The extracellular matrix (ECM) is a major component of tumors and a significant contributor to cancer progression. In this study, we use proteomics to investigate the ECM of human mammary carcinoma xenografts and show that primary tumors of differing metastatic potential differ in ECM composition. Both tumor cells and stromal cells contribute to the tumor matrix and tumors of differing metastatic ability differ in both tumor- and stroma-derived ECM components. We define ECM signatures of poorly and highly metastatic mammary carcinomas and these signatures reveal up-regulation of signaling pathways including TGFβ and VEGF. We further demonstrate that several proteins characteristic of highly metastatic tumors (LTBP3, SNED1, EGLN1, and S100A2) play causal roles in metastasis, albeit at different steps. Finally we show that high expression of LTBP3 and SNED1 correlates with poor outcome for ER(-)/PR(-)breast cancer patients. This study thus identifies novel biomarkers that may serve as prognostic and diagnostic tools. DOI: http://dx.doi.org/10.7554/eLife.01308.001.
The extracellular matrix (ECM) is a major component of tumors and a significant contributor to cancer progression. In this study, we use proteomics to investigate the ECM of human mammary carcinoma xenografts and show that primary tumors of differing metastatic potential differ in ECM composition. Both tumor cells and stromal cells contribute to the tumor matrix and tumors of differing metastatic ability differ in both tumor- and stroma-derived ECM components. We define ECM signatures of poorly and highly metastatic mammary carcinomas and these signatures reveal up-regulation of signaling pathways including TGFβ and VEGF. We further demonstrate that several proteins characteristic of highly metastatic tumors (LTBP3, SNED1, EGLN1, and S100A2) play causal roles in metastasis, albeit at different steps. Finally we show that high expression of LTBP3 and SNED1 correlates with poor outcome for ER(-)/PR(-)breast cancerpatients. This study thus identifies novel biomarkers that may serve as prognostic and diagnostic tools. DOI: http://dx.doi.org/10.7554/eLife.01308.001.
With an estimated number of new cases in 2008 of 1.3 million worldwide (http://globocan.iarc.fr), breast cancer is the second most frequent cancer worldwide and claimed the lives of over 39,000 patients in the United States in 2012 alone. Most cancer deaths (∼90%) are due to the metastatic colonization of distant organs by the tumor cells. The development of novel diagnostic approaches, including novel screening and imaging methods to improve detection of smaller primary tumors and distant metastases, and the identification of novel prognostic markers to permit better classification of breast cancers according to their metastatic potential is imperative as is the development of novel therapeutic strategies.For the last decade, there has been increasing interest in the tumor microenvironment, which encompasses all the components (cellular and acellular) of a tumor in addition to the tumor cells themselves (Joyce and Pollard, 2009; Egeblad et al., 2010). Indeed, in order to progress, a tumor needs to be surrounded by a permissive environment and, to metastasize, tumor cells need to find or create a favorable niche (seed and soil theory) (Paget, 1889; Ribatti et al., 2006; Erler and Weaver, 2009; Comen, 2012). To create such a niche, tumor cells either directly alter the microenvironment, or instruct local or recruited stromal cells to do so. In the context of breast cancer, recent studies have shown that the cross-talk and interaction of the tumor cells with their surrounding microenvironment is necessary for tumor progression (Tlsty and Coussens, 2006; Polyak et al., 2009; Dvorak et al., 2011; Boudreau et al., 2012; Conklin and Keely, 2012; Fordyce et al., 2012). In addition, the nature of the tumor microenvironment or gene expression profile of the stromal cells has been used to define humanbreast cancer types (Bergamaschi et al., 2008; Finak et al., 2008; Conklin et al., 2011). Recent studies have also demonstrated that treatment outcome depends on the tumor microenvironment (vascularization, oxygenation, recruited normal cells, etc; Chauhan et al., 2011; Jacobetz et al., 2013).The extracellular matrix (ECM) is the complex scaffold of proteins that provides the architectural support for cell and tissue organization (Hynes and Naba, 2012). Cells are in turn able to adhere to the extracellular matrix via different types of receptors including the integrins (Hynes, 2002; Geiger and Yamada, 2011). In addition to providing biophysical cues, the ECM provides biochemical signals that are major regulators of cell proliferation, survival, migration, and invasion. (Hynes, 2009). Pathologists have used excessive ECM deposition (desmoplasia) as a marker of tumors with poor prognosis long before the complexity of the ECM was even deciphered (Anastassiades and Pryce, 1974). Despite its great importance in physiological (development, aging) and pathological processes such as cancer, the extracellular matrix remains underexplored (Wilson, 2010).To define the composition of extracellular matrices of tissues and tumors, we have developed a proteomics-based method to enrich and identify ECM proteins and coupled it with a bioinformatic annotation of the ‘matrisome’ defined as the ensemble of ECM and ECM-associated proteins (Naba et al., 2012). Using this approach, we characterized the extracellular matrices of normal murine tissues (e.g., lung and colon) and demonstrated that each of these comprises over 100 proteins. In this study, we apply this proteomics approach to study the composition of the ECMs of poorly and highly metastatic human mammary carcinoma xenografts, and show that both the tumor cells and the stromal cells contribute in characteristic ways to the production of the tumor ECM. Moreover, we show that both tumor- and stroma-derived proteins differ between tumors of different metastatic potential. Importantly, we demonstrate functional roles for several specific tumor-cell-derived ECM proteins in promoting metastasis. Altogether, our results demonstrate that the proteomic analysis of the tumor ECM can be used to identify proteins playing causal roles in tumor progression that could be further developed as prognostic or diagnostic markers and potentially as therapeutic targets.
Results
The composition of the tumor extracellular matrix changes with tumor metastatic potential
To identify ECM proteins important for breast cancer progression and metastasis formation, we used a xenograft model where humanbreast cancer cells were orthotopically injected into the mouse mammary fat pad. We used cell lines of differing metastatic potential. The poorly metastatic MDA-MB-231 cell line was established from cells isolated from a pleural effusionsample from a triple-negative breast cancerpatient (Cailleau et al., 1978). The highly metastatic MDA-MB-231-LM2 line (denoted LM2), was previously selected and characterized for increased metastatic potential to the lungs (Minn et al., 2005). 6.5 weeks post-injection, the primary tumors were harvested, ECM proteins were enriched from tumors using the subcellular fractionation protocol described previously (Naba et al. 2012), and the composition of the ECM-enriched fractions obtained was characterized by mass spectrometry (Figure 1A).
Figure 1.
Enrichment of extracellular matrix proteins from human mammary tumor xenografts.
(A) The sequential extraction of intracellular components was monitored by immunoblotting for GAPDH (cytosol), the transferrin receptor (plasma membrane), and actin (cytoskeleton). The remaining insoluble fraction was highly enriched for ECM proteins (collagen I panel) and largely depleted for intracellular components. The ECM-enriched fraction obtained is subsequently submitted to multidimensional proteomic analysis and the matrisome (ECM composition) of each tumor type is defined as the ensemble of proteins present in two replicate samples and with at least two peptides in one of the two replicates. (B) Venn diagram represents the comparison of the matrisomes of MDA-MB-231 and LM2 tumors. In addition to 118 ECM proteins detected in both tumor types, we identified 26 proteins specific to poorly metastatic (MDA-MB-231) tumors and 43 proteins characteristic of highly metastatic tumors (LM2).
DOI:
http://dx.doi.org/10.7554/eLife.01308.003
Enrichment of extracellular matrix proteins from human mammary tumor xenografts.
(A) The sequential extraction of intracellular components was monitored by immunoblotting for GAPDH (cytosol), the transferrin receptor (plasma membrane), and actin (cytoskeleton). The remaining insoluble fraction was highly enriched for ECM proteins (collagen I panel) and largely depleted for intracellular components. The ECM-enriched fraction obtained is subsequently submitted to multidimensional proteomic analysis and the matrisome (ECM composition) of each tumor type is defined as the ensemble of proteins present in two replicate samples and with at least two peptides in one of the two replicates. (B) Venn diagram represents the comparison of the matrisomes of MDA-MB-231 and LM2 tumors. In addition to 118 ECM proteins detected in both tumor types, we identified 26 proteins specific to poorly metastatic (MDA-MB-231) tumors and 43 proteins characteristic of highly metastatic tumors (LM2).DOI:
http://dx.doi.org/10.7554/eLife.01308.003We define the matrisome of a tumor as the ensemble of proteins detected in two independent biological replicates and by at least two peptides in one of the two replicates. According to this definition, the matrisome of MDA-MB-231tumors is composed of 144 proteins and the matrisome of LM2 tumors is composed of 161 proteins (Figure 1B, Figure 2, Figure 2—source data 1). Comparison of the matrisomes of MDA-MB-231 and LM2 tumors identified 118 proteins expressed by both tumor types. In addition, we detected 26 proteins specific to the poorly metastatic tumors and 43 proteins specific to highly metastatic tumors (Figure 1B, Figure 2, Figure 2—source data 1). According to our previous bioinformatic definition of the matrisome (Naba et al., 2012), we further categorized these ECM proteins into two categories: core matrisome proteins and matrisome-associated proteins. The core matrisome comprises ECM glycoproteins, collagens, and proteoglycans. Matrisome-associated proteins include ECM-affiliated proteins, ECM regulators (ECM remodeling enzymes and their regulators), and ECM-associated secreted factors (Figure 2, Figure 2—source data 1). One can note that the most abundant proteins for each of these categories were detected in both tumor types. Examples of these proteins are fibronectin (FN1), fibrinogen, laminins, HSPG2 or perlecan, collagens I, III, IV, V and VI, and transglutaminase 2 (TGM2). In fact, we have previously reported the expression of these proteins in several normal tissues (Naba et al., 2012), which suggests that these proteins are widely expressed. Most of the matrisome-associated components were detected at lower abundance, reflecting their presence at lower molar ratios than structural core ECM proteins (Figure 2, Figure 2—source data 1). Therefore, the analysis identified ECM signatures of poorly (26 proteins) or highly (43 proteins) metastatic tumors (Figures 1B and 2) and the proteins that differ between the two tumor types belong mostly to the ECM glycoproteins and the ECM regulators categories. Among the 43 proteins characteristic of highly metastatic tumors (Figure 3D), we identified several proteins that have previously been reported to play a role in breast cancer metastasis in diverse cell and tumor models. Examples of these are angiopoietin-like 4 (ANGPTL4, Padua et al., 2008), cathepsin B (CTSB, Sevenich et al., 2010, 2011; Vasiljeva et al., 2006), insulin-like growth factor-binding protein 4 (IGFBP4, Ryan et al., 2009) and lysyl-oxidase-like 2 (LOXL2, Barry-Hamilton et al., 2010). Several other proteins in our list have been shown to play roles in metastasis of other tumor types (‘Discussion’).
Figure 2.
Comparison of the matrisomes of MDA-MB-231 tumors and LM2 tumors identifies ECM proteins characteristic of poorly and highly metastatic tumors.
Color code represents the number of unique peptides for each protein from poorly metastatic (MDA-MB-231) or highly metastatic (LM2) human mammary tumors. Values used to generate the figure were extracted from Figure 2—source data 1, columns P and AA (number of peptides). Grayed cells indicate that no peptides were detected in either of the two replicate samples. A dash (–) indicates that the protein was detected in only one of the two replicate samples of a given tumor type or with only one peptide in both replicate samples.
DOI:
http://dx.doi.org/10.7554/eLife.01308.004
DOI:
http://dx.doi.org/10.7554/eLife.01308.005
(A) Immunoblots were performed on ECM-enriched fractions prepared from MDA-MB-231 or LM2 tumors to confirm the differential expression of some of the proteins identified by proteomics. (B) Immunohistochemistry was performed on MDA-MB-231 or LM2 tumor sections to evaluate the expression and localization of LTBP3. LTBP3 is detected in LM2 but not MDA-MB-231 tumors. Note the extracellular distribution of LTBP3. (C) RT-qPCR was used to monitor mRNA expression levels in LM2 tumors as compared to MDA-MB-231 tumors and was conducted in triplicate in two independent tumors per tumor type. Bar charts represent normalized expression of the genes in LM2 tumors (black) as compared to MDA-MB-231 tumors (gray). Actin expression was used to normalize RT-qPCR data. Data are presented as means ±SEM. (D) RNA was extracted from normal murine mammary gland (light grey) or from autochtonous murine mammary tumors (MMTV-PyMT transgenic mice: adenoma, dark grey or adenocarcinoma, black). RT-qPCR was conducted in triplicate. Bar charts represent normalized expression of the genes. Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM.
DOI:
http://dx.doi.org/10.7554/eLife.01308.006
Figure 3.
The tumor extracellular matrix is secreted by both tumor cells and stromal cells and differs with the tumor’s metastatic potential.
(A) Proteins expressed by both tumor types and by the same compartment in the two tumor types. (B) Proteins expressed by both tumor types but by different compartments. (C) Proteins secreted by MDA-MB-231 tumors and not by LM2 tumors. (D) Proteins secreted by LM2 tumors and not by MDA-MB-231 tumors. The number of peptides detected for each protein is indicated. For the proteins secreted by both the tumor cells and the stromal cells, the number of peptides listed corresponds to the number of human (tumor-derived)- or murine (stroma-derived)-specific peptides. For the proteins secreted by only one compartment, the number of peptides includes both species-specific and indistinguishable peptides. Proteins are sorted by tumor type and by their origins: tumor (red), stroma (blue), or both (yellow: similar abundance of the human and mouse proteins, orange: human form is at least five times more abundant than the mouse form, green: the mouse form is at least five times more abundant). To determine the relative contributions of the tumor and stromal cells to the secretion of ECM proteins, human-to-mouse peptide abundance ratios were calculated using the values indicated in column P and AB for the MDA-MB-231 and LM2 tumors respectively (Figure 3—source data 1). Proteins for which different isoforms have been detected are indicated with an asterisk (*) and, for simplicity, isoforms are combined here, their UniProt accession numbers can be found in Figure 3—source data 1, column AP. In a few instances, the origin of the protein could not be determined due to the lack of species-specific peptides; these proteins are indicated with a question mark (?).
DOI:
http://dx.doi.org/10.7554/eLife.01308.007
DOI:
http://dx.doi.org/10.7554/eLife.01308.008
The four tables containing all of the confidently identified peptide spectrum matches (PSMs) from the LC-MS/MS runs of the 11 fractions resulting from off-gel electrophoresis of each of the four tumor samples can be downloaded from MassIVE (http://massive.ucsd.edu) using the identifier: MSV000078535. The file should be accessible at ftp://MSV000078535:a@massive.ucsd.edu/results.
DOI:
http://dx.doi.org/10.7554/eLife.01308.009
Comparison of the matrisomes of MDA-MB-231 tumors and LM2 tumors identifies ECM proteins characteristic of poorly and highly metastatic tumors.
Color code represents the number of unique peptides for each protein from poorly metastatic (MDA-MB-231) or highly metastatic (LM2) human mammary tumors. Values used to generate the figure were extracted from Figure 2—source data 1, columns P and AA (number of peptides). Grayed cells indicate that no peptides were detected in either of the two replicate samples. A dash (–) indicates that the protein was detected in only one of the two replicate samples of a given tumor type or with only one peptide in both replicate samples.DOI:
http://dx.doi.org/10.7554/eLife.01308.004
Complete MS data set of ECM-enriched fraction from MDA-MB-231 and LM2 human mammary tumor xenografts.
DOI:
http://dx.doi.org/10.7554/eLife.01308.005
Validation of the differential expression of proteins identified by proteomics.
(A) Immunoblots were performed on ECM-enriched fractions prepared from MDA-MB-231 or LM2 tumors to confirm the differential expression of some of the proteins identified by proteomics. (B) Immunohistochemistry was performed on MDA-MB-231 or LM2tumor sections to evaluate the expression and localization of LTBP3. LTBP3 is detected in LM2 but not MDA-MB-231tumors. Note the extracellular distribution of LTBP3. (C) RT-qPCR was used to monitor mRNA expression levels in LM2 tumors as compared to MDA-MB-231tumors and was conducted in triplicate in two independent tumors per tumor type. Bar charts represent normalized expression of the genes in LM2 tumors (black) as compared to MDA-MB-231tumors (gray). Actin expression was used to normalize RT-qPCR data. Data are presented as means ±SEM. (D) RNA was extracted from normal murine mammary gland (light grey) or from autochtonous murine mammary tumors (MMTV-PyMT transgenic mice: adenoma, dark grey or adenocarcinoma, black). RT-qPCR was conducted in triplicate. Bar charts represent normalized expression of the genes. Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM.DOI:
http://dx.doi.org/10.7554/eLife.01308.006
The tumor extracellular matrix is secreted by both tumor cells and stromal cells and differs with the tumor’s metastatic potential.
(A) Proteins expressed by both tumor types and by the same compartment in the two tumor types. (B) Proteins expressed by both tumor types but by different compartments. (C) Proteins secreted by MDA-MB-231tumors and not by LM2 tumors. (D) Proteins secreted by LM2 tumors and not by MDA-MB-231tumors. The number of peptides detected for each protein is indicated. For the proteins secreted by both the tumor cells and the stromal cells, the number of peptides listed corresponds to the number of human (tumor-derived)- or murine (stroma-derived)-specific peptides. For the proteins secreted by only one compartment, the number of peptides includes both species-specific and indistinguishable peptides. Proteins are sorted by tumor type and by their origins: tumor (red), stroma (blue), or both (yellow: similar abundance of the human and mouse proteins, orange: human form is at least five times more abundant than the mouse form, green: the mouse form is at least five times more abundant). To determine the relative contributions of the tumor and stromal cells to the secretion of ECM proteins, human-to-mouse peptide abundance ratios were calculated using the values indicated in column P and AB for the MDA-MB-231 and LM2 tumors respectively (Figure 3—source data 1). Proteins for which different isoforms have been detected are indicated with an asterisk (*) and, for simplicity, isoforms are combined here, their UniProt accession numbers can be found in Figure 3—source data 1, column AP. In a few instances, the origin of the protein could not be determined due to the lack of species-specific peptides; these proteins are indicated with a question mark (?).DOI:
http://dx.doi.org/10.7554/eLife.01308.007
Complete MS data set of ECM-enriched fraction from MDA-MB-231 and LM2 human mammary tumor xenografts taking into account the origin of matrisome proteins.
DOI:
http://dx.doi.org/10.7554/eLife.01308.008
Detailed list of all of the confidently identified peptide spectrum matches (PSMs) from the LC-MS/MS runs of the 11 fractions resulting from off-gel electrophoresis of each of the two MDA-MB-231 tumor replicates and each of the two LM2 tumor replicates.
The four tables containing all of the confidently identified peptide spectrum matches (PSMs) from the LC-MS/MS runs of the 11 fractions resulting from off-gel electrophoresis of each of the four tumorsamples can be downloaded from MassIVE (http://massive.ucsd.edu) using the identifier: MSV000078535. The file should be accessible at ftp://MSV000078535:a@massive.ucsd.edu/results.DOI:
http://dx.doi.org/10.7554/eLife.01308.009
Both the tumor- and stroma-derived ECM proteins differ with the tumor metastatic potential
A strength of human/mouse xenograft model systems coupled to mass spectrometry is that they allow the distinction of human (tumor-derived) protein sequences from their murine (stroma-derived) counterparts (Naba et al., 2012). Therefore we could determine the relative contributions of tumor and stromal cells to the production of the tumor ECM. We found that the tumor extracellular matrix is secreted by both tumor cells and stromal cells; some proteins are exclusively secreted by the tumor cells or the stromal cells; and some proteins are secreted by both compartments: either in equal proportions or more abundantly by the tumor cells or by the stromal cells (Figure 3, Figure 3—source data 1). We chose a conservative significance threshold of fivefold change in protein abundance, estimated as the summed precursor-ion intensity of the species-specific peptides. Because the tumor–stroma distinction relies on measurement of similar peptides of differing sequence (with accompanying mass differences), it is impractical to use more accurate mass spectrometric relative quantitation approaches that incorporate isotopic labels.The majority of proteins (82) found in the matrisomes of poorly and highly metastatic tumors are secreted by the same compartment in both tumor types (Figure 3A). As expected, ECM and ECM-associated proteins involved in hemostasis and found in the circulation are murine (fibrinogen chains: α, β, γ, plasminogen, thrombin [Factor 2], Factor XIII transglutaminase, vitronectin, etc). Structural collagens (collagens I and V) are also mostly secreted by the stroma. Components of the basement membranes were found to be expressed by the tumor cells only (laminin chains α3, β3, γ2), by both compartments (laminin chains α5, γ1, COL6A3, HSPG2) or by the stroma (Nidogens 1 and 2). In addition, 36 proteins were detected in both tumor types but their origin differed as a function of the tumor’s metastatic potential (Figure 3B). In poorly metastatic tumors, fibronectin (FN1) and periostin (POSTN) are secreted by the tumor cells, whereas in highly metastatic tumors, they are secreted by both the tumor cells and the stromal cells. Conversely, several basement membrane components (laminin chains β1 and β2, and the collagen chains 4A1, 4A5 6A1, 6A2 and 18A1) are secreted in poorly metastatic tumors mostly by the stroma, whereas in highly metastatic tumors, they are secreted by both the tumor cells and the stromal cells. As expected, many proteins specific to either poorly or highly metastatic tumors were secreted exclusively by the tumor cells. However, interestingly, we also observed that the stromal compartment also contributed to the differences detected (Figure 3C,D, Figure 3—source data 1). This indicates that tumor cells of differing metastatic potential not only synthesize distinct subsets of ECM proteins but also influence which ECM proteins are produced by the stroma.
Probing the tumor extracellular matrix reveals the activation of major signaling cascades
We sought to determine whether the expression of the ECM proteins characteristic of highly metastatic mammary tumors was controlled by common upstream regulators and whether, by probing the tumor ECM, we could identify signaling pathways contributing to tumor progression. To do so, we used Ingenuity Pathway Analysis (Figure 4—figure supplement 1). We found that 17 of the 43 (nearly 40%) ECM proteins found to be up-regulated in LM2 tumors are downstream of the TGFβ signaling pathway (Figure 4, left panel). The majority of these are tumor-derived, although several host proteins (C1qa, C1qc and Vwf) are also identified as being downstream of TGFβ. Interestingly, the LM2 cell line and its metastatic potential have previously been shown to be dependent on TGFβ (Minn et al., 2007).
Figure 4—figure supplement 1.
Ingenuity Pathway Analysis.
Identification of regulators (cytokines, growth factors, G-protein-coupled receptors, transcription regulators, or transmembrane receptors) controlling the expression of subsets of the 43 ECM genes characteristic of highly metastatic tumors was searched. Regulators upstream of at least three ECM genes are listed.
DOI:
http://dx.doi.org/10.7554/eLife.01308.011
Figure 4.
The TGFβ and the HIF1α/VEGF pathways are up-regulated in highly metastatic mammary tumors.
The 43 ECM and ECM-associated proteins (tumor- and/or stroma-derived) unique to highly metastatic mammary tumors were uploaded to the Ingenuity Pathway Analysis software and queried for common upstream regulators. The analysis revealed an enrichment of TGFβ and HIF1α/VEGF targets within our ECM signature of highly metastatic mammary tumors.
DOI:
http://dx.doi.org/10.7554/eLife.01308.010
Identification of regulators (cytokines, growth factors, G-protein-coupled receptors, transcription regulators, or transmembrane receptors) controlling the expression of subsets of the 43 ECM genes characteristic of highly metastatic tumors was searched. Regulators upstream of at least three ECM genes are listed.
DOI:
http://dx.doi.org/10.7554/eLife.01308.011
The TGFβ and the HIF1α/VEGF pathways are up-regulated in highly metastatic mammary tumors.
The 43 ECM and ECM-associated proteins (tumor- and/or stroma-derived) unique to highly metastatic mammary tumors were uploaded to the Ingenuity Pathway Analysis software and queried for common upstream regulators. The analysis revealed an enrichment of TGFβ and HIF1α/VEGF targets within our ECM signature of highly metastatic mammary tumors.DOI:
http://dx.doi.org/10.7554/eLife.01308.010
Ingenuity Pathway Analysis.
Identification of regulators (cytokines, growth factors, G-protein-coupled receptors, transcription regulators, or transmembrane receptors) controlling the expression of subsets of the 43 ECM genes characteristic of highly metastatic tumors was searched. Regulators upstream of at least three ECM genes are listed.DOI:
http://dx.doi.org/10.7554/eLife.01308.011One of the other signaling pathways significantly represented within our data set is the HIF1α/VEGF pathway that influences the levels of 10 of the 43 ECM proteins identified in our study (Figure 4, right panel). We also noted that there is a large overlap between the targets of TGFβ and HIF1α/VEGF as the genes identified as being downstream of the HIF1α/VEGF pathway are all also downstream of the TGFβ pathway. Interestingly, a recent publication by Curran and Keely highlights the convergence of TGFβ and HIF1α signaling pathways as a key contributor to the cross-talk between breast tumor cells and stromal cells (Curran and Keely, 2013). Altogether, this analysis indicates that by interrogating the tumor extracellular matrix, one can identify signaling pathways up-regulated within the tumor cells or stromal cells and these represent potential targets for therapeutic intervention.
Tumor-cell-derived ECM proteins influence the metastatic dissemination of tumor cells to distant organs
As noted above, several of the proteins up-regulated in LM2 tumors have previously been implicated in metastasis. We next wanted to evaluate whether other proteins found to be differentially expressed between poorly and highly metastatic tumors might play any causal, functional roles in tumor progression. Accordingly, we selected a set of proteins (LTBP3—Latent TGFβ Binding Protein 3; SNED1—Sushi, Nidogen and EGF-like Domains 1; EGLN1—Egl Nine homolog 1 and S100A2) based on the following criteria: they were (1) detected only in highly metastatic tumors; (2) secreted exclusively by the tumor cells; (3) in relatively high abundance (Figures 2 and 3D, Figure 2—source data 1, Figure 3—source data 1); (4) not previously investigated for any roles in metastasis. We focused on ECM proteins produced by the tumor cells as their expression can easily be manipulated in vitro. We also investigated the role of CYR61, a tumor-derived ECM protein detected in both MDA-MB-231 and LM2 tumors but with a much greater abundance in LM2 tumors (Figures 2 and 3, Figure 2—source data 1, Figure 3—source data 1). For proteins against which antibodies were available (LTBP3, EGLN1, and CYR61) we confirmed their differential expression by immunoblot and/or immunofluorescence analyses (Figure 2—figure supplement 1A,B). We also performed RT-qPCR analyses for several other proteins in our lists despite the fact that it is well known that mRNA levels and steady-state protein levels do not correlate at all well (Gygi et al., 1999). It can be seen that the mRNA changes for several of the proteins of interest (CYR61, EGLN1, LTBP3) do not show mRNA changes corresponding with the marked differences in protein levels detected, although some do (S100A2, SNED1) (Figure 2—figure supplement 1C). In addition, we show that Ltbp3 and Sned1 mRNAs are up-regulated during malignant progression in the autochthonous MMTV-PyMT murine mammary tumor model (Figure 2—figure supplement 1D).
Figure 2—figure supplement 1.
Validation of the differential expression of proteins identified by proteomics.
(A) Immunoblots were performed on ECM-enriched fractions prepared from MDA-MB-231 or LM2 tumors to confirm the differential expression of some of the proteins identified by proteomics. (B) Immunohistochemistry was performed on MDA-MB-231 or LM2 tumor sections to evaluate the expression and localization of LTBP3. LTBP3 is detected in LM2 but not MDA-MB-231 tumors. Note the extracellular distribution of LTBP3. (C) RT-qPCR was used to monitor mRNA expression levels in LM2 tumors as compared to MDA-MB-231 tumors and was conducted in triplicate in two independent tumors per tumor type. Bar charts represent normalized expression of the genes in LM2 tumors (black) as compared to MDA-MB-231 tumors (gray). Actin expression was used to normalize RT-qPCR data. Data are presented as means ±SEM. (D) RNA was extracted from normal murine mammary gland (light grey) or from autochtonous murine mammary tumors (MMTV-PyMT transgenic mice: adenoma, dark grey or adenocarcinoma, black). RT-qPCR was conducted in triplicate. Bar charts represent normalized expression of the genes. Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM.
DOI:
http://dx.doi.org/10.7554/eLife.01308.006
To address the roles of these proteins in tumor progression, we knocked down each of the five proteins selected for analysis in LM2 cells using short hairpins. As control, we used an shRNA targeting the firefly luciferase (sh-Cont.). For each gene of interest, two distinct hairpins giving efficient knockdown were selected (Figure 5—figure supplement 1). Control or knocked-down LM2 cells were orthotopically injected into the mouse mammary fat pad. At sacrifice (7 +/−0.5 weeks post-injection), the masses of the primary tumors were measured. We observed that none of the genes, when knocked down, significantly affected primary tumor growth (Figure 5A). Consistently, we also observed no differences in tumor cell proliferation or apoptosis between control and knockdown tumors (Figure 5—figure supplement 3). Importantly, the primary tumors (and the metastases deriving from them) were still ZsGreen-positive, indicating that the shRNA construct was still strongly expressed (Figure 5C). We also confirmed that the knockdowns persisted in vivo (Figure 5—figure supplement 2) and that there was no compensatory up-regulation of these genes by the stroma (data not shown). These data indicate that none of these genes is required for primary tumor growth.
Figure 5—figure supplement 1.
Establishment of stable LM2 knockdown cells.
RT-qPCR was used to monitor knockdown efficiency in cells in culture and was conducted for each cell line in triplicate on three independent sets of RNA collected at three consecutive cell passages. Bar charts represent normalized expression of the genes in knockdown cell lines relative to the control cell line (sh-Cont.). Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM. The two hairpins giving the most efficient knockdown are shown. When antibodies were available, knockdown efficiency was also monitored by immunoblotting (see CYR61 and EGLN1 panels).
DOI:
http://dx.doi.org/10.7554/eLife.01308.013
Figure 5.
Tumor-cell-derived ECM proteins influence the metastatic dissemination of tumor cells to distant organs.
Mice were injected orthotopically with control or knockdown LM2 cells. Tumors were allowed to grow for 7 ± 0.5 weeks. Number of mice per condition is indicated in Figure 5B. (A) ECM protein knockdown does not inhibit primary tumor growth. At sacrifice, control and knockdown primary tumors were weighed. Bar chart represents the mass of knockdown tumors as a percentage of that of control tumors ± SEM. Student’s t test was performed and none of the genes affected significantly and consistently primary tumor growth. (B) LM2 control tumors metastasize to the lungs, liver and spleen. The number of mice that presented with visible metastases in the indicated organs is indicated. (C) Representative pictures of whole left pulmonary lobe from LM2 (control or knockdown)-tumor-bearing mice with ZsGreen-positive metastatic foci. (D) Numbers of ZsGreen-positive metastatic foci in the left pulmonary lobe were counted. Data are presented as percentage of control ± SEM (Student’s t test, *p<0.05, and **p<0.01). Number of animals per group is indicated in Figure 5B. (E) Lung sections were stained with a human-specific anti-vimentin antibody to detect human tumor cells in the murine lung. (F) Alu PCR was performed on genomic DNA extracted from the lungs of control or knockdown tumor-bearing mice. Data are presented as normalized Alu signal as compared to murine actin signal and as percentage of control ± SEM (Student’s t test, *p<0.05, **p<0.01, ns: not significant, and nd: not determined). Number of animals per group is indicated in Figure 5B.
DOI:
http://dx.doi.org/10.7554/eLife.01308.012
RT-qPCR was used to monitor knockdown efficiency in cells in culture and was conducted for each cell line in triplicate on three independent sets of RNA collected at three consecutive cell passages. Bar charts represent normalized expression of the genes in knockdown cell lines relative to the control cell line (sh-Cont.). Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM. The two hairpins giving the most efficient knockdown are shown. When antibodies were available, knockdown efficiency was also monitored by immunoblotting (see CYR61 and EGLN1 panels).
DOI:
http://dx.doi.org/10.7554/eLife.01308.013
RT-qPCR was used to monitor knockdown persistence in tumors and was conducted on RNA extracted from individual control or knockdown tumors and in triplicate for each sample. Bar chart shows normalized expression of the genes in knockdown tumors relative to control tumors. Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM. The number of mice per group ranged from 3 to 13 and is indicated in Figure 5B.
DOI:
http://dx.doi.org/10.7554/eLife.01308.014
Primary tumor sections were stained with the anti-Ki67 antibody (A) to evaluate cell proliferation or anti-cleaved caspase 3 (B) to evaluate apoptosis. Knockdown of tumor cell-derived ECM proteins (CYR61, LTBP3, SNED1, EGLN1, or S100A2) did not affect tumor cell proliferation (Ki67 staining, A) or apoptosis (cleaved caspase 3, B).
DOI:
http://dx.doi.org/10.7554/eLife.01308.015
Figure 5—figure supplement 3.
Tumor-cell-derived ECM proteins do not influence proliferation or apoptosis of primary mammary tumors.
Primary tumor sections were stained with the anti-Ki67 antibody (A) to evaluate cell proliferation or anti-cleaved caspase 3 (B) to evaluate apoptosis. Knockdown of tumor cell-derived ECM proteins (CYR61, LTBP3, SNED1, EGLN1, or S100A2) did not affect tumor cell proliferation (Ki67 staining, A) or apoptosis (cleaved caspase 3, B).
DOI:
http://dx.doi.org/10.7554/eLife.01308.015
Figure 5—figure supplement 2.
Persistence of gene expression knockdown in tumors.
RT-qPCR was used to monitor knockdown persistence in tumors and was conducted on RNA extracted from individual control or knockdown tumors and in triplicate for each sample. Bar chart shows normalized expression of the genes in knockdown tumors relative to control tumors. Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM. The number of mice per group ranged from 3 to 13 and is indicated in Figure 5B.
DOI:
http://dx.doi.org/10.7554/eLife.01308.014
Tumor-cell-derived ECM proteins influence the metastatic dissemination of tumor cells to distant organs.
Mice were injected orthotopically with control or knockdown LM2 cells. Tumors were allowed to grow for 7 ± 0.5 weeks. Number of mice per condition is indicated in Figure 5B. (A) ECM protein knockdown does not inhibit primary tumor growth. At sacrifice, control and knockdown primary tumors were weighed. Bar chart represents the mass of knockdown tumors as a percentage of that of control tumors ± SEM. Student’s t test was performed and none of the genes affected significantly and consistently primary tumor growth. (B) LM2 control tumors metastasize to the lungs, liver and spleen. The number of mice that presented with visible metastases in the indicated organs is indicated. (C) Representative pictures of whole left pulmonary lobe from LM2 (control or knockdown)-tumor-bearing mice with ZsGreen-positive metastatic foci. (D) Numbers of ZsGreen-positive metastatic foci in the left pulmonary lobe were counted. Data are presented as percentage of control ± SEM (Student’s t test, *p<0.05, and **p<0.01). Number of animals per group is indicated in Figure 5B. (E) Lung sections were stained with a human-specific anti-vimentin antibody to detect humantumor cells in the murine lung. (F) Alu PCR was performed on genomic DNA extracted from the lungs of control or knockdown tumor-bearing mice. Data are presented as normalized Alu signal as compared to murine actin signal and as percentage of control ± SEM (Student’s t test, *p<0.05, **p<0.01, ns: not significant, and nd: not determined). Number of animals per group is indicated in Figure 5B.DOI:
http://dx.doi.org/10.7554/eLife.01308.012
Establishment of stable LM2 knockdown cells.
RT-qPCR was used to monitor knockdown efficiency in cells in culture and was conducted for each cell line in triplicate on three independent sets of RNA collected at three consecutive cell passages. Bar charts represent normalized expression of the genes in knockdown cell lines relative to the control cell line (sh-Cont.). Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM. The two hairpins giving the most efficient knockdown are shown. When antibodies were available, knockdown efficiency was also monitored by immunoblotting (see CYR61 and EGLN1 panels).DOI:
http://dx.doi.org/10.7554/eLife.01308.013
Persistence of gene expression knockdown in tumors.
RT-qPCR was used to monitor knockdown persistence in tumors and was conducted on RNA extracted from individual control or knockdown tumors and in triplicate for each sample. Bar chart shows normalized expression of the genes in knockdown tumors relative to control tumors. Actin expression was used to normalize RT-qPCR data. Data are presented as means ± SEM. The number of mice per group ranged from 3 to 13 and is indicated in Figure 5B.DOI:
http://dx.doi.org/10.7554/eLife.01308.014
Tumor-cell-derived ECM proteins do not influence proliferation or apoptosis of primary mammary tumors.
Primary tumor sections were stained with the anti-Ki67 antibody (A) to evaluate cell proliferation or anti-cleaved caspase 3 (B) to evaluate apoptosis. Knockdown of tumor cell-derived ECM proteins (CYR61, LTBP3, SNED1, EGLN1, or S100A2) did not affect tumor cell proliferation (Ki67 staining, A) or apoptosis (cleaved caspase 3, B).DOI:
http://dx.doi.org/10.7554/eLife.01308.015LM2 cells have been selected for their high metastatic potential and their tropism for the lungs (Minn et al., 2005). In our system, LM2 cells are injected in the absence of exogenous ECM support (Matrigel) in immunodeficientmice (NOD/SCID/IL2Rγ-null). We observed that the parental LM2 cells and the LM2 cells expressing the control hairpin, in addition to metastasizing to the lung, also could colonize the liver and the spleen from the primary site (Figure 5B). We thus wanted to evaluate the capacity of the knockdown tumors to metastasize from the primary site (mammary gland) to distant organs. Whereas knocking down CYR61, a protein that we detected by proteomics in both poorly and highly metastatic tumors, did not affect metastasis formation, knocking down any of the four genes characteristic of highly metastatic (LM2) tumors, and not detected in the poorly metastatic (MDA-MB-231) tumors, led to a significant decrease of the metastatic burden as compared with that of mice injected with control LM2 cells (Figure 5B). None of the SNED1 or EGLN1knockdown tumors disseminated to organs other than the lungs and the number of mice presenting visible lung metastases was dramatically decreased (Figure 5B). LTBP3 and S100A2 knockdown also led to a very significant inhibition of metastatic dissemination, although we detected occasional visible metastases in the liver or spleen of mice injected with LTBP3 or S100A2 knockdown cells (Figure 5B). Because of the pulmonary tropism of LM2 cells, we further analyzed the lungs of control or knockdown tumor-bearing mice. The analysis of the lungs of control or knockdown tumor-bearing mice for the presence or absence of ZsGreen-positive metastatic foci confirmed the significant decrease in the number of metastases formed by knockdown tumors (Figure 5B–D). As the tumor cells are human, we monitored the presence of human cells within murine lungs. We used a human-specific anti-vimentin antibody and Alu PCR to detect human genomic DNA and both methods confirmed the significantly decreased metastatic burden in knockdown-tumor-bearing mice as compared to control mice (Figure 5E,F). These results demonstrate that these four ECM proteins play significant functional roles in the metastatic dissemination of these mammary tumor cells.
Tumor cell-derived ECM proteins influence different steps of the metastatic cascade
Metastatic dissemination is a multistep process that requires tumor cells to proliferate, invade the surrounding host tissue, intravasate, survive in the circulation, extravasate and eventually seed and proliferate in distant organs. To pinpoint which steps of the metastatic cascade are influenced by each metastasis-associated ECM protein, we first compared the vascularization, invasiveness, and degree of fibrosis in control and knockdown primary tumors. Knock-down of any of the five ECM genes selected did not affect significantly primary tumor vascularization (Figure 6—figure supplement 1). Control tumors markedly invaded the skin (Figure 6) and the surrounding muscles (not shown), and were significantly fibrotic, as indicated by staining tumor sections with Masson’s Trichrome (Figure 6). Cells in which CYR61, EGLN1, or S100A2 were knocked down formed highly invasive (white arrow) and desmoplastic tumors resembling the control tumors, suggesting that these proteins did not influence tumor invasion or fibrosis (Figure 6). Interestingly, LTBP3 and SNED1knockdown tumors were characterized by deposition of collagen at the periphery of the tumor forming a thick capsule. Consistently, the LTBP3 and SNED1tumors failed to invade the surrounding tissues, suggesting that LTBP3 and SNED1 are promoters of tumor invasiveness.
Figure 6—figure supplement 1.
Tumor-cell-derived ECM proteins do not influence vascularization of primary mammary tumors.
Primary tumor sections were stained with an anti-CD31 (endothelial cell marker) to visualize tumor vasculature.
DOI:
http://dx.doi.org/10.7554/eLife.01308.017
Figure 6.
Tumor-cell-derived ECM proteins influence the invasiveness of primary mammary tumors.
Primary tumor sections were stained with Masson’s trichrome (blue: collagen fibers, red: cells) to evaluate fibrosis (indicated by vertical double-dashed line) and encapsulation (bracket) or invasiveness (white arrowhead) into the skin of the primary tumors. Note that tumors in which LTBP3 or SNED1 are knocked down are less invasive and more encapsulated than in the control tumors. CYR61, EGLN1, or S100A2 knockdown did not affect tumors’ invasiveness.
DOI:
http://dx.doi.org/10.7554/eLife.01308.016
Primary tumor sections were stained with an anti-CD31 (endothelial cell marker) to visualize tumor vasculature.
DOI:
http://dx.doi.org/10.7554/eLife.01308.017
Tumor-cell-derived ECM proteins influence the invasiveness of primary mammary tumors.
Primary tumor sections were stained with Masson’s trichrome (blue: collagen fibers, red: cells) to evaluate fibrosis (indicated by vertical double-dashed line) and encapsulation (bracket) or invasiveness (white arrowhead) into the skin of the primary tumors. Note that tumors in which LTBP3 or SNED1 are knocked down are less invasive and more encapsulated than in the control tumors. CYR61, EGLN1, or S100A2 knockdown did not affect tumors’ invasiveness.DOI:
http://dx.doi.org/10.7554/eLife.01308.016
Tumor-cell-derived ECM proteins do not influence vascularization of primary mammary tumors.
Primary tumor sections were stained with an anti-CD31 (endothelial cell marker) to visualize tumor vasculature.DOI:
http://dx.doi.org/10.7554/eLife.01308.017To test whether each metastasis-associated ECM protein influenced later steps of the metastatic cascade (survival in the circulation, extravasation and seeding, survival and proliferation in the lung), we injected the tumor cells directly into the circulation via the lateral tail vein. When injected into the blood circulation, control LM2 cells efficiently seeded and colonized the lungs and formed large metastases detectable by fluorescence (Figure 7A, upper panel), by staining lung sections with hematoxylin and eosin (Figure 7A, middle panel) or with an anti-humanvimentin antibody (Figure 7A, lower panel). Knockdown of EGLN1 or S100A2 strongly inhibited the formation of pulmonary metastases (Figure 7A–7C). In contrast, knockdown of LTBP3 or SNED1 in LM2 cells did not affect lung colonization (Figure 7A,B), consistent with our finding that these proteins influence tumor cell invasion at the primary site (Figure 6). Although LTBP3 knockdown gave rise to the same number of metastases, the metastases were significantly smaller (based on the size of the ZsGreen-positive foci) and consistently, the Alu PCR signal was significantly lower than in the control lungs (Figure 7C). Together, our data suggest that, although all these four proteins are required to increase metastasis formation, they do so by influencing different steps of the metastatic cascade. LTBP3 and SNED1 likely act early in the metastatic cascade by promoting tumor invasiveness. In addition, LTBP3, but not SNED1, appears to affect the growth of lung metastases. Our data also suggest that EGLN1 and S100A2 are likely to act at later stages of the metastatic cascade (extravasation, seeding, survival, and/or growth of the tumor cells in secondary sites) because, although the primary tumors are very invasive, they failed to colonize distant organs.
Figure 7.
Tail vein metastasis assay.
Control or knockdown cells were injected via the tail vein and the formation of lung metastases was evaluated. (A) Upper panel: representative pictures of the whole left pulmonary lobe with ZsGreen-positive metastatic foci from mice injected with LM2 (control or knockdown) cells (upper panel). Lung sections were stained with hematoxylin and eosin (H&E, middle panel) or with human-specific anti-vimentin antibody (lower panel) to visualize the metastatic foci. (B) Numbers of ZsGreen-positive metastatic foci in the left pulmonary lobe. Data are presented as percentage of control ± SEM (Student’s t test, *p<0.05, **p<0.01, ns: not significant). Number of animals per group: sh-Cont.: 17 mice, sh-LTBP3: 10 mice, sh-SNED1: 10 mice, sh-EGLN1: 8 mice, sh-S100A2: 8 mice. (C) Alu PCR was performed to monitor the presence of human tumor cells in the murine lung. Data are presented as percentage of control ± SEM (Student’s t test, *p<0.05, **p<0.01, ns: not significant). Number of animals per group: sh-Cont.: 17 mice, sh-LTBP3: 10 mice, sh-SNED1: 10 mice, sh-EGLN1: 8 mice, sh-S100A2: 8 mice.
DOI:
http://dx.doi.org/10.7554/eLife.01308.018
Tail vein metastasis assay.
Control or knockdown cells were injected via the tail vein and the formation of lung metastases was evaluated. (A) Upper panel: representative pictures of the whole left pulmonary lobe with ZsGreen-positive metastatic foci from mice injected with LM2 (control or knockdown) cells (upper panel). Lung sections were stained with hematoxylin and eosin (H&E, middle panel) or with human-specific anti-vimentin antibody (lower panel) to visualize the metastatic foci. (B) Numbers of ZsGreen-positive metastatic foci in the left pulmonary lobe. Data are presented as percentage of control ± SEM (Student’s t test, *p<0.05, **p<0.01, ns: not significant). Number of animals per group: sh-Cont.: 17 mice, sh-LTBP3: 10 mice, sh-SNED1: 10 mice, sh-EGLN1: 8 mice, sh-S100A2: 8 mice. (C) Alu PCR was performed to monitor the presence of humantumor cells in the murine lung. Data are presented as percentage of control ± SEM (Student’s t test, *p<0.05, **p<0.01, ns: not significant). Number of animals per group: sh-Cont.: 17 mice, sh-LTBP3: 10 mice, sh-SNED1: 10 mice, sh-EGLN1: 8 mice, sh-S100A2: 8 mice.DOI:
http://dx.doi.org/10.7554/eLife.01308.018
Tumor-derived ECM proteins may have prognostic value for some breast cancer patients
In addition to providing novel insights into the biology of breast cancer progression, we sought initial indications that any of the ECM proteins identified here by proteomics and shown to play causal roles in mammary carcinoma progression, might correlate with clinical outcome in breast cancerpatients. Since equivalent proteomic data are not yet available for humanpatient material, we could only make comparisons with mRNA expression data, even though we know that correlation between protein and mRNA levels is known to be loose. We used Kaplan–Meier Plotter (Györffy et al., 2010), an online-available meta-analysis tool for biomarker assessment. Using this tool, we tested whether the mRNA expression of any of the four genes we studied correlated with distant-metastasis-free survival for breast cancerpatients. While expression levels for SNED1 and LTBP3 were not significantly correlated across all mammary cancer sub-types (Figure 8, right panels), they were significantly correlated (p values of 0.0079 and 0.034, respectively) with poor prognosis for estrogen-receptor-negative and progesterone-receptor-negative (ER−/PR−) patients (Figure 8, left panels). In this context, it is significant that the MDA-MB-231 cells were isolated from the pleural effusion of a triple-negative breast cancerpatient (Cailleau et al., 1978). While we are not suggesting that the correlations between the expression of two ECM proteins and probability of metastasis in a limited subset of cancerpatients is currently of predictive value, this analysis demonstrates that we can identify within our proteomics signatures, a subset of ECM proteins that are pro-metastatic in model systems and may have potential as prognostic biomarkers and are worthy of further investigation.
Figure 8.
Correlation between SNED1 and LTBP3 expression and distant-metastasis-free survival in breast cancer patients.
We tested the predictive value of the four ECM genes studied using the online assessment tool Kaplan–Meier Plotter. Whereas the expression of none of the genes studied correlated with distant metastasis-free survival for the entire population of breast cancer patients, SNED1 and LTBP3 expression inversely correlated with the survival of estrogen-receptor-negative and progesterone-receptor-negative (ER−/PR−) breast cancer patients.
DOI:
http://dx.doi.org/10.7554/eLife.01308.019
Correlation between SNED1 and LTBP3 expression and distant-metastasis-free survival in breast cancer patients.
We tested the predictive value of the four ECM genes studied using the online assessment tool Kaplan–Meier Plotter. Whereas the expression of none of the genes studied correlated with distant metastasis-free survival for the entire population of breast cancerpatients, SNED1 and LTBP3 expression inversely correlated with the survival of estrogen-receptor-negative and progesterone-receptor-negative (ER−/PR−) breast cancerpatients.DOI:
http://dx.doi.org/10.7554/eLife.01308.019
Discussion
We demonstrate in this study that a proteomics-based discovery approach can define ECM signatures of tumors of differing metastatic potential. We show that the tumor ECM is derived from both the tumor and stromal cells and that tumors of differing metastatic potential differ in both the tumor- and stroma-derived ECM. Our study led to the identification of tumor-derived ECM proteins that play functional roles in tumor progression and metastatic dissemination. Indeed, a high proportion of the proteins we detected as up-regulated in highly metastatic tumors (some reported previously, some new to this study) contribute to metastatic dissemination. We further demonstrate that these proteins can affect different steps of the metastatic cascade: LTBP3 and SNED1 appear to promote early stages of invasion and dissemination, whereas EGLN1 and S100A2 act at later stages of the metastatic cascade. Finally, using gene expression data sets from breast cancerpatients, we show that some of the proteins discovered by proteomics as differentially expressed are correlated with breast cancerpatient outcomes. We studied in detail five ECM or ECM-associated proteins not previously clearly implicated in metastasis and demonstrate that four out of five of these proteins play roles at different steps of the metastatic cascade.CYR61 was detected in both poorly and highly metastatic tumors but with a greater abundance in highly metastatic tumors. Previous studies had reported the up-regulation of CYR61 in more aggressive tumor cell lines or lesions (Tsai et al., 2000, 2002). Our study demonstrates that although produced in greater abundance by highly metastatic tumors, CYR61 is not necessary to promote metastatic dissemination as knocking down its expression did not have any effect on the metastatic dissemination of LM2 cells.Consistent with the role of TGFβ in cancer progression (Padua and Massagué, 2009; Massague, 2012), we show that LTBP3, a protein that regulates TGFβ secretion and bioavailability (Chen et al., 2002; Munger and Sheppard, 2011) promotes primary tumor invasion and metastasis. LTBP3 is also a protein that contributes to the formation of the fibrillar ECM network (Ramirez and Rifkin, 2009; Todorovic and Rifkin, 2012). Thus, whether LTBP3 contributes to tumor progression because of its signaling role or its architectural role remains to be elucidated. Of note, LTBP3 is a member of a family of proteins and the three other members of the family; LTBP1, LTBP2 and LTBP4 were all detected in the matrisome of both poorly and highly metastatic tumors, LTBP1 and 4 being expressed by the tumor cells and not the stromal cells and LTBP2 being expressed by both the tumor cells and stromal cells (Figures 2 and 3, Figure 2—source data 1, Figure 3—source data 1).SNED1 (Sushi, Nidogen, and EGF-like Domains 1) is a large ECM glycoprotein first identified as a potential component of the basement membrane (Leimeister et al., 2004) whose roles in normal physiology and pathology remain to be characterized. In this study, we report for the first time a functional role for SNED1 in tumor progression and metastasis and we now wish to understand the molecular mechanisms by which SNED1 contributes to tumor progression. Interestingly, SNED1 displays two potential integrin-binding sites, an RGD motif is found upstream of the amino-terminal NIDO domain and an LDV motif is upstream of the first EGF domain.EGLN1 (also known as PHD2, Prolyl Hydroxylase Domain-containing protein 2) is a prolyl-hydroxylase and, in normoxic conditions, catalyzes the hydroxylation of proline residues of the hypoxia-inducible factor 1 α (HIF1α), rendering it susceptible to poly-ubiquitinylation and subsequent proteasomal degradation (Berra et al., 2003). Klotsche-van Ameln et al. have reported that inhibiting EGLN1 had an anti-tumor effect by enhancing TGFβ anti-proliferative effect in a model of murineosteosarcoma (Klotzsche-von Ameln et al., 2011). However, the extracellular role of this protein remains unknown.S100A2 is a calcium-binding protein that belongs to the S100 family of acute-phase response factors and, when overexpressed in non-small-cell lung carcinoma cells subsequently injected subcutaneously in mice, has been shown to promote metastasis to the lungs (Bulk et al., 2009). The fact that we observed a decrease in the number of metastases formed by cells in which S100A2 was knockeddown, both when the cells were injected orthotopically and metastasized from the primary tumor and when the cells were injected in the circulation, suggests that S100A2 is important for the growth of tumor cells in distant organs, in particular the lungs.The proteomics-based discovery pipeline we developed identified, with high yield, proteins playing a causal role in tumor progression and metastatic dissemination. Indeed, in addition to the four proteins whose involvement in mammary carcinoma metastasis we report here, previous studies using various mammary carcinoma cell lines or tumor models had already implicated several other proteins in breast cancer progression (ANGPTL4, CTSB, IGFBP4, LOXL2) or invasiveness of breast tumor cells (ADAM9, ADAM10). In addition, analyses by Kaplan–Meier Plotter (Györffy et al., 2010) show that several proteins from our list of ECM proteins up-regulated in highly metastatic LM2 cells (ADAM9, LOXL2, S100A2; data not shown) show statistically significant correlations with poor prognosis for metastasis-free survival of breast cancerpatients. Thus, in total, from the list of 43 ECM proteins that we find expressed only in the metastatic LM2 cells and not in MDA-MB-231, 12 show suggestive evidence of functional involvement in metastasis of breast cancer. Also included are proteins previously implicated in tumor progression in other cancer types (e.g., CTGF, TIMP1, S100A10) and proteins that we have identified in proteomics screens of other tumor models (unpublished data). These concordances indicate that the proteins we identify here are relevant to breast cancer metastasis and their significance is likely not limited solely to the breast cancer lines we used in this study.To determine whether these proteins are regulated independently or might be coregulated, we conducted pathway analysis. Two main pathways, the TGFβ pathway and the HIF1α/VEGF pathway, appeared to be upstream of several of the proteins we identified. In addition to signal transduction pathways, microRNAs are another mechanism by which cells can rapidly control the expression or inhibition of sets of genes. Korpal et al. have identified in breast cancerpatients the miR-200 family as being pro-metastatic via its inhibition of Sec23a, a protein involved in the secretion machinery (Korpal et al., 2011). Interestingly, several of the proteins we found to be up-regulated in highly metastatic tumors (AGRN, LTBP3, EFEMP2, IGFBP4, SERPINE2, SNED1 and TINAGL1) were shown in the Korpal study to be down-regulated in the conditioned medium of Sec23a knockdown cells and were thus postulated to be anti-metastatic. However, our study indicates that this set of proteins is pro-metastatic, which could point towards tumor-specific or context-dependent mechanisms of action for these proteins.Our study also revealed that not only the production of tumor-derived ECM proteins changes with a tumor’s metastatic potential but the stromal contribution to the tumor ECM also changes. This is consistent with the idea that the composition of the stroma (possibly including the cell types present) of a non-metastatic primary tumor differs from that of a highly metastatic primary tumor and that tumor cells of different metastatic potential may recruit different stromal cell types. In fact, we have observed that LM2 tumors are more vascularized than the MDA-MB-231tumors (data not shown). Our data also suggest that tumor cells of different metastatic potential can instruct local stromal cells to express different sets of ECM proteins. This interesting aspect of tumor–stroma interactions has not been extensively studied in vivo, although a recent paper notes that cancer-associated fibroblasts from different mammary tumor subtypes differ in their expression profiles (Tchou et al., 2012).Finally, we believe that our approach offers the possibility of identifying proteins of clinical relevance. We showed that LTBP3 and SNED1, identified by proteomics in our study as differentially expressed between poorly and highly metastatic mammary tumors, correlate at the transcript level with clinical outcome in a cohort of ER−/PR− breast cancerpatient. We can envision three ways in which one could exploit the ECM to improve cancer diagnosis and prognosis and improve cancerpatient care. As demonstrated for SNED1 and LTBP3, other proteins that are part of the proteomic signatures of highly and poorly metastatic breast tumors described here, may prove to correlate with patient outcomes and may prove useful as novel prognostic and diagnostic biomarkers. Development of immuno- or mass spectrometry-based assays (Gillette and Carr, 2013) for these proteins is therefore of interest since protein-level measurements may be of equivalent or greater predictive value than RNA expression analyses. This will require development of panels of specific antibodies against the ECM proteins of interest and their testing on larger numbers of well annotated patientsamples to establish correlations with tumor stage and patient outcomes. ECM proteins are particularly favorable candidate biomarkers since they are abundant, are laid down in characteristic patterns and are readily accessible. ECM proteins can also serve as anchors to deliver selectively to tumors and/or metastases imaging probes to enhance the detection of metastases or anti-tumor agents to enhance therapy on the model of the work pioneered by Neri et al. (Pasche and Neri, 2012). Finally, another possible translational aspect is the identification of potential novel direct therapeutic targets. Whether by targeting the interactions between ECM proteins and their cellular receptors (Goodman and Picard, 2012) or by disrupting the architecture of the ECM (that acts as a barrier) to allow more efficient drug delivery (Yuan et al., 2007; Whatcott et al., 2011; Jacobetz et al., 2013), the proteins discovered in our differential proteomics-based approach have the potential to serve as novel anticancer therapeutic targets.
Materials and methods
Cells
The human mammary carcinoma cells, MDA-MB-231, and their highly metastatic variant MDA-MB-231_LM2 (LM2) were a kind gift of Dr Joan Massague (Memorial Sloan Kettering Cancer Center, New York, NY). The cells were grown in HyClone high-glucose Dulbecco’s modified Eagle’s medium (Thermo Scientific, Pittsburgh, PA) supplemented with 2 mM glutamine and 10% fetal bovine serum (Invitrogen, Carlsbad, CA) at 37°C in a 5% CO2 incubator.
Orthotopic human mammary tumor cell xenografts
Tumor growth and spontaneous metastasis formation were assayed by transplanting tumor cells orthotopically into the mammary fat pad of 6 to 8-week-old female NOD/SCID/IL2Rγ-null mice (Jackson Laboratory, Bar Harbor, ME). The mice were anesthetized by intraperitoneal (IP) injection of 125–250 mg/kg body weight of Avertin (reconstituted in PBS), followed by IP injection of 100 μl of 12 μg/ml Buprenorphine for analgesia. A small incision was made in the right flank to expose the inguinal mammary gland, and 2.5.105 cells in suspension in 25 μl of Hank’s Balanced Salt Solution (Invitrogen, Carlsbad, CA) were injected. The mice received three additional IP injections of 100 μl of 12 μg/ml Buprenorphine at 12-hr intervals following the surgery. Surgery and mouse monitoring were performed according to the animal protocol approved by MIT’s Department of Comparative Medicine and Committee on Animal Care. Animals were sacrificed 7 ± 0.5 weeks post-injection and the tumors were dissected and weighed, flash frozen and kept at −80°C or fixed in 3.8% formaldehyde, imaged with a fluorescence microscope and subsequently embedded in paraffin and sectioned. In addition, secondary tumor sites (lung, liver, spleen) were collected and fixed in 3.8% formaldehyde for subsequent embedding in paraffin and sectioning.
Experimental lung metastasis assay
5.104 cells in 100 μl of Hank’s Balanced Salt Solution were injected into the lateral tail vein of 6- to 8-week-old female NOD/SCID/IL2Rγ-null mice. The mice were sacrificed 4 weeks post-injection and lungs were inflated with 3.8% formaldehyde imaged with a fluorescence microscope and subsequently fixed overnight with 3.8% formaldehyde. Samples were kept in 70% ethanol prior to embedding and sectioning.
Quantification of metastases
ZsGreen-positive foci were counted in the left pulmonary lobe using the open-source software Cell Profiler 2.0 (Lamprecht et al., 2007; http://www.cellprofiler.org/) and counts were manually curated when needed. The Cell Profiler pipeline developed for this study is provided as a .cp file (Supplementary file 1). Student’s t test was performed to evaluate the statistical significance of the results.
Tissue preparation and ECM protein enrichment
Sequential extractions of proteins from frozen tumorsamples were performed using the CNMCS (Cytosol/Nucleus/Membrane/Cytoskeleton) compartmental protein extraction kit (Cytomol, Union City, CA) as previously described (Naba et al. 2012). This led to the extraction of intracellular soluble proteins and the enrichment of ECM proteins.
ECM-enriched fraction solubilization and digestion
Two independent biological replicates of each tumor type (MDA-MB-231 or LM2) were analyzed. The ECM-enriched samples from each tumor were subsequently analyzed by mass spectrometry.100–300 µg ECM-enriched pellets were solubilized and reduced in a solution of 8M urea, 100 mM ammonium bicarbonate pH 8, 10 mM dithiothreitol, and incubated at 37°C for 30 min with continuous vortexing. After cooling to room temperature, cysteines were alkylated by adding iodoacetamide to 25 mM for 30 min. After diluting to 2M urea with 100 mM ammonium bicarbonate pH 8.0, samples were deglycosylated with 1000–2000 units of PNGaseF (New England BioLabs, Ipswich, MA) and incubated at 37°C for 2 hr with continuous vortexing, followed by digestion with Lys-C (Wako Chemicals USA, Inc., Richmond, VA), at a ratio of 1:100 enzyme:substrate, with for 2 hr. Final digestion was done using trypsin (Sequencing Grade, Promega, Madison, WI), at a ratio of 1:50 enzyme:substrate at 37°C overnight with continuous vortexing, followed by a second aliquot of trypsin, at a ratio of 1:100 enzyme:substrate, and an additional 2 hr of incubation. Solutions that began cloudy upon initial reconstitution were clear after overnight digestion. Samples were acidified and desalted using 10 mg HLB Oasis Cartridges (Waters Corp., Milford, MA) eluted with 60% acetonitrile, 0.1% trifluoroacetic acid (TFA), followed by concentration in a Speed-Vac.
Peptide fractionation by off-gel electrophoresis
Approximately, 50 µg samples of peptide digest were fractionated using an Agilent 3100 OFFGEL Fractionator (Agilent Technologies, Wilmington, DE) and 13 cm Immobiline Drystrips pH 3–10 (GE Healthcare BioSciences AB, Uppsala, Sweden, 17-6001-14). Fractionation was performed according to the Agilent instruction manual. Briefly, peptides were diluted in IPG buffer, pH 3–10 (GE Healthcare, 17-6000-87), containing 5% glycerol. 150 µl of peptide solution were loaded into each of 12 wells and focused for 20 kV hr with a maximum current of 50 µA and power of 200 mW (24–36 hr). Focused solutions were pipetted out of each well and the wells were re-extracted with 30% acetonitrile/0.1% TFA. Fractions 9 and 10 were combined, yielding 11 total fractions for subsequent LC-MS/MS analysis. Fractions were acidified with TFA, cleaned-up using stage tips, that is, pipette tips packed with reversed-phase membrane disks (Empore C-18 #2215, 3M Corporation, St Paul, MN), eluted with 60% acetonitrile, 0.1% TFA, and then concentrated in a Speed-Vac (Rappsilber et al., 2003).
Mass spectrometry
Tryptic digests were analyzed with an automated nano LC-MS/MS system, consisting of an Agilent 1100 nano-LC system (Agilent Technologies, Wilmington, DE) coupled to either an LTQ-Orbitrap or an LTQ Orbitrap XL Fourier transform mass spectrometer (Thermo Fisher Scientific, San Jose, CA) equipped with a nanoflow ionization source (James A Hill Instrument Services, Arlington, MA). Peptides were eluted from a 10-cm column (Picofrit 75 um ID, New Objectives) packed in-house with ReproSil-Pur C18-AQ 3 μm reversed phase resin (Dr Maisch, Ammerbuch Germany) using either a 120 min gradient at a flow rate of 200 nl/min to yield ∼20 s peak widths. Solvent A was 0.1% formic acid and solvent B was 90% acetonitrile/0.1% formic acid. The elution portion of the LC gradient was 3–6% solvent B in 2 min, 6–31% B in 75 min, 31–60% B in 13 min, 60–90% B in 1 min, and held at 90% B for 5 min. Data-dependent LC-MS/MS spectra were acquired in ∼3 s cycles; each cycle was of the following form: one full Orbitrap MS scan at 60,000 resolution followed by 8 MS/MS scans in the ion trap on the most abundant precursor ions using an isolation width of 3 m/z. Dynamic exclusion was enabled with a mass width of ± 25 ppm, a repeat count of 1 and an exclusion duration of 45 s. Charge-state screening was enabled along with monoisotopic precursor selection and non-peptide monoisotopic recognition to prevent triggering of MS/MS on precursor ions with unassigned charge or a charge state of 1. Normalized collision energy was set to 30 with an activation Q of 0.25 and activation time of 30 ms.
Protein identification, quantitation, and distinction between mouse (stroma) and human (tumor) proteins
All MS data was interpreted using the Spectrum Mill software package v4.1 beta (Agilent Technologies, Santa Clara, CA). Similar MS/MS spectra acquired on the same precursor m/z within ± 60 s were merged, MS/MS spectra with precursor charge >4 and poor quality MS/MS spectra, which failed the quality filter by not having a sequence tag length >0 (i.e., minimum of two masses separated by the in-chain mass of an amino acid) were excluded from searching. MS/MS spectra were searched against a UniProt database containing both human (78,369 entries) and mouse (53,448 entries) sequences. All sequences (including isoforms and excluding fragments) were downloaded from the UniProt website on 30 June 2010. To each database a set of common laboratory contaminant proteins (73 entries) was appended. Initial search parameters included: ESI linear ion-trap scoring parameters, trypsin enzyme specificity with a maximum of two missed cleavages, 35% minimum matched peak intensity, ± 20 ppm precursor mass tolerance, ± 0.7 Da product mass tolerance, and carbamidomethylation of cysteines and possible carbamylation of N-termini as fixed/mix modifications. Allowed variable modifications were oxidized methionine, deamidation of asparagine, pyro-glutamic acid modification at N-terminal glutamine, and hydroxylation of proline with a precursor MH + shift range of −18 to 97 Da. Hydroxyproline was only observed in the proteins known to have it (collagen and proteins containing collagen domains; emilins, etc) and only within the expected GXPG sequence motifs. Figure 3—source data 2 containing the detailed peptide spectral matches might have some examples not in the expected motif when there is either a proline near the motif for which the spectrum could have had insufficient fragmentation to confidently localize the mass change to a particular residue, or a nearby methionine in the peptide and the spectrum had insufficient fragmentation to localize the mass change to oxidized methionine or hydroxyproline. When the motif nX[ST] occurs in a peptide in Figure 3—source data 2, this is likely to indicate a site where N-linked glycosylation was removed by the PNGaseF treatment of the sample. While a lowercase n indicates a gene-encoded asparagine residue detected in aspartic acid form, possible mechanisms of modification such as acid-catalyzed deamidation during sample processing vs enzymatic conversion during deglycosylation cannot be explicitly distinguished. Identities interpreted for individual spectra were automatically designated as confidently assigned using the Spectrum Mill autovalidation module to apply target-decoy-based, false-discovery rate (FDR) scoring threshold criteria via a two-step auto-threshold strategy at the spectral and protein levels. First, peptide mode was set to allow automatic variable range precursor mass filtering with score thresholds optimized to yield a spectral level FDR of 1.6% for each of the precursor charge states 2, 3, and 4 in each LC-MS/MS run. Second, protein mode was applied to further filter all the peptide-level validated spectra combined from the 22 LC-MS/MS runs from both replicates of an experiment using a minimum protein score of 20 and a maximum protein-level FDR of zero. Since the maximum peptide score is 25, the protein-level step filters the results so that each identified protein is comprised of multiple peptides unless a single excellent scoring peptide was the sole match. The above criteria yielded false discovery rates of <1.0% for each sample at the peptide–spectrum match level and <1.2% at the distinct peptide level as estimated by target-decoy-based searches using reversed sequences. In calculating scores at the protein level and reporting the identified proteins, redundancy is addressed in the following manner: the protein score is the sum of the scores of distinct peptides. A distinct peptide is the single highest scoring instance of a peptide detected through an MS/MS spectrum. MS/MS spectra for a particular peptide may have been recorded multiple times, (i.e., as different precursor charge states, isolated from adjacent OGE fractions, modified by deamidation at Asn or oxidation of Met) but are still counted as a single distinct peptide. When a peptide sequence >8 residues long is contained in multiple protein entries in the sequence database, the proteins are grouped together and the highest scoring one and its accession number are reported. In some cases, when the protein sequences are grouped in this manner there are distinct peptides which uniquely represent a lower scoring member of the group (isoforms, family members, and different species i.e., mouse vs human). Each of these instances spawns a subgroup and multiple subgroups are reported and counted towards the total number of proteins and in Figure 3—source data 1, they are given related protein subgroup numbers (see column AQ and AR I Figure 3—source data 1A, e.g., Tenascin C (TNC), the murine and human forms and are listed as subgroup members 25.1 and 25.2 respectively). Our in silico matrisome list was then used to categorize all of the identified protein subgroups as being ECM-derived or not. The reporting of the number of peptides contributing to each subgroup can be altered by enabling the subgroup-specific option in Spectrum Mill. This was done to report separately the species-specific peptides, the peptides common to both human and mouse, and the total of common and species-specific peptides.Relative abundances of proteins were determined using either the number of peptides or using the peptide abundance (see legends for Figures 2 and 3). When we sought to determine the relative abundance of human-derived and murine-derived proteins, we used extracted ion chromatograms (XIC’s) for each peptide precursor ion in the intervening high resolution FT-MS scans of the LC-MS/MS runs. An individual protein’s abundance was calculated as the sum of the ion current measured for all quantifiable peptide precursor ions with MS/MS spectra confidently assigned to that protein. Peptides were considered not quantifiable if they were shared across multiple subgroups of a protein or the precursor ions had a poorly defined isotope cluster (i.e., the subgroup-specific and exclude poor isotope quality precursor XIC’s filters in Spectrum Mill were enabled). Proteins were considered quantifiable if they were represented in two independent samples and represented by at least two distinct peptides in one of the two samples. The peak area for the XIC of each precursor ion subjected to MS/MS was calculated automatically by the Spectrum Mill software in the intervening high-resolution MS1 scans of the LC-MS/MS runs using narrow windows around each individual member of the isotope cluster. Peak widths in both the time and m/z domains were dynamically determined based on MS scan resolution, precursor charge and m/z, subject to quality metrics on the relative distribution of the peaks in the isotope cluster vs theoretical. Although the determined protein ratios are generally reliable to within a factor of twofold of the actual ratio, numerous experimental factors contribute to variability in the determined abundance for a protein. These factors may include incomplete digestion of the protein; widely varying response of individual peptides due to inherent variability in ionization efficiency and interference/suppression by other components eluting at the same time as the peptide of interest, differences in instrument sensitivity over the mass range analyzed, and inadequate sampling of the chromatographic peak between MS/MS scans.The original mass spectra may be downloaded from MassIVE (http://massive.ucsd.edu) using the identifier: MSV000078535. The data should be accessible in the ‘Spectrum’ folder at ftp://MSV000078535:a@massive.ucsd.edu.
Gene knock-down, reverse transcription, and quantitative real-time PCR
97-nucleotide miR30-based shRNAs targeting each gene of interest (Supplementary file 2) were designed using the shRNA design software available through the Cold Spring Harbor Laboratory website (http://katahdin.mssm.edu/siRNA/RNAi.cgi?type=shRNA), and cloned into the MSCV-ZSG-2A-Puro-miR30 vector retroviral vector as described previously (Stern et al., 2008; Lamar et al., 2012). This vector expresses the miR30-based shRNA in the 3’UTR of a single transcript encoding the ZsGreen reporter gene and the puromycin-resistance gene. Retroviruses were packaged in 293FT cells and LM2 cells were transduced as previously described (Stern et al., 2008; Lamar et al., 2012). For qPCR, RNA was isolated from cell or tumor lysates using RNeasy kit (Qiagen, Germantown, MD) and cDNA was synthesized by reverse transcription using the First-Strand cDNA Synthesis Kit (Promega, Madison, WI). qPCR reactions were performed using Bio-RadSYBR Green Supermix (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. PCR conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 20 s, 58°C for 30 s, and 72°C for 30 s. qPCR data analysis was performed using Bio-Rad CFX Manager Software. Human and murine PCR primers used are listed in Supplementary file 3.
Immunohistochemistry
Tumorsamples were formaldehyde-fixed and paraffin-embedded. Sections were dewaxed and rehydrated following standard procedures. When required, heat-induced epitope retrieval was performed by incubating sections in 10 mM sodium citrate buffer (pH6.0) heated at 95°C for 20 min. Sections were cooled down at room temperature and were then stained using appropriate Vectastain ABC kits (Vector Laboratories, Burlingame, CA). Primary antibodies used were: mouse anti-humanvimentin antibody (Leica, Davie, FL), mouse anti-Ki67 antibody (Vector Laboratories), rabbit anti-cleaved caspase 3 (Cell Signaling, Danvers, MA), rabbit anti-CD31 (PECAM) antibody (Abcam, Cambridge, MA), rabbit anti-LTBP3 (Santa Cruz Biotechnology, Dallas, TX), Sections were subsequently counterstained with methyl green or hematoxylin. Hematoxylin and eosin and Masson’s trichrome stainings were performed following standard procedures.
Immunoblotting
Tumorsamples were lysed in Laemmli buffer, proteins were separated by SDS-PAGE and immunoblotting was performed using the following antibodies: rabbit anti-collagen I (Millipore, Billerica, MA), mouse anti-transferrin receptor (Invitrogen), mouse anti-GAPDH (Millipore), rabbit anti-LTBP3 (Santa Cruz Biotechnology), rabbit anti-EGLN1 (Cell Signaling), the rabbit anti-actin antibody was generated in the laboratory. The rabbit anti-CYR61 antibody was a kind gift of Dr Lester Lau.
Alu PCR
DNA was extracted from formaldehyde-fixed and paraffin-embedded tissues using the QIAamp DNA FFPE Tissue Kit (Qiagen). Quantitative PCR was conducted on 1 ng of genomic DNA. Primers used are: Alu Forward: 5′GTGAAACCCCGTCTCTACTAAAAATACAAA3′, Alu Reverse: 5′GCGATCTCGGCTCACTGCAA3′. qPCR reactions were performed using Bio-RadSYBR Green Supermix (Bio-Rad) according to the manufacturer’s instructions. PCR conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 20 s, 58°C for 30 s, and 72°C for 30 s qPCR data analysis was performed using Bio-Rad CFX Manager Software. Murine actin served as a reference to normalize qPCR data.
Data mining
Ingenuity Pathway Analysis (http://www.ingenuity.com/products/ipa) was used to identify common upstream regulators (‘Results’). Kaplan–Meier Plotter (http://www.kmplot.com/), an online-available meta-analysis tool (Györffy et al., 2010), was used to test possible correlations between expression of the genes encoding proteins identified by proteomics in our study (‘Results’) with distant metastasis-free survival. We interrogated the data from all patients or only the subset of estrogen-receptor-negative and progesterone-receptor-negative patients included on the multiple clinical data sets available.eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.Thank you for sending your work entitled “Extracellular matrix signatures of human mammary carcinoma identify novel metastasis promoters” for consideration at eLife. Your article has been evaluated by a Senior editor and 4 reviewers, one of whom is a member of our Board of Reviewing Editors, and one of whom, Joan Brugge, has agreed to reveal her identity.All four of your reviewers agree that the work is of high quality and comes to a number of interesting and important conclusions that highlight the importance of ECM proteins in tumor progression. However, we are concerned that the conclusions made about the potential role of these ECM proteins as regulators of metastasis in humanbreast cancer are not currently well supported by the experiments. The consensus is that there are several major concerns that currently pose a barrier to publishing in eLife.1) One of the greatest and nearly unanimous concerns is the use of a single pair of cultured cell lines (one cell type) of “normal and cancer states” (derived from a single patient). The consensus is that this is simply not enough to judge whether the findings are at physiologically relevant and functionally significant and how broadly applicable the results might be. The cell lines used were manipulated extensively and passaged through mice several times, which further compounds the problems/caveats. A related issue is whether the differences in overall matrisome and in the five ECM proteins tested truly represent differences between mammary tumors and lung metastases, as you hope is the case, or whether they represent ECM differences between tumors that are initiated with 250,000 cells implanted at once versus tumors that are initiated by circulating cells that reach the lungs over time singly or as very small clusters. Since mammary tumors are among the few that can be successfully initiated at the near single cell level, the recommendation to re-visit matrisome results (at least the key differentially expressed proteins identified) on mammary tumors initiated with just a few cells instead of the 250,000.2) Another broadly shared criticism is that xenograft studies are not sufficient to draw conclusions about humantumors. As pointed out, expression of these ECM proteins in humantumors of different metastatic potential is a necessity to generalize about the relevance to breast cancer. It will also be important to demonstrate that tumors with the same metastatic potential show similar ECM composition.3) One reviewer raises a concern that most of the proteins that showed differential expression and all of the ones chosen for functional studies had relatively few peptides in the proteomics analyses. Alternative methods should be used to validate expression differences and further delineate their magnitude.4) Several reviewers raised the concern as to whether some of the expression changes are a consequence rather than a cause of metastasis. This issue needs to be sorted out and substantiated experimentally.5) Some follow up studies seems warranted to support the conclusions made about the roles of matrisome components not previously implicated in metastasis, but unearthed in your study.[Editors’ note: the authors asked the editors for clarifications in advance of resubmission, which are shown below.]We all agree that you and your co-authors have found interesting candidate ECM proteins potentially linked to metastatic potential. All of your reviewers concluded that some independent experimental confirmation of findings would be necessary for publication in eLife.Although you and your co-authors concede that language linking these proteins to humanbreast cancer metastases should be reduced in the manuscript, it was felt that secondary confirmation of the role of these proteins in (minimally) another breast cancer cell line would be essential in order for the conclusions following from this work to be of broad interest to the readership of eLife. For example, you indicate that an antibody for LTBP3 for western blot and immunostaining is available. Perhaps your coauthors could perform additional knock down studies and characterization of this candidate protein and its role in a second breast cancer cell line.The validation of protein expression levels for the top candidates which your coauthors have already performed should be included in the paper. Indeed, you have clearly recognized the importance of validating your results in primary humantumors but state that this work is beyond the scope of this publication. While it was agreed that a full study of primary tumors would be unnecessary for this publication, without further characterization using a second xenograft model, the most interesting implications of this work are not well supported by the data. I hope this helps to streamline the process and delineate more specifically what would be the minimum needed for eLife to move forward with publication of your study.All four of your reviewers agree that the work is of high quality and comes to a number of interesting and important conclusions that highlight the importance of ECM proteins in tumor progression. However, we are concerned that the conclusions made about the potential role of these ECM proteins as regulators of metastasis in humanbreast cancer are not currently well supported by the experiments. The consensus is that there are several major concerns that currently pose a barrier to publishing in eLife.We had not intended to claim that all of these ECM proteins were conclusively identified as “regulators of metastasis in humanbreast cancer”. On rereading the text, we noted several places where we may have inadvertently given that impression. We have modified those sentences and inserted additional text noting what would need to be done to validate these as useful biomarkers for humanclinicalbreast cancer. We acknowledge that, as with any novel large-scale discovery studies, additional follow-up studies are required to establish definitive humanpatient relevance. In order to extend the implications to humanpatient material, we have established collaborations with clinicians to access well annotated humanpatientsamples and we are starting the necessary large-scale production of antibodies against ECM proteins. That will take significant time and effort and is beyond the scope of this paper.1) One of the greatest and nearly unanimous concerns is the use of a single pair of cultured cell lines (one cell type) of “normal and cancer states” (derived from a single patient). The consensus is that this is simply not enough to judge whether the findings are at physiologically relevant and functionally significant and how broadly applicable the results might be.We used the well studied and widely used MDA-MB-231/LM2 pair of human cell lines as discovery tools to evaluate 1) the composition of the ECM of tumors of different metastatic potentials; 2) the tumor vs stroma/host contributions to the production of the tumor ECM; 3) the functional involvement in metastasis of four ECM proteins previously not known to play any role in that process. Those experiments could not have been done without suitable cell lines and mouse xenograft models. A major advantage of this system is that LM2 cells metastasize from the primary tumor site (mammary gland) without requiring the addition of Matrigel (which would complicate the proteomics). LM2 also efficiently metastasize when injected via the tail vein. We find these cells, previously used in several discovery studies (at the RNA expression level) of metastasis, suitable for the protein-level studies that we conducted. We clearly demonstrate in this paper that the changes in the proteins that we tested are functionally significant in metastasis in the systems analyzed. As noted above, we are not claiming that the results obtained with this pair of cell lines are demonstrably broadly applicable. We hope they will be and we have noted the evidence consistent with that hope. We believe that to repeat the complete set of proteomics experiments and knockdowns presented in this manuscript on other tumor cell lines would not be a productive use of time, money and animals (quite apart from requiring probably at least a year of further work). If we were to do that as requested, the question would still remain – how relevant are these data to humanbreast cancer? It does not seem to us to be a reasonable request. We believe that the appropriate next step is to analyze patient-derived material and we are beginning those studies now but they will in themselves be a large undertaking beyond the scope of this paper.The cell lines used were manipulated extensively and passaged through mice several times, which further compounds the problems/caveats.We acknowledge that the cell lines are model systems – albeit ones that have been widely used in the literature to good effect as discovery tools. Note that we identified multiple ECM proteins that have previously been implicated in breast cancer as well as discovering numerous additional proteins that change and we demonstrated that 4/5 tested were indeed pro-metastatic.A related issue is whether the differences in overall matrisome and in the five ECM proteins tested truly represent differences between mammary tumors and lung metastases, as you hope is the case, or whether they represent ECM differences between tumors that are initiated with 250,000 cells implanted at once versus tumors that are initiated by circulating cells that reach the lungs over time singly or as very small clusters. Since mammary tumors are among the few that can be successfully initiated at the near single cell level, the recommendation to re-visit matrisome results (at least the key differentially expressed proteins identified) on mammary tumors initiated with just a few cells instead of the 250,000.This is a misunderstanding: the proteomic analyses were conducted on ECM of primary tumors of differing metastatic potential. The ECM signatures therefore correlate with metastatic potential not with differences between primaries and metastases – a different but also interesting question (a subject of our ongoing work). We added text to clarify this point.2) Another broadly shared criticism is that xenograft studies are not sufficient to draw conclusions about humantumors. As pointed out, expression of these ECM proteins in humantumors of different metastatic potential is a necessity to generalize about the relevance to breast cancer. It will also be important to demonstrate that tumors with the same metastatic potential show similar ECM composition.As noted above, we agree and we did not intend to conclude that we have yet shown that these ECM proteins are relevant to clinicalcancer. The model systems used in this paper are discovery tools and the xenograft approach is essential to dissect the relative contributions of tumor and stromal cells – a set of results that the referees agree are interesting. It will, of course, be necessary (as we are now doing) to extend the work to humanpatient material. To do so, it will be essential to analyze a larger number of tumors than is feasible by proteomics. Rather, it will be necessary to prepare antibodies to the candidate ECM biomarkers discovered here and apply them in immunohistochemistry assays of humantumor microarrays to test correlations with clinical stage, tumor type, metastatic potential, etc. This is a large endeavor (few useful antibodies are available) but it is only made possible by the discoveries described in this paper – that is why we believe that this paper merits publication prior to that considerable extension to clinical material.3) One reviewer raises a concern that most of the proteins that showed differential expression and all of the ones chosen for functional studies had relatively few peptides in the proteomics analyses. Alternative methods should be used to validate expression differences and further delineate their magnitude.It is not entirely clear to us why the reviewer is concerned: certainty of identification, quantitation, or both? The 5 proteins chosen for functional studies LTBP3, SNED1, EGLN1, S100A2, and CYR61 were observed with 6, 8, 3, 2, and 6 peptides, respectively, and in duplicate analyses (see Figure 3–source data 1). Our requirement of a protein being detected in two replicates and with at least two peptides in one of the two replicate is a conservative threshold that was applied to virtually eliminate the possibility of a false-positive identification. So, there is no doubt about the identity or differential expression of the proteins. Rather than using the words most and all, the reviewer’s comment would seem to be more accurately stated as “some of the proteins that showed differential expression and some of the ones chosen for functional studies had relatively few peptides”. We have modified the text to clarify some of the nuances of our methodology. Note that because the tumor-stroma distinction relies on measurement of similar peptides of differing sequence (with accompanying mass differences), it is impossible to use more accurate mass spectrometric quantitation approaches that incorporate isotopic labels.While it is impractical to validate by alternative methods the protein expression measurements for all 150+ ECM proteins observed in our proteomics experiments, we have included immunoblot data (for LTBP3, EGLN1 and CYR61) and immunohistochemical staining (LTBP3) that confirm the differential expression of these proteins (see Figure 2–figure supplement 1). We note however that evaluating the relative abundance changes for proteins deposited extracellularly is not as simple as surveying mRNA expression. In fact, RNA expression only poorly correlates with protein level expression. However, we have conducted some such experiments and included some data along those lines (see Figure 2–figure supplement 1 and Results section).4) Several reviewers raise the concern as to whether some of the expression changes are a consequence rather than a cause of metastasis. This issue needs to be sorted out and substantiated experimentally.We are not sure what is meant by this comment. Some of the protein expression changes may indeed be consequences of the fact that the primary tumors differ in their metastatic potential. The reason why we conducted the knockdown experiments was precisely to test whether any of the proteins were causal and, indeed, 4/5 of those tested were causal – others may not be. However, even if some of the changes detected are consequential rather than causal, these proteins may still be valuable as biomarkers as we now note in the revised manuscript (see Results and Discussion sections).5) Some follow up studies seems warranted to support the conclusions made about the roles of matrisome components not previously implicated in metastasis, but unearthed in your study.We are not sure what is being suggested here – that is exactly why we conducted the knockdown experiments.[Editors’ note: the authors asked the editors for clarifications in advance of resubmission, which are shown
below.]We all agree that you and your co-authors have found interesting candidate ECM proteins potentially linked to metastatic potential. All of your reviewers concluded that some independent experimental confirmation of findings would be necessary for publication in eLife.Although you and your co-authors concede that language linking these proteins to humanbreast cancer metastases should be reduced in the manuscript, it was felt that secondary confirmation of the role of these proteins in (minimally) another breast cancer cell line would be essential in order for the conclusions following from this work to be of broad interest to the readership of eLife. For example, you indicate that an antibody for LTBP3 for western blot and immunostaining is available. Perhaps your coauthors could perform additional knock down studies and characterization of this candidate protein and its role in a second breast cancer cell line.The validation of protein expression levels for the top candidates which your coauthors have already performed should be included in the paper. Indeed, you have clearly recognized the importance of validating your results in primary humantumors but state that this work is beyond the scope of this publication. While it was agreed that a full study of primary tumors would be unnecessary for this publication, without further characterization using a second xenograft model, the most interesting implications of this work are not well supported by the data. I hope this helps to streamline the process and delineate more specifically what would be the minimum needed for eLife to move forward with publication of your study.1) A request for independent experimental confirmation of the findings. We take this to mean, in part, confirmation by orthogonal means of the differences detected and documented extensively by proteomics. We have added data confirming the protein-level differences for proteins on which we focused in our tests for causality. Such confirmation either requires decent antibodies (which are not always available but we have included all that are) or repeat proteomics (which we had already included).We also understood that you and the referees would like to see qRT-PCR data confirming the proteomics “hits”. We have done such experiments for the main proteins on which we focused and for some others and we now include some of those data. They show (as expected) that some of the protein data conform with changes in mRNA levels and some do not – that is widely understood in the field and we now discuss that discrepancy in the text.Therefore, it is clear that mRNA data (an imperfect measure of instantaneous rate of production) are not a reliable way to confirm the proteomics data (measures of steady-state protein levels). We also now include some confirmatory in vivo data from an autochthonous mouse model of mammary cancer. We believe that we have done the best that can be done – we have applied stringent criteria for scoring the proteomics data, all of which have been replicated. We have added text to the manuscript (pages noted in the response to referees, and highlighted in the resubmitted manuscript) to clarify for the reader. These are not one-off Western blot data and they are robust.2) You also asked for secondary confirmation of “the role of these proteins in minimally another [xenograft] breast cancer cell line” and “additional knock down studies and characterization of this candidate protein and its role in a second breast cancer cell line” and you indicate that this “would be essential in order for the conclusions following from this work to be of broad interest to the readership of eLife.” While we understand the reasons for this request from you and the referees, we regret that we do not see it as a realistic one to achieve in the short term. As we have mentioned above, we did conduct RT-qPCR analyses on a variety of mammary cell lines but, as we demonstrate for the ones we have studied in detail (MDA-MB-MB231 and LM2), such data are not of much significance with respect to protein data. Furthermore, and perhaps even more important, in vitro data on other cell lines are very poorly relevant to the situation in vivo. All our data concern tumors growing in vivo and thus comprise both tumor-cell-derived proteins as well as stromal proteins and, as we show in the paper, there is extensive crosstalk between the cells – so in vitro data are not germane.Thus, in order to do what you request, we would need to do in vivo confirmation on additional cell line tumors for protein expression, either by proteomics (an enormous amount of work) or, where antibodies are available (not the case for all the proteins of interest, although we are working on generating them) in order to validate changes in protein-level expression. Without such prior studies, we believe, it would be pointless to proceed to do further knockdown/metastasis assays (also a lot of time, mice, and expense) on other lines not validated for in vivo expression. Quite apart from the fact that what you are requesting would be a large body of work, requiring an extended time, large numbers of mice (we estimate that we used >100 mice for the experiments presented, each housed for months while tumors developed) and considerable expense both for the mice and for the proteomics, we do not believe that these are the next essential questions. If we believed that such a sequence of experiments would be productive, we would do them.However, it is our opinion that they would not advance the situation. No matter how many cell lines or mouse models we examined, the question would still remain – how relevant are these xenotransplant data to humanbreast cancer? You and the referees have raised this point and we completely agree with it. Therefore, what we should be doing (and are) is extending the novel insights gained from this paper to humanpatient material. That is why we included some comparisons with patient outcome data extracted from the literature in our initial submission. We have now expanded that (and toned down some of our conclusions to “correlation” rather than “prediction”). These data show that many of the proteins we identify in vivo as upregulated in highly metastatic tumors show corroborative evidence – from other papers and/or from our comparisons with gene expression metadata analyses – supporting their roles in humanbreast cancer. Even though these are comparisons between protein level data and mRNA expression data with all their qualifications, there are a striking number of concordances that need investigation. We believe that validates our approach and the data presented in this paper – proteins we identify through in vivo analyses of our (admittedly) model discovery system include many that may be relevant to humancancer.Therefore, we believe that the data we present in the revised manuscript do provide clear evidence that the proteins that we have discovered using a novel, systematic approach are clearly of interest for further work and to your readers. We see the next required steps to be to extend the work to humanpatient material, not to do further confirmatory experiments in xenotransplant models in mice. It has been our understanding that eLife also believes that excessive time should not be spent on performing experiments that do not materially improve a paper, delaying publication of the work, and postponing the progress of junior investigators onto the next substantive investigations. That is our contention here and we hope that you will consider our arguments for this position.
Authors: Noor Jailkhani; Jessica R Ingram; Mohammad Rashidian; Steffen Rickelt; Chenxi Tian; Howard Mak; Zhigang Jiang; Hidde L Ploegh; Richard O Hynes Journal: Proc Natl Acad Sci U S A Date: 2019-05-08 Impact factor: 11.205
Authors: Kristen M Seiler; William H Goo; Qiang Zhang; Cathleen Courtney; Adam Bajinting; Jun Guo; Brad W Warner Journal: J Pediatr Surg Date: 2020-02-27 Impact factor: 2.545
Authors: David T Dudley; Xiao-Yan Li; Casey Y Hu; Celina G Kleer; Amanda L Willis; Stephen J Weiss Journal: Proc Natl Acad Sci U S A Date: 2014-09-29 Impact factor: 11.205
Authors: Matthew S Hall; Farid Alisafaei; Ehsan Ban; Xinzeng Feng; Chung-Yuen Hui; Vivek B Shenoy; Mingming Wu Journal: Proc Natl Acad Sci U S A Date: 2016-11-21 Impact factor: 11.205