Literature DB >> 24475178

Prevalence and evolution of low frequency HIV drug resistance mutations detected by ultra deep sequencing in patients experiencing first line antiretroviral therapy failure.

Marie-Anne Vandenhende1, Pantxika Bellecave2, Patricia Recordon-Pinson2, Sandrine Reigadas2, Yannick Bidet3, Mathias Bruyand4, Fabrice Bonnet5, Estibaliz Lazaro6, Didier Neau7, Hervé Fleury2, François Dabis8, Philippe Morlat5, Bernard Masquelier2.   

Abstract

OBJECTIVES: Clinical relevance of low-frequency HIV-1 variants carrying drug resistance associated mutations (DRMs) is still unclear. We aimed to study the prevalence of low-frequency DRMs, detected by Ultra-Deep Sequencing (UDS) before antiretroviral therapy (ART) and at virological failure (VF), in HIV-1 infected patients experiencing VF on first-line ART.
METHODS: Twenty-nine ART-naive patients followed up in the ANRS-CO3 Aquitaine Cohort, having initiated ART between 2000 and 2009 and experiencing VF (2 plasma viral loads (VL) >500 copies/ml or one VL >1000 copies/ml) were included. Reverse transcriptase and protease DRMs were identified using Sanger sequencing (SS) and UDS at baseline (before ART initiation) and VF.
RESULTS: Additional low-frequency variants with PI-, NNRTI- and NRTI-DRMs were found by UDS at baseline and VF, significantly increasing the number of detected DRMs by 1.35 fold (p<0.0001) compared to SS. These low-frequency DRMs modified ARV susceptibility predictions to the prescribed treatment for 1 patient at baseline, in whom low-frequency DRM was found at high frequency at VF, and 6 patients at VF. DRMs found at VF were rarely detected as low-frequency DRMs prior to treatment. The rare low-frequency NNRTI- and NRTI-DRMs detected at baseline that correlated with the prescribed treatment were most often found at high-frequency at VF.
CONCLUSION: Low frequency DRMs detected before ART initiation and at VF in patients experiencing VF on first-line ART can increase the overall burden of resistance to PI, NRTI and NNRTI.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24475178      PMCID: PMC3903565          DOI: 10.1371/journal.pone.0086771

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The advent of combination antiretroviral therapy (ART) has dramatically reduced HIV-1 infection-related morbidity and mortality [1]. However, the efficiency of these treatments can be compromised by the presence of drug-resistant variants, resulting in virological failure [2]. According to epidemiological studies, 8–11% of antiretroviral naive patients are infected with a virus harbouring drug resistance associated mutations (DRMs) in Europe and the USA [3]. Treatment guidelines therefore recommend genotypic resistance testing before initiating antiretroviral therapy and in the case of virological failure [4]. Standard genotyping by Sanger sequencing (SS) used currently in clinical practice cannot detect viral variants representing less than 15–25% of the viral population [5]. More sensitive techniques have been developed, including ultra-deep sequencing (UDS), which can detect and quantify low-frequency variants harbouring DRMs down to 0.5–1% [6]. Clinical relevance of detecting low-frequency DRMs remains open to debate. Some studies have found no significant association between the presence of low-frequency DRMs and subsequent virological failure [7]–[9] while others reported an overt correlation [10]–[14]. A recent pooled analysis showed that low-frequency non-nucleoside reverse transcriptase inhibitor (NNRTI)-DRMs increased the risk of virological failure (VF) with NNRTI-based regimen more than two-fold [15]. The impact of low-frequency protease inhibitor (PI)-DRMs on treatment response has been limited to a few studies that found no associations [11], [16]. The objectives of our study were to determine the prevalence of DRMs detected by UDS as well as their effect on ART resistance before treatment and at VF, and to analyse their evolution under treatment, in HIV-1 infected patients experiencing VF on first-line ART.

Methods

Ethics statement

All patients included in this study gave written informed consent. The study protocol was approved by the Ethics committee of Bordeaux University Hospital (Comité de protection des personnes). The Agence Nationale de Recherche sur le SIDA (ANRS) CO3 Aquitaine Cohort is a prospective hospital-based cohort of HIV-1 infected patients under routine clinical management, initiated in 1987 in the Bordeaux University Hospital and four other public hospitals in the Aquitaine region, South Western France. Inclusion criteria are: adult patients of the participating hospital wards with confirmed HIV-1 infection, having at least one follow-up after the first report, and having given informed consent. Visits occur usually every three months if the patient is treated, every six months otherwise. Detailed presentation of the cohort has been reported elsewhere [17].

Study population

Patients starting a first antiretroviral treatment between January 2000 and June 2009 were retrospectively screened from the ANRS CO3 Aquitaine Cohort database. Patients experiencing virological failure (VF), defined as a plasma viral load (VL) >1,000 copies/ml or 2 consecutives VL>500 cp/ml at least 6 months after ART initiation, and with plasma samples available both at baseline (last sample available before ART initiation) and at VF (plasma sample corresponding to first VL>1000 or second VL>500 cp/ml) were included in our study. Patients were excluded if they changed or stopped their ART. Socio-demographic, clinical and biological characteristics of eligible participants were extracted from the database.

Sanger sequencing

Viral RNA was extracted from 1 ml of plasma sample at baseline and at VF using the High Pure Viral RNA kit (Roche). The Reverse Transcriptase (RT) and Protease gene sequences were determined using Sanger sequencing (SS) according to the ANRS consensus method (http://www.hivfrenchresistance.org).

Ultra-deep sequencing (UDS)

Viral RNA was extracted as described above and used as a template for RT-PCR. The Pol region (HxB2 position: 2082–3420) was amplified using the 5P1 and MJ4 primers and the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase kit (Invitrogen, Carlsbad, CA). RT-PCR conditions were reverse-transcription at 50°C for 30 minutes, one denaturation step of 94°C for 2 minutes, followed by 40 cycles of denaturation for 30 seconds at 94°C, annealing for 30 seconds at 55°C, extension for 90 seconds at 68°C, and a final 7-minutes extension at 68°C. Two microliters of RT-PCR product were used to generate 4 amplicons (Prot, RT1, RT2 and RT3) encompassing protease and RT regions and harbouring specific MIDs in their end. Amplicons and primers are described in . The nested PCR was performed with the FastStart High Fidelity PCR System (Roche Diagnosis) and according to the following conditions: initial denaturation step of 94°C for 3 minutes followed by 40 cycles of denaturation for 30 seconds at 94°C, annealing for 45 seconds at 55°C, and extension for 60 seconds and a final 8-minutes extension at 72°C.
Table 1

Primers used for amplicon generation.

AmpliconHxB2 positionHIV specific primer (5′-3′)
Prot2136–2164 TCAGAGCAGACCAGAGCCAACAGCCCCA
2621–2650 AATGCTTTTATTTTTTCTTCTGTCAATGGC
RT11 -
-
RT22706–2734 GAAAATCCATACAATACTCCAGTATTTGC
3119–3145 CTATGCTGCCCTATTTCTAAGTCAGAT
RT32 2874–2891CTRGATGTGGGTGATGCA
3265–3284CNYTATAGGCTGTACTGTCC

Note that forward and reverse primers are linked to primer A and B (454 Life Sciences; Roche) respectively and contain the TCAG key. To distinguish each sample in the multiplexed UDPS, nine unique sequence tags (MID1 to 9, according Roche's protocol) were inserted between the adaptor A or B and the gene specific primer.

RT1: primers under patent process

Primers from Mitzuya's paper [29]

Note that forward and reverse primers are linked to primer A and B (454 Life Sciences; Roche) respectively and contain the TCAG key. To distinguish each sample in the multiplexed UDPS, nine unique sequence tags (MID1 to 9, according Roche's protocol) were inserted between the adaptor A or B and the gene specific primer. RT1: primers under patent process Primers from Mitzuya's paper [29] PCR products were purified using magnetic beads (Agencourt AMPure Kit, Beckman Coulter, and Benried, Germany) to eliminate primer-dimers. The number of molecules was quantified by fluorometry (Quant-iT PicoGreen dsDNA assay kit, Invitrogen, Carlsbad, CA) and equimolar concentrations of amplicons were pooled. This library was submitted to emulsion-based clonal amplification (emPCR) using GS Junior Titanium emPCR Kit (Lib-A) according to Roche's protocol. UDS was performed in both strands on a 454 Life Science Roche GS junior. Amplicon Variant Analyzer (AVA 2.7) software (454 Life Sciences; Roche) was used to align all read amplicons and to calculate variant frequencies at each nucleotide position relative to the HxB2 reference HIV-1 strain sequence. Raw data were submitted to GenBank under SRP033482 study accession number.

UDS technical error rate

To estimate the error rate of our UDS protocol, we calculated the percentage of errors generated from 2 steps of PCR (Platinum Taq Polymerase followed by FastStart High Fidelity polymerase amplification) and pyrosequencing of a plasmid control containing HIV-1 LAV reference HIV-1 strain (pNL4.3). The mean error rate was calculated using a triplicate experiment and the percentage of variations compared to the plasmid HIV-1 sequence. We estimated an overall mean error rate of 0.21±0.07% (mean reads per position: 3007±1477). Deletion and insertions events corresponded to 29.8% and 61.9% of the overall errors, with 0.07±0.06% of deletion and 0.12±0.07% of insertion relative to total reads. These values are in accordance with the rate of errors generated by the FastStart High Fidelity polymerase [18]. As input HIV RNA was not quantified, the expected sampling error depended on sample viral load. The stochastic effects of sampling variation were limited when the starting RNA copy number was higher than 10,000 copies/mL [6]. Below this threshold, the proportion of sequenced PCR amplicons containing DRMs may not be representative to the original sample. Drug resistant mutations (DRMs) were thus accepted as significant variants when present at a frequency of >1% among the total number of reads and in both strands.

Drug resistance mutations and Genotypic Sensitivity Score

Reverse transcriptase and protease DRMs were identified using SS and UDS at baseline and VF. Analyzed mutations associated with resistance to nucleoside reverse transcriptase inhibitor (NRTI), NNRTI and PI were referenced in the 2011 International AIDS Society (IAS)–USA drug resistance mutations list [19]. Genotypic resistance was interpreted with the 2012 ANRS HIV drug resistance algorithm v22 (http://www.hivfrenchresistance.org) in order to determine the overall burden of resistance to antiretroviral (ARV) drugs and resistance to the prescribed treatment. The weighted Genotypic Sensitivity Score (wGSS) scores the resistance to the prescribed treatment and was calculated as the sum of the scores obtained for each prescribed ARV drug. In this system, ARV drugs are considered to display full, intermediate or null antiviral activity and scored as 1, 0.5 or 0 for PIs, 1, 0, 0 for NNRTIs and 0.5, 0, 0 for NRTIs [20].

Statistical tests

Paired t-tests were used to compare the mean number of DRMs detected by SS versus UDS for all DRMs, PI-DRMs, NRTI-DRMS and NNRTI-DRMs (Stata 12.1 software).

Results

Twenty-nine patients achieving VF at least 6 months after initiating first-line ART had plasma samples available at baseline and at VF and were included in our study ( ). They were mainly men (79.3%) and infected with subtype B HIV-1 in 72.4% of the cases. Median baseline CD4 cell counts (cells/mm3) and median VL (log10 copies/ml) were 248 (interquartile range IQR: 177–314) and 5.0 (IQR: 4.6–5.2) respectively. After a median duration of 14.3 months under therapy (IQR: 8.7–24.2), VF occurred in patients with a median of 3.7 log10 copies/ml of HIV RNA (IQR: 3.3–4.0).
Table 2

Demographic, clinical and virological characteristics of the included patients (n = 29).

Patients characteristicsn (%)
Gender male, n (%)23 (79.3%)
Median age, years (IQR)36.8 (33.0–39.4)
Transmission group, n (%)MSM13 (44.8%)
IDU5 (17.3%)
Heterosexual9 (31.0%)
Other2 (6.9%)
HIV-1 B subtype, n (%)21 (72.4%)
Antiretroviral treatment, n (%)2 NRTIs3 (10.3%)
3 NRTIs5 (17.2%)
2 NRTI + PI3 (10.3%)
3 NRTI + PI2 (6.9%)
2 NRTI + PI/r8 (27.6%)
3 NRTI + PI/r2 (6.9%)
2 NRTI + NNRTI6 (20.8%)
Period of ART initiation<200317 (58.6%)
≥200312 (41.4%)
Median baseline plasma HIV-1 RNA, log10 copies/ml (IQR)5.0 (4.6–5.2)
Median baseline CD4 cell count, cells/mm3 (IQR)248 (177–314)
Median VF plasma HIV-1 RNA, log10 copies/ml (IQR)3.7 (3.3–4.0)
Median time between baseline and VF, month (IQR)14.3 (8.7–24.2)

MSM: men who have sex with men, IDU: intravenous drug user, IQR: interquartile range, VF: virological failure

MSM: men who have sex with men, IDU: intravenous drug user, IQR: interquartile range, VF: virological failure Three patients were treated with a 2 NRTI-based regimen, 5 patients with 3 NRTIs, 5 patients with NRTIs + PI, 10 patients with NRTIs + boosted PI and 6 patients with 2 NRTIs + NNRTI. Co-prescribed PIs were Atazanavir, Lopinavir, Nelfinavir or Fosamprenavir and co-prescribed NNRTIs were Efavirenz or Nevirapine.

Sequencing

Sequencing was performed at baseline on the last plasma sample available before ART initiation (median time period between the baseline sample and the start of ART: 28 days, IQR: 8–91) and on the plasma sample corresponding to the date of VF. UDS performed on baseline viral HIV RNA yielded a median of 1663 (IQR: 1017–2533) reads per amplicon (VL range: 3.08 log10 cp/ml to 6.62 log10 cp/ml), and a median of 1739 (IQR: 1123–2585) reads per amplicon on viral HIV RNA from plasma collected at VF (VL range: 3.01 log10 cp/ml to 4.98 log10 cp/ml at failure). UDS of the protease region was successful for all of the 29 patients at failure and at baseline but RT UDS failed for 1 patient at baseline. Comparison of the mean number of DRMs detected by the 2 sequencing techniques ( ) revealed that 1.35-fold more DRMs were detected by UDS (1.4-fold more at baseline and 1.3 at VF, p<0.0001). All the DRMs found by SS were also detected by UDS. Additional low-frequency DRMs were found in 21/29 patients at baseline and in 18/29 patients at failure. The difference between the mean number of DRMs detected by SS and by UDS was statistically significant (p<0.05) at baseline for PI and NNRTI-DRMs and at VF for the 3 antiviral drug classes.
Figure 1

Drug resistant mutations (DRMs) detected by Sanger sequencing (SS) and ultra-deep sequencing (UDS).

Mean of DRMs per patients were obtained. Two-tailed p values and 95% confidence intervals were calculated from the paired Student t-test (ns: not statistically significant, p>0.05). ALL_SS and ALL_UDS: all DRMs detected by SS and UDS respectively PI_SS and PI_UDS: Protease inhibitor (PI)-DRMs detected by SS and UDS respectively NRTI_SS and NRTI_UDS: Nucleoside Reverse Transcriptase Inhibitor (NRTI)-DRMs detected by SS and UDS respectively. NNRTI_SS and NNRTI_UDS: Non-Nucleoside Reverse Transcriptase Inhibitor (NNRTI)-DRMs detected by SS and UDS respectively.

Drug resistant mutations (DRMs) detected by Sanger sequencing (SS) and ultra-deep sequencing (UDS).

Mean of DRMs per patients were obtained. Two-tailed p values and 95% confidence intervals were calculated from the paired Student t-test (ns: not statistically significant, p>0.05). ALL_SS and ALL_UDS: all DRMs detected by SS and UDS respectively PI_SS and PI_UDS: Protease inhibitor (PI)-DRMs detected by SS and UDS respectively NRTI_SS and NRTI_UDS: Nucleoside Reverse Transcriptase Inhibitor (NRTI)-DRMs detected by SS and UDS respectively. NNRTI_SS and NNRTI_UDS: Non-Nucleoside Reverse Transcriptase Inhibitor (NNRTI)-DRMs detected by SS and UDS respectively. Italic: mutations only detected by UDS/Normal: mutations detected by both UDS and SS Bold: Major protease mutations Underlined: mutations associated to prescribed treatment GSS, Genotypic Sensitivity Score; ART, antiretroviral treatment; ZDV, zidovudine; DDI, didanosine; D4T, stavudine; 3TC, lamivudine; FTC: Emtricitabine; ABC, abacavir; TDF, tenofovir; NFV, nelfinavir; LPV/r, boosted lopinavir; ATZ/r, boosted atazanavir, FPV/r, boosted fosamprenavir UDS failed for this sample. Only DRMs detected by SS were listed. For technical reasons, E138 position was not read by UDS. Italic: mutations only detected by UDPS/Normal: mutations detected by both UDPS and SS. Bold: Major protease mutations. Underlined: mutations associated to prescribed treatment. GSS, Genotypic Sensitivity Score; ART, antiretroviral treatment; ZDV, zidovudine; DDI, didanosine; D4T, stavudine; 3TC, lamivudine; FTC: Emtricitabine; ABC, abacavir; TDF, tenofovir; EFV, efavirenz; NVP, nevirapine.

Baseline mutations (Tables 3 and 4)

Prevalence of DRMs

Using Sanger sequencing, PI mutations were detected in most of the patients but they were accessory or polymorphic IAS-USA mutations except for Patient 4 who had virus harbouring a major PI mutation. NRTI-DRMs were found in 13.8% (4/29) of the patients and NNRTI-DRMs in 17.2% (5/29). UDS analysis showed that 51.7% (15/29), 3.4% (1/29), 10.7% (3/28) and 25.0% (7/28) of the patients had viruses harbouring additional low-frequency PI-, major PI-, NRTI- and NNRTI-DRMs respectively at baseline. The low-frequency NNRTI-DRMs corresponded to polymorphic Etravirine mutations (V90I, V106I) and Rilpivirine mutations (E138G) in a total of 4 and 2 patients respectively. These low-frequency DRMs could increase the overall burden of resistance to one or more ARV drugs in 4 of 29 patients (13.8%).

Association of low-frequency DRMs with the prescribed treatment

Among the 21 patients with low-frequency DRMs, 8 had virus harbouring DRMs correlated with the future prescribed treatment. Nevertheless, the wGSS was not modified except for Patient 61 who harboured 2.1% of HIV variants with Y181C mutation that could imply resistance to its NNRTI treatment.

VF mutations (Tables 3 and 4)

Using Sanger sequencing, we determined that 20/29 patients had viruses harbouring DRM. Accessory PI mutations were detected in most of the patients but major-PI mutations were found in 17.2% of patients (5/29). NRTI- and NNRTI-DRMs were found in 58.6% (17/29) and 34.5% (10/29) of the patients respectively. Additional low-frequency PI-, major PI-, NRTI- and NNRTI-DRMs were found by UDS in 44.8% (13/29), 10.3% (3/29), 25% (7/28) and 21.4% (6/28) of the patients respectively. These low-frequency DRMs could increase the overall burden of resistance to one or more ARV drug in 9 of 29 patients (31%). Among the 18 patients with low-frequency DRMs, 12 had virus harbouring DRMs correlated with the prescribed treatment. These low-frequency DRMs detected only by UDS led to changes in susceptibility predictions to the prescribed treatment in 6/29 patients (20.7%), as shown by their VF UDS GSS lower than their VF SS GSS. Patients 14, 49 and 64 presented in their viral population 4.3% of M184I, 2.7% and 3.8% of M184V respectively that could be involved in resistance to the prescribed Lamivudine. Abacavir resistance was identified in Patient 46 who harboured 3% of viruses with L74V mutation and in Patient 86 who was infected with 34.9% of viruses carrying Y115F mutation. In Patient 40, 5 high-frequency PI-DRMs were found, leading to possible resistance to Lopinavir. The detection of 5% of variants with the additional Lopinavir resistance mutation L10V could explain an increase on resistance to this PI. Taking into account both high-frequency and low-frequency DRMs, 8 patients (Patients 16, 23 25, 28, 31, 41, 47 and 85) had no resistance to their prescribed treatment, and 4 had even no DRMs related to their prescribed treatment (Pt 16, 28, 47 and 85)

Evolution of the low-frequency DRMs between baseline and virological failure

Among the 38 additional low-frequency DRMs detected at baseline, 9 were related to the future prescribed treatment (8 patients). Among them, 1/5 PI-DRMs (Patient 23), 2/3 NRTI-DRMs (Patients 25 and 80) and 1/1 NNRTI-DRMs (Patient 61) were also detected at VF. All the PI-DRMs were accessory PI-DRMs. In the unique subject with baseline low-frequency NNRTI-DRM that could lead to resistance to the prescribed ART (Patient 61, Y181C at 2.1%), both UDS and SS performed at virological failure showed the evolution of this mutation which was detected at high frequency (97.4%). Most of the treatment-related mutations found at VF were not detected at baseline by UDS. In 75% of the cases (21/28), VF was associated with the occurrence of NRTI DRMs, mainly the M184I/V mutation. Among the 26 patients receiving Emtricitabine (FTC) or Lamivudine (3TC), viruses harbouring the M184I/V mutation at VF were found in 14 patients by both SS and UDS and in 3 patients by UDS only. However, this M184 mutation was never detected at baseline by UDS. Pre-existing low-frequency TAM-NRTI mutations were found in 2/5 patients from whom high level of TAMs were detected at VF (4% and 2.5% baseline M41L; Patient 25 and 80). Concerning the 4 patients with NNRTI-DRMs at VF, only one (Patient 61) had pre-existing low-frequency NNRTI-DRM at baseline. Among the 5 patients treated with PI-based regimen with viruses harbouring major PI-DRMs related to their treatment, none of these PI-DRMs was detected by UDS at baseline. Most of the polymorphic PI-DRMs were already detected at baseline by both SS and UDS.

Discussion

Our study gave new insights on the distribution of low-frequency variants harbouring PI-, NRTI- and NNRTI-DRMs present prior to first-line therapy and at virological failure, with emphasis on the evolution of these DRMs under ARV therapy. More than two-thirds of the patients presented additional low-frequency DRMs only detected by UDS, with 1.4-fold more DRMs detected by UDS at baseline and 1.3 fold more at VF. This increased prevalence of DRMs was in concordance with previous reports describing the abundance of low-frequency resistant variants (representing less than 20% of viral population), especially detected by UDS, on treatment-naive patients [10], [11], [16] as well as on treatment-experienced patients [21]–[24], confirming the high sensitivity of this technique for the detection and quantification of DRMs. These low-frequency DRMs detected only by UDS could increase the overall burden of resistance to ARV drugs in 13.8% of the patients at baseline and 31% at VF. However, they led to changes in susceptibility predictions to the prescribed treatment only in 3.5% of the patients at baseline and 20.7% at VF. Twenty-six patients had a 3TC/FTC backbone in their regimen. The M184I/V mutation was detected in 17 of them at failure (only by UDS in 3 of them). Nevertheless, we never detected this mutation on samples collected prior to treatment even at low frequency. The absence of the M184V mutation in baseline circulating viruses is not in agreement with previous reports describing the detection of low-frequency variants carrying M184V mutations in acute [7], [25] and chronically infected naive patients [9]. One explanation could be the difference of the ultrasensitive assay used. In these studies, allele-specific PCR was performed for M184V detection, with detection threshold lower than our 1% cut-off. Simen et al found a very low prevalence of M184V/I by UDS in chronically infected naive patients [11]. We could also hypothesize that this lack of M184I/V-harbouring viruses in treatment-naive patients may be a result of the high fitness cost of the M184V virus, which severely impairs replicative capacity [21]. Longer time periods between seroconversion, and then transmission of putative M184V variants, and plasma collection for baseline UDS in our study could lead, in the absence of selective drug pressure, to the decay of these low-replicative variants to very low levels (under the limit of detection of UDS) or even its elimination from the plasma. One of the main questions sparked by these new ultrasensitive assays remains the significance and the clinical relevance of these low-frequency DRMs, and especially their role in subsequent virological failure. In our study, 4/29 patients had viruses harbouring low-frequency NRTI- or NNRTI-DRMs related to the prescribed treatment at baseline and these DRMs were found at high frequency at VF in 3 of them. Moreover, for the unique patient with viruses harbouring low-frequency DRM at baseline (Y181C at 2.1%) which may lead to a resistance to his future treatment by NNRTI, this mutation was found at high frequency (97.4%) by both UDS and SS at virological failure. The impact of low-frequency DRMs on the subsequent response to ARV likely depends on the percentage of low-frequency resistant variants and/or on the mutational viral load [14], [15]. A recent pooled analysis found an increased risk of VF even at very low NNRTI-DRMs frequencies, but showed a dose-dependent effect of low-frequency DRMs with a significantly higher risk of VF with the presence of low-frequency variant at 1% or greater [15]. In our study, we chose to report only low-frequency DRM present at a threshold greater than 1%, to select the mutations with potentially stronger impact on virological outcome, but also to exclude mutations related to laboratory artefact from reverse transcription, PCR amplification and/or sequencing [18], [26]. The impact on the virological outcome probably also depends on treatment regimen. Many studies clearly report a strong and significant association between low-frequency NNRTI-DRMs and a higher risk of virological failure in patients treated by NNRTI-based regimen[10]–[15], [27] even with high levels of adherence [28]. The few studies that evaluated the impact of low-frequency PI-DRMs on PI-based regimen found no associations with an increased risk of treatment failure [11], [16]. In our study, PI-DRMs found by UDS in ARV-naive patients were mainly accessory IAS-USA mutations. These accessory PI mutations are polymorphic but their accumulation could impact the susceptibility to some PI such as Lopinavir or Nelfinavir. In addition, none of the major PI-DRMs present at virological failure were detected at low frequency prior to treatment. Nevertheless, major PI-DRMs were present at low frequency at virological failure in 5/15 patients treated with a PI-based regimen. The additional accessory PI-DRMs only detected by UDS at VF led to changes in susceptibility predictions to the prescribed PI in one of the 15 patients and might explain virological failure. Others studies have shown that low-frequency variants harbouring major PI-mutations are infrequently detected by UDS (most of them are accessory mutations with low Stanford HIVdb scores) and occurred in isolation in ARV-naive patients and in patients experiencing failure on PI boosted-regimen [16], [24]. A study reported that samples with low-frequency PI-DRMs (identified with Stanford-HIVdb weights >12 for Atazanavir and Lopinavir) remained phenotypically susceptible to PIs. This might be explained by the fact that these low-frequency PI-DRMs have been found at levels lower than 0.5–1% [24]. The very low prevalence of variants harbouring major PI-DRMs at significant levels combined with the high genetic barrier to resistance of PI could explain the fact that studies failed to show an impact of low-frequency PI-DRMs on virological response to boosted-PI based regimens. Further studies are needed to determinate if the existence of major PI-DRMs present at low frequency could affect the efficacy of PI/r containing regimens. Our work has several limitations. First, the ability to detect low-frequency variants depends on initial VL and on the amount of RNA copies used for RT-PCR. We were not able to quantify the number of RNA copies submitted to amplification procedure. Based on previously published data that consider RNA extraction efficiency, we assumed that the approximate number of templates derived from a sample with plasma HIV-1 RNA levels ≥4.5 log copies/mL and submitted to UDS was around 100–200 copies [6], [29], [30]. The number of RNA templates used for UDS may not be a limiting factor for low-frequency DRMs detection from baseline samples since 76% of them had VL above 4.5 log copies/mL. However, 86% of the failure samples had VL below 4.5 log copies/mL and thus, the probability of finding low-frequency DRMs on these samples may have been then reduced. In addition, the detected low-frequency DRMs could have been over-estimated due to sampling error and selection bias. However, the low-frequency DRMs associated to the treatment detected at failure were in most of the cases found at level >2.5%, increasing the confidence on their reliability. Secondly, patients were included if they experienced a VF on first-line therapy. The prevalence of low-frequency DRMs on this group of patients was not compared to a control group of patients with virological suppression. Hence, we could not evaluate the impact of the drug resistant low-frequency DRMs on virological outcome. Because of the small number of patients experiencing VF under a first-line ART for whom plasma samples were available both at baseline and VF, only 29 subjects were included in our study. Besides almost 45% of them received an antiretroviral therapy dating back from 2000 which is not state of the art anymore. Finally, adherence to HAART was not reported. Eight patients had no ARV drug resistance suggesting that their VF was related to non-adherence to treatment. Besides, most of the DRMs found at VF under first-line ARV therapy did not exist prior to treatment and were probably acquired through drug selection pressure, favoured by poor adherence or pharmacokinetic factors. Adherence to antiretroviral therapy is a major predictor of viral suppression and disease progression [31]. Low-frequency NNRTI-DRMs increased the risk of VF across all adherence categories, especially in high level of adherence [28]. Thus this essential parameter has to be taken in consideration for further studies. In conclusion, UDS identified significantly more DRMs than SS for each class of ARV (NRTI, NNRTI and PI), both in treatment-naive patients and in patients who experienced virological failure on first-line ARV. In few cases, these additional low-frequency DRMs may change the ARV susceptibility predictions to the prescribed treatment. Large prospective studies are now needed to assess the impact of these low-frequency DRMs on virological response, according to the proportion of each DRM and to the composition of the ARV regimen, before applying these ultrasensitive assays in routine clinical practice.
Table 3

List of drug resistance mutations (DRM) detected at baseline (BL) and virological failure (VF) by Sanger sequencing (SS) and UDS for patients failing a PI-based regimen (n = 15).

Pt.BL VL (cp/ml)Baseline DRM SS and UDS (%) BL GSSARTVF VL (cp/ml)VF DRM SS and UDS (%) VF GSS
ProteaseNRTINNRTISSUDSProteaseNRTINNRTISSUDS
4125416 L10I, M36I, D60E, L63P, A71T, G48V M41L, D67N, L210W, T215Y V179T, E138G (2.1) 22ZDV 3TC DDI NFV5914 L10I, M36I, D60E, L63P, A71T, G48V, V82A M41L, D67N, L210W, T215Y, M184V V179T0.50.5
141292950 M36I, I62V, L63P, A71T, V77I 002.52.5ZDV 3TC ABC NFV8435 M36I, I62V, L63P, A71T, V77I M184I (4.3) Y188C (2.0) 2.52
1620103V77I, L63P (1.5) 002.52.5ZDV 3TC ABC LPV/r1170V77I002.52.5
23121221 M36I (13.1), A71T (11.2) 0022ZDV 3TC NFV2414 M36I (15.4) 0022
25119112G16E, I62V, L63P, V77I L210W, T215D, M41L (4.0) 0223TC TDF LPV/r97597G16E, I62V, L63P, V77I, D60E (1.5) L210W, T215D, M41L 022
31198233 L10V, G16E, K20I, M36I, H69K, L89M0022ZDV 3TC LPV/r59663 L10V, G16E, K20I, M36I, H69K, L89M0022
4096878 K20R, M36I, I62V, L63P, M36L (2.1) 0022ZDV 3TC LPV/r2021 K20R, M36I, I62V, L63P,M46L,I54V , V82A,L10V (5.0) M184V 01.50.5
41771 K20I, M36I, H69K, L89M00223TC TDF ATZ/r1530 K20I, M36I, H69K, L89M0022
4383525K20I, M36I, H69K, L89M0022ZDV 3TC NFV9819K20I, M36I, H69K, L89M, D60E, L63P, I54V, L90M, L89I (26.3), M46L (5.0) M184V 00.50.5
46140551 M36I (1.0) 002.52.5ZDV 3TC ABC LPV/r14505M36I, V11I (1.5) L74V (3.0) 02.52
49232736K20R, V77I, M36I (32.6), L63P (3.4) 0V90I223TC ABC FPV/r2387V77I M184I (2.7) V90I 2 1.5
5119200G16E, K20R, M36I, I62V (8.5), V77I (4.6) 0022TDF FTC LPV/r12796G16E, K20R, M36I, V77I (1.9) M184V, M184I (2.2) K101E (6.8) 1.5 1.5
52782200I62V, L63P, V77I, M36I (1.3) 0 V90I (4.5) 22TDF FTC ATZ/r2155I62V, L63P, V77I, N88S,M46L (18.8) ,_ M46I (8.3) , A71V (9.2), G73S (24.1) M184V 00.50.5
57142700M36I, I62V, L63P, A71T, V77I0022ZDV 3TC LPV/r4861M36I, I62V, L63P, A71T, V77I, G16E (1.6) M184V 01.51.5
791108000 M36I, L63P, G16E (19.3), K20T (5.1), I62V (5.8), V77I (4.4) T215D V90I22DDI D4T NFV1693M36I, L63P, D30N D67N, T215D, M184V V90I0.50.5

Italic: mutations only detected by UDS/Normal: mutations detected by both UDS and SS

Bold: Major protease mutations

Underlined: mutations associated to prescribed treatment

GSS, Genotypic Sensitivity Score; ART, antiretroviral treatment; ZDV, zidovudine; DDI, didanosine; D4T, stavudine; 3TC, lamivudine; FTC: Emtricitabine; ABC, abacavir; TDF, tenofovir; NFV, nelfinavir; LPV/r, boosted lopinavir; ATZ/r, boosted atazanavir, FPV/r, boosted fosamprenavir

Table 4

List of drug resistance mutations (DRM) detected at baseline (BL) and virological failure (VF) by Sanger sequencing (SS) and UDS for patients failing a NNRTI-based regimen (n = 6) or NRTI-based regimen (n = 8).

Pt.BL VL (cp/ml)Baseline DRM SS and UDS (%) BL GSSARTVF VL (cp/ml)VF DRM SS and UDS (%) VF GSS
ProteaseNRTINNRTISSUDSProteaseNRTINNRTISSUDS
2045028L63P, L33V (6.4), M36I (24.8) 0022ZDV 3TC NVP6572L63P, M36I (6.9) M184V K103N, H221Y, M230L, V90I (14.5) 0.50.5
28492680001.51.5ZDV 3TC ABC88025 G16E (2.7), L33V (2.6), M36I (1.8), V77I (2.0) 001.51.5
3838779M36I001.51.5ZDV 3TC ABC91320 M184V 011
471324K20I, M36I, H69K, L89M00223TC FTC EFV2160K20I, M36I, H69K, L89M0022
6133676K20I, M36I, H69K, L89M, G16E (1.1) 0 Y181C (2.1) 213TC D4T NVP533K20I, M36I, H69K, L89M, H69R (4.4), D30N (1.3) M184I Y181C, V90I0.50.5
6267288L63P, D60E (8.5), I62V (3.0), V77I (12.0) 0# V90I# 22ZDV 3TC NVP10371I62V, L33V (2.9), L63P (35.3) 0 Y181C, V90I,K101E (4.2) 11
6388509G16E, M36I, I62V, H69K, K20R (11.6) NDNDNDNDZDV 3TC ABC676G16E, M36I, I62V, H69K K20R M184V * 0* 1ND
64141586V11I, K20I, M36I, H69K, L89M, V77I (6.7) 0# 0# 223TC TDF EFV41115V11I, K20I, M36I, H69K, L89M M184V (3.8) G190S, V90I (45.0) 10.5
7615857I62V, M36I (2.7), Q58E (2.5) , L63P (2.3) 0 V106I (11.0), V90I (1.9) 11ZDV 3TC2438I62V M184V, K70R (15.2) 00.50,5
801607D60E, L63P D67N, K70R, T215Y, K219E, M41L (2.6) 000DDI D4T2033D60E, L63P D67N, K70R, T215Y, K219E, M41L 000
82586670L63P, V77I L210W (9.0) K103N1.51.5ZDV 3TC ABC2667L63P, V77I, D60E (2.8) M184V K103N11
836741L63P, K20R (4.0), M36I (7.5) 0 V90I (6.6) 11ZDV 3TC1812L63P M184V 00.50.5
8514765000 V90I (2.2) 223TC TDF EFV330600V90I22
8657839V77I0 E138G (1.1) 1.51.5ZDV 3TC ABC65400 M184V,Y115F (34.9) V90I, H221Y (8.6) 10.5

UDS failed for this sample. Only DRMs detected by SS were listed.

For technical reasons, E138 position was not read by UDS.

Italic: mutations only detected by UDPS/Normal: mutations detected by both UDPS and SS.

Bold: Major protease mutations.

Underlined: mutations associated to prescribed treatment.

GSS, Genotypic Sensitivity Score; ART, antiretroviral treatment; ZDV, zidovudine; DDI, didanosine; D4T, stavudine; 3TC, lamivudine; FTC: Emtricitabine; ABC, abacavir; TDF, tenofovir; EFV, efavirenz; NVP, nevirapine.

  31 in total

Review 1.  2011 update of the drug resistance mutations in HIV-1.

Authors:  Victoria A Johnson; Vincent Calvez; Huldrych F Günthard; Roger Paredes; Deenan Pillay; Robert Shafer; Annemarie M Wensing; Douglas D Richman
Journal:  Top Antivir Med       Date:  2011-11

2.  Minor variant detection in amplicons using 454 massive parallel pyrosequencing: experiences and considerations for successful applications.

Authors:  Ina Vandenbroucke; Herwig Van Marck; Peter Verhasselt; Kim Thys; Wendy Mostmans; Stéphanie Dumont; Veerle Van Eygen; Katrien Coen; Marianne Tuefferd; Jeroen Aerssens
Journal:  Biotechniques       Date:  2011-09       Impact factor: 1.993

Review 3.  Low-frequency HIV-1 drug resistance mutations and risk of NNRTI-based antiretroviral treatment failure: a systematic review and pooled analysis.

Authors:  Jonathan Z Li; Roger Paredes; Heather J Ribaudo; Evguenia S Svarovskaia; Karin J Metzner; Michael J Kozal; Kathy Huppler Hullsiek; Melanie Balduin; Martin R Jakobsen; Anna Maria Geretti; Rodolphe Thiebaut; Lars Ostergaard; Bernard Masquelier; Jeffrey A Johnson; Michael D Miller; Daniel R Kuritzkes
Journal:  JAMA       Date:  2011-04-06       Impact factor: 56.272

Review 4.  Relationship between minority nonnucleoside reverse transcriptase inhibitor resistance mutations, adherence, and the risk of virologic failure.

Authors:  Jonathan Z Li; Roger Paredes; Heather J Ribaudo; Evguenia S Svarovskaia; Michael J Kozal; Katherine H Hullsiek; Michael D Miller; David R Bangsberg; Daniel R Kuritzkes
Journal:  AIDS       Date:  2012-01-14       Impact factor: 4.177

5.  Transmission of HIV-1 drug-resistant variants: prevalence and effect on treatment outcome.

Authors:  Martin R Jakobsen; Martin Tolstrup; Ole S Søgaard; Louise B Jørgensen; Paul R Gorry; Alex Laursen; Lars Ostergaard
Journal:  Clin Infect Dis       Date:  2010-02-15       Impact factor: 9.079

6.  Transmission of drug-resistant HIV-1 is stabilizing in Europe.

Authors:  Jurgen Vercauteren; Annemarie M J Wensing; David A M C van de Vijver; Jan Albert; Claudia Balotta; Osamah Hamouda; Claudia Kücherer; Daniel Struck; Jean-Claude Schmit; Birgitta Asjö; Marie Bruckova; Ricardo J Camacho; Bonaventura Clotet; Suzie Coughlan; Zehava Grossman; Andrzej Horban; Klaus Korn; Leondios Kostrikis; Claus Nielsen; Dimitrios Paraskevis; Mario Poljak; Elisabeth Puchhammer-Stöckl; Chiara Riva; Lidia Ruiz; Mika Salminen; Rob Schuurman; Anders Sonnerborg; Danica Stanekova; Maja Stanojevic; Anne-Mieke Vandamme; Charles A B Boucher
Journal:  J Infect Dis       Date:  2009-11-15       Impact factor: 5.226

7.  Prevalence and clinical significance of HIV drug resistance mutations by ultra-deep sequencing in antiretroviral-naïve subjects in the CASTLE study.

Authors:  Max Lataillade; Jennifer Chiarella; Rong Yang; Steven Schnittman; Victoria Wirtz; Jonathan Uy; Daniel Seekins; Mark Krystal; Marco Mancini; Donnie McGrath; Birgitte Simen; Michael Egholm; Michael Kozal
Journal:  PLoS One       Date:  2010-06-03       Impact factor: 3.240

8.  The combined effect of modern highly active antiretroviral therapy regimens and adherence on mortality over time.

Authors:  Viviane D Lima; Richard Harrigan; David R Bangsberg; Robert S Hogg; Robert Gross; Benita Yip; Julio S G Montaner
Journal:  J Acquir Immune Defic Syndr       Date:  2009-04-15       Impact factor: 3.731

9.  Pre-existing minority drug-resistant HIV-1 variants, adherence, and risk of antiretroviral treatment failure.

Authors:  Roger Paredes; Christina M Lalama; Heather J Ribaudo; Bruce R Schackman; Cecilia Shikuma; Francoise Giguel; William A Meyer; Victoria A Johnson; Susan A Fiscus; Richard T D'Aquila; Roy M Gulick; Daniel R Kuritzkes
Journal:  J Infect Dis       Date:  2010-03       Impact factor: 5.226

10.  Emergence of drug resistance is associated with an increased risk of death among patients first starting HAART.

Authors:  Robert S Hogg; David R Bangsberg; Viviane D Lima; Chris Alexander; Simon Bonner; Benita Yip; Evan Wood; Winnie W Y Dong; Julio S G Montaner; P Richard Harrigan
Journal:  PLoS Med       Date:  2006-09       Impact factor: 11.069

View more
  22 in total

1.  Re-treatment of chronic hepatitis C virus genotype 1 infection after relapse: an open-label pilot study.

Authors:  Anu Osinusi; Anita Kohli; Miriam M Marti; Amy Nelson; Xiaozhen Zhang; Eric G Meissner; Rachel Silk; Kerry Townsend; Phillip S Pang; G Mani Subramanian; John G McHutchison; Anthony S Fauci; Henry Masur; Shyam Kottilil
Journal:  Ann Intern Med       Date:  2014-11-04       Impact factor: 25.391

2.  Phenotype, Genotype, and Drug Resistance in Subtype C HIV-1 Infection.

Authors:  Anne Derache; Carole L Wallis; Saran Vardhanabhuti; John Bartlett; Nagalingeswaran Kumarasamy; David Katzenstein
Journal:  J Infect Dis       Date:  2015-07-14       Impact factor: 5.226

3.  Ultra-Deep Sequencing Analysis on HIV Drug-Resistance-Associated Mutations Among HIV-Infected Individuals: First Report from the Philippines.

Authors:  Ivo N SahBandar; Genesis Samonte; Elizabeth Telan; Nalyn Siripong; Mahdi Belcaid; David Schanzenbach; Susan Leano; Haorile Chagan-Yasutan; Toshio Hattori; Cecilia M Shikuma; Lishomwa C Ndhlovu
Journal:  AIDS Res Hum Retroviruses       Date:  2017-07-05       Impact factor: 2.205

Review 4.  Diagnosis of Human Immunodeficiency Virus Infection.

Authors:  Bharat S Parekh; Chin-Yih Ou; Peter N Fonjungo; Mireille B Kalou; Erin Rottinghaus; Adrian Puren; Heather Alexander; Mackenzie Hurlston Cox; John N Nkengasong
Journal:  Clin Microbiol Rev       Date:  2018-11-28       Impact factor: 26.132

5.  Absence of putative artemisinin resistance mutations among Plasmodium falciparum in Sub-Saharan Africa: a molecular epidemiologic study.

Authors:  Steve M Taylor; Christian M Parobek; Derrick K DeConti; Kassoum Kayentao; Sheick Oumar Coulibaly; Brian M Greenwood; Harry Tagbor; John Williams; Kalifa Bojang; Fanta Njie; Meghna Desai; Simon Kariuki; Julie Gutman; Don P Mathanga; Andreas Mårtensson; Billy Ngasala; Melissa D Conrad; Philip J Rosenthal; Antoinette K Tshefu; Ann M Moormann; John M Vulule; Ogobara K Doumbo; Feiko O Ter Kuile; Steven R Meshnick; Jeffrey A Bailey; Jonathan J Juliano
Journal:  J Infect Dis       Date:  2014-09-01       Impact factor: 5.226

6.  ViVaMBC: estimating viral sequence variation in complex populations from illumina deep-sequencing data using model-based clustering.

Authors:  Bie Verbist; Lieven Clement; Joke Reumers; Kim Thys; Alexander Vapirev; Willem Talloen; Yves Wetzels; Joris Meys; Jeroen Aerssens; Luc Bijnens; Olivier Thas
Journal:  BMC Bioinformatics       Date:  2015-02-22       Impact factor: 3.169

7.  Contribution of human immunodeficiency virus type 1 minority variants to reduced drug susceptibility in patients on an integrase strand transfer inhibitor-based therapy.

Authors:  Richard M Gibson; Jan Weber; Dane Winner; Michael D Miller; Miguel E Quiñones-Mateu
Journal:  PLoS One       Date:  2014-08-11       Impact factor: 3.240

8.  HIV Drug Resistance Mutations (DRMs) Detected by Deep Sequencing in Virologic Failure Subjects on Therapy from Hunan Province, China.

Authors:  Xi Chen; Xiaobai Zou; Jianmei He; Jun Zheng; Jennifer Chiarella; Michael J Kozal
Journal:  PLoS One       Date:  2016-02-19       Impact factor: 3.240

9.  Longitudinal Detection and Persistence of Minority Drug-Resistant Populations and Their Effect on Salvage Therapy.

Authors:  Masako Nishizawa; Masakazu Matsuda; Junko Hattori; Teiichiro Shiino; Tetsuro Matano; Walid Heneine; Jeffrey A Johnson; Wataru Sugiura
Journal:  PLoS One       Date:  2015-09-11       Impact factor: 3.240

10.  An Efficient Microarray-Based Genotyping Platform for the Identification of Drug-Resistance Mutations in Majority and Minority Subpopulations of HIV-1 Quasispecies.

Authors:  Verónica Martín; Celia Perales; María Fernández-Algar; Helena G Dos Santos; Patricia Garrido; María Pernas; Víctor Parro; Miguel Moreno; Javier García-Pérez; José Alcamí; José Luis Torán; David Abia; Esteban Domingo; Carlos Briones
Journal:  PLoS One       Date:  2016-12-13       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.