00E-18
GBSSR-VF-218F:GCTCCGCATATACAAAGATGR:ATGGCGGTGGTCACTATG211(CCA)5KC21879057NoneNoneNone
GBSSR-VF-220F:ACCATTTGGCCTGTTCCTR:CAAATGCTGAAATGGCCT217(GTG)6KC21879158CAA61492.1phloem specific protein [Vicia faba]2.00E-13
GBSSR-VF-221F:CCGAAATGAAGATGATGATGAR:TGAAAGGGAAACTGAAAGTCA243(CAT)5KC21879258NoneNoneNone
GBSSR-VF-237F:TTGGGTGCAACATCATCAR:CGGGAAAGAATCAGAGGC234(GTG)5KC21879358AKF45200.1unknown [Medicago truncatula]2.00E-05
GBSSR-VF-245F:TTGTACCAAGCATTTAATTTTCR:CATTACCACCGTGAGGCA279(TCA)5KC21879457NoneNoneNone
GBSSR-VF-255F:GGAGATGCTTTTGGCCTCR:TGGTCCTGCAGTTTCCAT262(GTT)5KC21879558XP_003544671.1uncharacterized protein LOC100809022 [Glycine max]2.00E-24
GBSSR-VF-258F:AAACCCTCCATCTTCGGAR:CAGGAGAGTATCTTGATAAGGC165(GTG)4KC21879658CAB16318.1cysteine proteinase precursor [Vicia narbonensis]5.00E-30
GBSSR-VF-262F:TCTGGCGAGTGGCATACTR:GCCTTCTACACAACGGCTT224(GAA)5KC21879758CAB07811.1sucrose transport protein [Vicia faba]9.00E-14
GBSSR-VF-263F:ATGCCACCCTCACTTTCCR: TCCTTCCAAATTCAGAATCC157(ACA)6 KC21879858XP_003592083.1Polypyrimidine tract-binding protein-like protein [Medicago truncatula]2.7
GBSSR-VF-266F:CAAATGCAATGCTGCAAAR:AACAGGTGGTGGCTGATG292(TCA)5KC21879958NoneNoneNone
GBSSR-VF-270F:CAGGGATTGCACACAACAR:TGAAAGGAATGGAAGAGGG252(TCA)4KC21880058AAD50628.1alpha-tubulin [Gossypium hirsutum]0.017
GBSSR-VF-271F:TTTTATGAAAGCGAAACCGR:TTGGAACAAAGGCAACAA158(TCT)5KC21880156ACJ84526.1unknown [Medicago truncatula] 1.00E-05
GBSSR-VF-276F:GCTCTTCAACCTGCCCTTR:GGGACAGTTGCTGTTGGA150(CAA)4KC21880258AAU11490.1monodehydroascorbate reductase I [Pisum sativum]9.00E-55
GBSSR-VF-285F:AAGAAGGTGTCGCGGAAGR:CCGCACCTTCTCCTCTCT176(GAT)5KC21880358NoneNoneNone
GBSSR-VF-288F:GCCTGTGGCTAGAAGCAAR:TAATGGTCCCAGCACCTC237(TCA)5KC21880457NoneNoneNone
GBSSR-VF-293F:CCCATTCAGAACGTGGAAR:TCAGCAATAAAAGCTCTTGGA160(ACA)4KC21880558ACU17538.1unknown [Glycine max]0.018
GBSSR-VF-295F:CAGGGTTACGATTGCTCGR:AAATGGCAAGAGATTAAAAGCA175(TGC)4KC21880658XP_003594716.1Prefoldin subunit [Medicago truncatula]3.00E-35
GBSSR-VF-297F:AGACCAAGAATCAAGGTCACAR:CTCTTCACAAAGCGACCCT150(AAT)6KC21880758CAB39664.1putative protein [Arabidopsis thaliana]4.00E-05
GBSSR-VF-298F:AATCATCCGGAACCATCCR:GACGTCTGAGGAGAGGGC249(TTC)4KC21880858XP_003624491.1hypothetical protein MTR_7g083930 [Medicago truncatula] 3.00E-25
GBSSR-VF-311F:GGCCTTTCAACAAGAGGGR:ACCATTTGGCCTGTTCCT207(CAC)6KC21880958CAA61492.1phloem specific protein [Vicia faba]2.00E-16
GBSSR-VF-312F:GGCTATGGTGGTCATGGAR:TTACGCCGCCTCCAC151(TGG)5KC21881058CAH40798.1putative glycine rich protein precursor [Pisum sativum]6.00E-08
GBSSR-VF-319F:CATGCATTTGCTGCTCAAR:GTGCAGGCACTACATGGG158(TTG)5KC21881158NP_001237269.1VHS and GAT domain protein [Glycine max] 5.00E-28
GBSSR-VF-323F:TCTGCTTCCATCTTCATCGR:TTGCTGAAGTTGCTCTGTGA180(ACA)4KC21881258NoneNoneNone

Note: Ta, annealing temperature.

Table 2

Diversity statistics from initial primer screening in 32 accessions of faba bean (Vicia faba L.).

Marker MAF NG NA HO HE PIC
GBSSR-VF-80.1717150.280.890.88
GBSSR-VF-190.50660.000.660.61
GBSSR-VF-200.42890.090.740.71
GBSSR-VF-210.38660.060.740.70
GBSSR-VF-220.47780.030.710.67
GBSSR-VF-320.66550.000.540.51
GBSSR-VF-340.65660.000.560.53
GBSSR-VF-380.69770.100.490.46
GBSSR-VF-520.47770.000.690.65
GBSSR-VF-840.58440.000.600.56
GBSSR-VF-1130.38770.000.760.73
GBSSR-VF-1150.341090.030.790.76
GBSSR-VF-1190.28660.000.800.77
GBSSR-VF-1310.30880.060.800.78
GBSSR-VF-1490.47990.000.730.70
GBSSR-VF-1530.50440.000.670.62
GBSSR-VF-1540.47770.060.710.68
GBSSR-VF-1590.41550.000.700.65
GBSSR-VF-1640.52870.060.670.64
GBSSR-VF-1680.2510110.130.810.78
GBSSR-VF-1720.3018140.440.850.84
GBSSR-VF-1730.52770.090.660.63
GBSSR-VF-1750.2313120.250.820.80
GBSSR-VF-1800.50550.090.660.61
GBSSR-VF-1840.61550.030.560.51
GBSSR-VF-1850.91330.060.170.17
GBSSR-VF-1900.56990.280.640.61
GBSSR-VF-2030.91220.000.170.16
GBSSR-VF-2090.77440.030.390.35
GBSSR-VF-2130.47550.000.690.64
GBSSR-VF-2150.72330.000.440.39
GBSSR-VF-2160.75220.000.380.30
GBSSR-VF-2180.81220.000.300.26
GBSSR-VF-2200.68440.060.500.46
GBSSR-VF-2210.45760.130.680.63
GBSSR-VF-2370.63650.090.560.53
GBSSR-VF-2450.72550.000.450.42
GBSSR-VF-2550.75440.000.410.37
GBSSR-VF-2580.56660.130.630.60
GBSSR-VF-2620.4411100.250.740.71
GBSSR-VF-2630.41880.190.700.65
GBSSR-VF-2660.59440.000.580.53
GBSSR-VF-2700.69330.000.480.43
GBSSR-VF-2710.381080.220.740.70
GBSSR-VF-2760.72330.000.440.40
GBSSR-VF-2850.73550.260.450.43
GBSSR-VF-2880.64550.030.530.49
GBSSR-VF-2930.78330.000.350.31
GBSSR-VF-2950.70550.030.470.43
GBSSR-VF-2970.59860.160.590.55
GBSSR-VF-2980.72330.000.440.40
GBSSR-VF-3110.72760.090.450.42
GBSSR-VF-3120.69220.000.430.34
GBSSR-VF-3190.80440.030.350.32
GBSSR-VF-3230.66760.230.520.49
Mean0.5636.36.00.0740.5870.550

(MAF ), Major allele frequency; (NG), number of genotype; (NA), number of allele; (HO), observed heterozygosity; (HE), expected heterozygosity; (PIC), polymorphic information content.

Characteristics of the 55 cDNA-SSR markers for faba bean (Vicia faba L.). Note: Ta, annealing temperature. Diversity statistics from initial primer screening in 32 accessions of faba bean (Vicia faba L.). (MAF ), Major allele frequency; (NG), number of genotype; (NA), number of allele; (HO), observed heterozygosity; (HE), expected heterozygosity; (PIC), polymorphic information content.

3. Experimental

3.1. Plant Material

Faba bean seeds were selected from the National Agrobiodiversity Center, Rural Development Administration, Suwon, Korea. Seedlings were germinated and grown in a glasshouse. The leaves of young seedlings were used to extract the mRNA required to synthesize the cDNA library and for 454 sequencing.

3.2. cDNA Preparation

Total RNA was extracted from V. faba leaves that were frozen in liquid nitrogen, ground well into a powder, and then extracted using an RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions. The integrity of total RNA was determined using a BIOSPEC-NANO spectrophotometer (Shimadzu, Kyoto, Japan) and agarose gel electrophoresis. mRNA was purified using the PolyATract mRNA Isolation System IV (Promega, Madison, WI, USA), and the purified products were used to synthesize full-length cDNAs using a ZAP-cDNA Synthesis kit (Stratagene, Santa Clara, CA, USA). Finally, cDNA was fragmented by nebulization for library construction.

3.3. Library Preparation

Approximately 1 µg of cDNA was used to generate a DNA library to use with the rapid library preparation method manual (Roche Life Science Inc., Branford, CT, USA). The cDNA fragment ends were polished (blunted), and two short adapters were ligated to both ends according to standard procedures described previously. The adapters provided priming of the sequences for both amplification and sequencing of the sample library fragments, as well as the sequencing key, a short sequence of four nucleotides used by the system’s software for base calling. Following repair of any nicks in the double-stranded library, the unbound strand of each fragment was released (with 5-Adaptor A). Finally, the quality of this single-stranded template DNA library was assessed using a 2100 BioAnalyzer (Agilent, Waldbronn, Germany). The library was quantified to determine the optimal amount of the library needed as input for emulsion-based clonal amplification.

3.4. 454 Pyrosequencing

Single effective copies of template species from the DNA library to be sequenced were hybridized to DNA capture beads. The immobilized library was then resuspended in an amplification solution, and the mixture was emulsified, followed by polymerase chain reaction (PCR) amplification. The DNA carrying beads were recovered from the emulsion and enriched after amplification. The second strands of the amplified products were melted, leaving the amplified single-stranded DNA library bound to the beads. The sequencing primer was then annealed to the immobilized amplified DNA templates. After amplification, a single DNA carrying bead was placed into each well of a PicoTiterPlate (PTP) device. Simultaneous sequencing with multiple samples on a single PTP (four region gasket) was used. The PTP was then inserted into the FLX Genome Titanium sequencer for pyrosequencing [13,14], and sequencing reagent was sequentially flowed over the plate. Information from the PTP wells was captured simultaneously by a camera, and the images were processed in real-time by an onboard computer. Multiplex identifiers were used to specifically tag unique samples in a GS FLX Titanium sequencing run, which were recognized by the GS data analysis software after the sequencing run and provided high confidence for assigning individual sequencing reads to the correct sample. Sequence assembly was performed after sequencing using GS De Novo Assembler software (Roche) to produce contigs and singletons. All sequence data were conformed to references using GS Reference Mapper software (Roche).

3.5.Discovery of cDNA-SSR Markers

All contigs and singletons from both transcriptomes were then used to mine SSR motifs, and the SSR motifs were identified using the ARGOS pipeline program (version 1.46) at the default settings to survey the molecular markers present in the V. faba accessions [15]. Parameters were designed for identifying perfect di-, tri-, tetra-, penta-, and hexa-nucleotide motifs with a minimum of six repeats. Primer design parameters were set as follows: length range, 18–23 nucleotides with 21 as optimum; PCR product size range, 100–400 bp; optimum annealing temperature, 55 °C; and GC content 40–60%, with 50% as optimum. Faba bean genomic DNA was extracted from 18 diverse faba bean accession samples for EST-SSR marker validation using a DNeasy® Plant Mini kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. Fresh leaf tissue from each accession was used for each extraction and ground well using liquid nitrogen. DNA was resuspended in 100 μL water, and dilutions were made to 10 ng/μL followed by storage at either −20°C or −80°C. Randomly selected EST-SSR primer pairs were validated experimentally, and forward primers were synthesized by adding the M13 sequence to enable fluorescent tail addition through the PCR amplification process [16]. PCR conditions included a hot-start at 95 °C for 10 min, followed by 10 cycles at 94 °C for 30 s, 60–50 °C for 30 s and 72 °C for 30 s, followed by 25 cycles at 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 30 s, and a final elongation step of 72 °C for 10 min. PCR products were separated and visualized using the QIAxcel Gel Electrophoresis System (Qiagen).

3.6. Data Analysis

These 55 SSR loci were screened in 32 accessions (Table 3). The number of alleles (N), major allele frequency (M), observed heterozygosity (H), Expected heterozygosity (H), number of genotype (N), and polymorphism information content (PIC) were calculated using GenAlEx (version 6.5) [17].
Table 3

List of faba bean (Vicia faba L.) accessions and details of collection sites.

No.Temp. IDARS No.Origin
1K193517PI 221516Afghanistan
2K193518PI 223418Iran
3K193519PI 234634Australia
4K193520PI 251331Israel
5K193521PI 253806Iraq
6K193522PI 254920Spain
7K193523PI 275641Ethiopia
8K193524PI 284338Lebanon
9K193525PI 284345Italy
10K193526PI 319901Soviet Union
11K193527PI 358270Serbia and Montenegro
12K193528PI 371806United Kingdom
13K193529PI 415027France
14K193530PI 415050Sudan
15K193531PI 430133Egypt
16K193532PI 442559BEL
17K193533PI 458504Mexico
18K193534PI 469135Japan
19K193535PI 469144Cyprus
20K193536PI 469180Greece
21K193537PI 469182Jordan
22K193538PI 469189India
23K193539PI 478506Bolivia
24K193540PI 499959China
25K193541PI 577723Kyrgyzstan
26K193542PI 577735Chile
27K193543PI 577741Nepal
28K193544PI 655323Morocco
29K193545PI 655325Peru
30K193546PI 655326Ecuador
31K193547PI 655330Kenya
32K193548PI 655344Pakistan

Temp ID, Korean Gene Bank ID; ARS No, USDA-ARS Number.

List of faba bean (Vicia faba L.) accessions and details of collection sites. Temp ID, Korean Gene Bank ID; ARS No, USDA-ARS Number.

4. Conclusions

In our study we have developed 55 cDNA-SSR markers, and they were successfully used to investigate the genetic diversity among 32 accessions of faba bean. However, there seems to be a relatively higher genetic diversity within V. faba, as only 55 of 240 cDNA-SSR loci exhibited polymorphism. The availability of co-dominant polymorphic cDNA-SSR markers provided a tool set for further study on molecular diversity, and will greatly facilitated the genetic structure studies of V. faba populations, the identification and conservation of faba bean.
  13 in total

Review 1.  Pyrosequencing sheds light on DNA sequencing.

Authors:  M Ronaghi
Journal:  Genome Res       Date:  2001-01       Impact factor: 9.043

2.  Reference standards for determination of DNA content of plant nuclei.

Authors:  J S Johnston; M D Bennett; A L Rayburn; D W Galbraith; H J Price
Journal:  Am J Bot       Date:  1999-05       Impact factor: 3.844

3.  Pyrosequencing: a tool for DNA sequencing analysis.

Authors:  Elahe Elahi; Mostafa Ronaghi
Journal:  Methods Mol Biol       Date:  2004

4.  Mining and survey of simple sequence repeats in expressed sequence tags of dicotyledonous species.

Authors:  Siva P Kumpatla; Snehasis Mukhopadhyay
Journal:  Genome       Date:  2005-12       Impact factor: 2.166

Review 5.  Functions of the gene products of Escherichia coli.

Authors:  M Riley
Journal:  Microbiol Rev       Date:  1993-12

6.  Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers.

Authors:  Sukhjiwan Kaur; Luke W Pembleton; Noel O I Cogan; Keith W Savin; Tony Leonforte; Jeffrey Paull; Michael Materne; John W Forster
Journal:  BMC Genomics       Date:  2012-03-20       Impact factor: 3.969

7.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

8.  De novo assembly and characterization of root transcriptome using Illumina paired-end sequencing and development of cSSR markers in sweet potato (Ipomoea batatas).

Authors:  Zhangying Wang; Boping Fang; Jingyi Chen; Xiongjian Zhang; Zhongxia Luo; Lifei Huang; Xinliang Chen; Yujun Li
Journal:  BMC Genomics       Date:  2010-12-24       Impact factor: 3.969

9.  Transcriptome sequencing of lentil based on second-generation technology permits large-scale unigene assembly and SSR marker discovery.

Authors:  Sukhjiwan Kaur; Noel O I Cogan; Luke W Pembleton; Maiko Shinozuka; Keith W Savin; Michael Materne; John W Forster
Journal:  BMC Genomics       Date:  2011-05-25       Impact factor: 3.969

10.  Transferability of the EST-SSRs developed on Nules clementine (Citrus clementina Hort ex Tan) to other Citrus species and their effectiveness for genetic mapping.

Authors:  François L Luro; Gilles Costantino; Javier Terol; Xavier Argout; Thierry Allario; Patrick Wincker; Manuel Talon; Patrick Ollitrault; Raphael Morillon
Journal:  BMC Genomics       Date:  2008-06-16       Impact factor: 3.969

View more
  10 in total

1.  Association mapping for frost tolerance using multi-parent advanced generation inter-cross (MAGIC) population in faba bean (Vicia faba L.).

Authors:  Ahmed Sallam; Regina Martsch
Journal:  Genetica       Date:  2015-06-04       Impact factor: 1.082

2.  Relationship between geographical origin, seed size and genetic diversity in faba bean (Vicia faba L.) as revealed by SSR markers.

Authors:  Şurhan Göl; Sami Doğanlar; Anne Frary
Journal:  Mol Genet Genomics       Date:  2017-05-11       Impact factor: 3.291

3.  Genetic variability in Tunisian populations of faba bean (Vicia faba L. var. major) assessed by morphological and SSR markers.

Authors:  Feten Rebaa; Ghassen Abid; Marwa Aouida; Souhir Abdelkarim; Ibtissem Aroua; Yordan Muhovski; Jean-Pierre Baudoin; Mahmoud M'hamdi; Khaled Sassi; Moez Jebara
Journal:  Physiol Mol Biol Plants       Date:  2017-02-02

4.  Hemolytic crisis in a G6PD-deficient infant after ingestion of pumpkin.

Authors:  Gian Vincenzo Zuccotti; Francesca Redaelli; Valentina Gualdi; Valeria Rizzi; Chiara Mameli; Dario Dilillo; Valentina Fabiano
Journal:  Ital J Pediatr       Date:  2014-07-21       Impact factor: 2.638

5.  Genetic Diversity and Population Structure in Vicia faba L. Landraces and Wild Related Species Assessed by Nuclear SSRs.

Authors:  Hugo R Oliveira; Diana Tomás; Manuela Silva; Susana Lopes; Wanda Viegas; Maria Manuela Veloso
Journal:  PLoS One       Date:  2016-05-11       Impact factor: 3.240

6.  De Novo Sequencing and Analysis of the Safflower Transcriptome to Discover Putative Genes Associated with Safflor Yellow in Carthamus tinctorius L.

Authors:  Xiuming Liu; Yuanyuan Dong; Na Yao; Yu Zhang; Nan Wang; Xiyan Cui; Xiaowei Li; Yanfang Wang; Fawei Wang; Jing Yang; Lili Guan; Linna Du; Haiyan Li; Xiaokun Li
Journal:  Int J Mol Sci       Date:  2015-10-26       Impact factor: 5.923

7.  Genetic diversity of Xanthoceras sorbifolium bunge germplasm using morphological traits and microsatellite molecular markers.

Authors:  Zhan Shen; Jie Duan; Luyi Ma
Journal:  PLoS One       Date:  2017-06-01       Impact factor: 3.240

Review 8.  Mining and Development of Novel SSR Markers Using Next Generation Sequencing (NGS) Data in Plants.

Authors:  Sima Taheri; Thohirah Lee Abdullah; Mohd Rafii Yusop; Mohamed Musa Hanafi; Mahbod Sahebi; Parisa Azizi; Redmond Ramin Shamshiri
Journal:  Molecules       Date:  2018-02-13       Impact factor: 4.411

9.  Identification and Verification of QTL Associated with Frost Tolerance Using Linkage Mapping and GWAS in Winter Faba Bean.

Authors:  Ahmed Sallam; Mustapha Arbaoui; Mohamed El-Esawi; Nathan Abshire; Regina Martsch
Journal:  Front Plant Sci       Date:  2016-08-04       Impact factor: 5.753

10.  Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing.

Authors:  Yong Li; Weirui Zhang
Journal:  Appl Plant Sci       Date:  2015-10-13       Impact factor: 1.936

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.