| Literature DB >> 24658602 |
Wenhui Zhai1, Zhigang Huang2, Li Chen3, Cong Feng3, Bei Li3, Tanshi Li3.
Abstract
Phthalates are extensively used as plasticizers in a variety of daily-life products, resulting in widespread distribution in aquatic environments. However, limited information is available on the endocrine disrupting effects of phthalates in aquatic organisms. The aim of the present study was to examine whether exposure to mono-(2-ethylhexyl) phthalate (MEHP), the hydrolytic metabolite of di-(2-ethylhexyl) phthalate (DEHP) disrupts thyroid endocrine system in fish. In this study, zebrafish (Danio rerio) embryos were exposed to different concentrations of MEHP (1.6, 8, 40, and 200 μg/L) from 2 h post-fertilization (hpf) to 168 hpf. The whole-body content of thyroid hormone and transcription of genes involved in the hypothalamic-pituitary-thyroid (HPT) axis were examined. Treatment with MEHP significantly decreased whole-body T4 contents and increased whole-body T3 contents, indicating thyroid endocrine disruption. The upregulation of genes related to thyroid hormone metabolism (Dio2 and UGT1ab) might be responsible for decreased T4 contents. Elevated gene transcription of Dio1 was also observed in this study, which might assist to degrade increased T3 contents. Exposure to MEHP also significantly induced transcription of genes involved in thyroid development (Nkx2.1 and Pax8) and thyroid hormone synthesis (TSHβ, NIS and TG). However, the genes encoding proteins involved in TH transport (transthyretin, TTR) was transcriptionally significantly down-regulated after exposure to MEHP. Overall, these results demonstrate that acute exposure to MEHP alters whole-body contents of thyroid hormones in zebrafish embryos/larvae and changes the transcription of genes involved in the HPT axis, thus exerting thyroid endocrine toxicity.Entities:
Mesh:
Substances:
Year: 2014 PMID: 24658602 PMCID: PMC3962405 DOI: 10.1371/journal.pone.0092465
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Primer sequences for the genes tested in the present study.
| Gene name | Primer Sequence (5′-3′) | Accession Number | |
| Forward | Reverse | ||
|
| ttgttggtgttgttgctggt | ggatgctcaacagggttcat | NM_200713 |
|
| gcagatcctcacttcacctacc | gcacaggtttggagcatctca | AY135147 |
|
| aggacggtaaaccgtgtcag | caccatgctgctcgtgtact | NM_131589 |
|
| gaagatcgcggagtacaagc | ctgcactttagtgcggatga | AF072549 |
|
| ggtggcatgaaggctgtaat | gatacggcatccattgttgg | NM_001089391 |
|
| ccagccgaaaggatagagttg | atgctgccgtggaatagga | XM_001335283 |
|
| cgggtggagtttgacacttt | gctcagaaggagagccagta | BC081488 |
|
| gttcaaacagcttgtcaaggact | agcaagcctctcctccaagtt | BC076008 |
|
| gcataggcagtcgctcattt | tgtggtctctcatccaacca | NM_212789 |
|
| ccaccaagtctttccgtgtt | gcagtccttcacaggctttc | NM_213422 |
Development index of zebrafish larvae after exposure to MEHP (0, 1.6, 8, 40 and 200 μg/L) until 168 hpf.a
| MEHP (μg/L) | 0 | 1.6 | 8 | 40 | 200 |
| Hatching | 93.5±1.2 | 91.9±2.6 | 94.4±0.7 | 90.8±0.7 | 93.2±0.4 |
| Malformation | 2.08±0.42 | 3.02±0.87 | 2.04±0.43 | 2.57±0.25 | 3.01±0.38 |
| Survival | 75.2±1.3 | 73.2±3.4 | 76.5±1.0 | 72.6±0.1 | 74.9±0.2 |
| Length | 3.41±0.13 | 3.41±0.05 | 3.52±0.11 | 3.32±0.06 | 3.11±0.13 |
| Weight | 0.36±0.03 | 0.37±0.01 | 0.36±0.03 | 0.35±0.04 | 0.34±0.01 |
The values represent mean ± standard error (SEM) of six replicate groups.
Figure 1Whole-body thyroxine (T4) contents in zebrafish larvae exposed to different concentrations of MEHP until 168 hpf.
Values represent mean±SEM (n = 6). Significant difference from the control group is indicated by ** P<0.01.
Figure 2Whole-body triiodothyronine (T3) contents in zebrafish larvae exposed to different concentrations of MEHP until 168 hpf.
Values represent mean±SEM (n = 6). Significant difference from the control group is indicated by * P<0.05.
Figure 3Gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in zebrafish larvae after exposure to different concentrations of MEHP until 168 hpf.
Data expressed as mean±SEM (n = 6). Significant difference from the control group is indicated by * P<0.05, and ** P<0.01.