The anthrax protective antigen (PA) is an 83 kDa protein that is one of three protein components of the anthrax toxin, an AB toxin secreted by Bacillus anthracis. PA is capable of undergoing several structural changes, including oligomerization to either a heptameric or octameric structure called the prepore, and at acidic pH a major conformational change to form a membrane-spanning pore. To follow these structural changes at a residue-specific level, we have conducted initial studies in which we have biosynthetically incorporated 5-fluorotryptophan (5-FTrp) into PA, and we have studied the influence of 5-FTrp labeling on the structural stability of PA and on binding to the host receptor capillary morphogenesis protein 2 (CMG2) using (19)F nuclear magnetic resonance (NMR). There are seven tryptophans in PA, but of the four domains in PA, only two contain tryptophans: domain 1 (Trp65, -90, -136, -206, and -226) and domain 2 (Trp346 and -477). Trp346 is of particular interest because of its proximity to the CMG2 binding interface, and because it forms part of the membrane-spanning pore. We show that the (19)F resonance of Trp346 is sensitive to changes in pH, consistent with crystallographic studies, and that receptor binding significantly stabilizes Trp346 to both pH and temperature. In addition, we provide evidence that suggests that resonances from tryptophans distant from the binding interface are also stabilized by the receptor. Our studies highlight the positive impact of receptor binding on protein stability and the use of (19)F NMR in gaining insight into structural changes in a high-molecular weight protein.
The anthrax protective antigen (PA) is an 83 kDa protein that is one of three protein components of the anthrax toxin, an AB toxin secreted by Bacillus anthracis. PA is capable of undergoing several structural changes, including oligomerization to either a heptameric or octameric structure called the prepore, and at acidic pH a major conformational change to form a membrane-spanning pore. To follow these structural changes at a residue-specific level, we have conducted initial studies in which we have biosynthetically incorporated 5-fluorotryptophan (5-FTrp) into PA, and we have studied the influence of 5-FTrp labeling on the structural stability of PA and on binding to the host receptor capillary morphogenesis protein 2 (CMG2) using (19)F nuclear magnetic resonance (NMR). There are seven tryptophans in PA, but of the four domains in PA, only two contain tryptophans: domain 1 (Trp65, -90, -136, -206, and -226) and domain 2 (Trp346 and -477). Trp346 is of particular interest because of its proximity to the CMG2 binding interface, and because it forms part of the membrane-spanning pore. We show that the (19)F resonance of Trp346 is sensitive to changes in pH, consistent with crystallographic studies, and that receptor binding significantly stabilizes Trp346 to both pH and temperature. In addition, we provide evidence that suggests that resonances from tryptophans distant from the binding interface are also stabilized by the receptor. Our studies highlight the positive impact of receptor binding on protein stability and the use of (19)F NMR in gaining insight into structural changes in a high-molecular weight protein.
The anthrax protective antigen
(PA) is one of three protein components of the anthrax toxin, an AB
toxin secreted by Bacillus anthracis. PA is a four-domain
protein that binds to host cellular receptors,[1−3] and the proteolytic
cleavage of domain 1 by a cell-surface furin-like protease[4] generates a 63 kDa fragment, which then oligomerizes
into a heptameric[5] or octameric[6] doughnut-shaped structure called the prepore.
Formation of the prepore creates binding sites for the two enzymatic
components of the anthrax toxin, edema factor (EF) and lethal factor
(LF). The complex is endocytosed into the cell, and within an acidified
late endosomal compartment, the prepore undergoes a major conformational
change, forming a membrane-spanning β-barrel pore.[7,8] The pore provides a conduit for entry of EF and LF into the cell
cytosol.[9]The structures of the 83
kDa form of PA, in the unbound form or
bound to host cellular receptor capillary morphogenesis protein 2
(CMG2), have been determined.[5,10,11] The latter structure published by Santelli and co-workers showed
that the binding interface is largely comprised of domain 4, but that
a small loop within domain 2 (domain 2β3–2β4 loop, residues 340–348) binds within a groove on the
surface of CMG2. From biochemical experiments by Benson and Nassi,[8,12] this loop is projected to form part of the long β-barrel pore,
and because of its interaction with the receptor, it was postulated
that the receptor sterically inhibits the process of pore formation.
Therefore, this loop must dissociate from the receptor to allow pore
formation to occur.[5,13] Early crystallographic evidence
suggested that in the monomeric form of PA, this loop becomesdisordered
at low pH,[10] and biochemical experiments
have also suggested that interactions with this loop dictate the pH
threshold for pore formation, that the loss of contacts (via mutagenesis)
between PA and this loop increases the pH requisite for pore formation.[14] In addition, recent saturation transfer experiments
monitoring resonances in CMG2 that contact the domain 2 loop in the
heptameric form of PA suggest that these contacts are weakened as
the pH is lowered, supporting the view that this loop is sensitive
to pH.[15]Here, we have labeled PA
with 5-fluorotryptophan (5-FTrp) and have
studied the impact of labeling on structure and stability, using tryptophan
fluorescence, circular dichroism, X-ray crystallography, and19F nuclear magnetic resonance (NMR). We also determined the
effect of receptor binding on the stability to pH and temperature
using 19F NMR. There are seven tryptophans located in two
of the four domains of PA: domain 1 (residues 1–258), which
includes the 20 kDa PA20 domain formed after cleavage by
furin C-terminal to Arg167[16] and includes
Trp65, -90, -136, -206, and -226; and domain 2 (residues 259–487),
which includes Trp346 andTrp477. Trp346 is part of the domain 2β3–2β4 loop and is closest to the CMG2
binding interface.19F NMR is a powerful tool for
studying the structure
and function of proteins, as it provides residue-specific information
about environmental perturbations around each fluorine nucleus.[17,18] On the basis of our 19F NMR studies, we show that the
Trp346 resonance undergoes conformational exchange at low pH, with
very little change in the other 19F resonances, providing
further support that the domain 2β3–2β4 loop is particularly sensitive to pH. In addition, we show
that receptor binding stabilizes the Trp346 resonance to variations
in pH and temperature along with other tryptophan residues that are
more distant from the binding interface. Finally, we have determined
the structure of 5-FTrp-labeled PA to 1.7 Å resolution, which
exhibits nearly identical structural properties as the WT protein.
Our studies highlight the use of 19F NMR to follow structural
changes at a residue-specific level in a relatively high molecular
weight protein and the positive impact of receptor binding on global
protein stabilization.
Experimental Procedures
Materials
Urea
(electrophoresis grade) and5-fluorotryptophan
were obtained from Sigma (St. Louis, MO). The urea concentration was
determined by the refractive index at room temperature, and the urea
was stored at −80 °C until the day of the experiment.
All other chemicals prepared were reagent grade. Escherichia
coli strain DL41 was obtained as a gift from the Yale E. coli genetic stock center.
Plasmid Construction and
Mutagenesis
Plasmid pQE80-PA83 was used for generating
mutations within the pa sequence.[19] We used the following forward
primers (SigmaGenosys, purified via high-performance liquid chromatography)
to create the mutants Trp206Tyr (CGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCACCATACATTTCTAATATTCATGAAAAGAAAGG),
Trp226Phe (TCTCCTGAAAAATTCAGCACGGCTTCTGATCCGTACAGTGATTTCG),
Trp346Tyr (CATTCACTATCTCTAGCAGGGGAAAGAACTTACGCTGAAACAATGGG),
andTrp477Phe (GAGTGAGGGTGGATACAGGCTCGAACTTTAGTGAAGTGTTACCGC)
and the corresponding reverse strands using the Quickchange mutagenesis
kit from Stratagene. Sequences were confirmed at the Protein Nucleic
Acid Laboratory (PNACL) at Washington University in St. Louis (St.
Louis, MO).
Protein Production
The pQE80-PA83 plasmid
was transformed into E. colitryptophan auxotrophic
strain DL41 grown in the presence of 100 μg/mL ampicillin. Cells
were grown in a defined medium that is identical to ECPM1, but substituting
the casamino acids for defined amino acids.[18] The tryptophan concentration was 0.25 mM. Cells were grown to an
optical density (OD600) of 3.0 at 32 °C. The cells
then were washed twice with 0.9% NaCl; then the same medium containing
0.25 mM 5-FTrp in place of tryptophan was added to the cells, and
the cells were resuspended. The cells were then incubated for 10 min
prior to the addition of IPTG to a final concentration of 1 mM at
26 °C, and grown for an additional 2–3 hours prior to
harvesting.
Protein Purification
For the preparation
of PA, after
the OD had reached 6.0, bacterial cells were centrifuged and resuspended
in a buffer containing 20 mM Tris-HCl (pH 8.0), 20% sucrose, and 1
mM EDTA for 15 min at room temperature. The cells were centrifuged
for 15 min at 8000g and 4 °C, and the pellet
was resuspended in ice-cold 5 mM MgSO4. Before centrifugation,
1 M Tris-HCl (pH 8.0) was added to a final concentration of 20 mM,
and cells were again centrifuged at 4 °C (8000g). The supernatant was filtered (0.2 μM, Millipore) and applied
to a Hi-Trap Q anion exchange column pre-equilibrated in 20 mM Tris-HCl
(pH 8.0) at 4 °C. PA was eluted with a NaCl gradient on an Aktä
Prime LC system. Fractions were concentrated using an Amicon Ultra-15
10 kDa centrifugal filter (Millipore) and then applied to a Sephadex
S-200 gel filtration column pre-equilibrated in 20 mM Tris-HCl and
150 mM NaCl (pH 8.0) at 4 °C. Pure protein fractions were identified
using sodium dodecyl sulfate–polyacrylamide gel electrophoresis
(SDS-PAGE), pooled, and concentrated. CMG2 was prepared and purified
as described previously.[20] Purification
of PA20 was conducted using a trypsin nicking protocol,
whereby 10 mg of PA or 5-FTrpPA was digested with 10 μg of Trypzean
(Sigma) for 30 min at room temperature, followed by the addition of
an excess of soybean trypsin inhibitor (100 μg) on ice. The
PA20 was purified over a H-Trap Q column equilibrated in
20 mM Tris (pH 8.5) and 1 mM CaCl2, eluting with a NaCl
gradient.
Fluorescence
Data were recorded on a Cary Eclipse spectrofluorimeter
equipped with a Peltier cooling system, using an excitation wavelength
of 280 or 295 nm with slit widths set at 5 nm for both excitation
and emission. All measurements were taken at 20 °C in a 50 mM
Tris/25 mM MES/25 mM acetic acid buffer system, using 1 μM for
pH experiments and 0.8 μM for the urea denaturation experiments.
For the pH andurea experiments, only 295 nm excitation was used,
recording emission data for the WT at 330 or 333 nm for the 5-FTrp-labeled
PA or PA20 proteins, and the data are an average of five
scans from 300 to 600 nm. All samples were incubated overnight at
the respective pH or urea concentrations to allow for adequate equilibration.
For the pH experiments, the solid lines through the data points are
nonlinear least-squares fits of the data to the Henderson–Hasselbalch
equation to give an apparent pKa for the
pH transition. For the urea denaturation experiments, in the case
of the full-length PA proteins, the data were fit to a three-state
transition as described previously.[19] For
the PA20urea denaturation experiments, the denaturation
curves were fit to a two-state model with sloping baselines according
to the model described by Clarke and Fersht.[21] The curves were fit using Kaleidagraph version 3.6 (Synergy Software,
Reading, PA).
Circular Dichroism (far UV)
Measurements
were performed
using a Jasco J810 spectropolarimeter. Spectra were measured in 10
mM HEPES (pH 8.0) at a concentration of 8 μM, using a 0.1 cm
path length cell. The response time was 2 s, and the scan rate was
20 nm/min.
19F NMR Spectroscopy
Spectra were acquired
on a Varian INOVA 400 MHz spectrometer equipped with a tunable inverse
detection probe. Spectra were recorded at 20 °C unless otherwise
indicated, and sample concentrations were typically in the 200 μM
range in 50 Tris/25 mM Mes/25 mM AcOH buffer (pH 8.0) with 10% D2O added for a field frequency lock. Spectra were acquired
using a 90° pulse width and a recycle delay of 5 s and were referenced
to an internal standard of 4-fluorophenylalanine as described previously.[22] Spectra typically required >10000 transients
for adequate peak visualization and were processed with 10 Hz of line
broadening.
MTSL Spin-Labeling
The 5-FTrpPAGlu712Cys protein was
expressed and purified as described previously.[11] We added 1 mM DTT to the final MgSO4/Tris (pH
8.0) step in the isolation of periplasm, and column buffers for purification
included 1 mM DTT. The 5-FTrpPA was purified and the DTT removed by
loading the protein solution onto a PD-10 column equilibrated with
buffer containing 20 mM HEPES (pH 7.25) and 150 mM NaCl and then eluted
using the same buffer. Immediately after purification, a 10-fold molar
excess of MTSL [S-(2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl methanesulfonothioate] in methanol
was added for 30 min at room temperature; then an additional 10-fold
molar excess of MTSL was added, and this solution was incubated overnight
at 4 °C. The next day, MTSL was removed using an S-200 gel filtration
column equilibrated in 50 mM Tris/25 mM Mes/25 mM AcOH buffer (pH
8.0) at 4 °C. The sample was split into two aliquots, each containing
207 μL of PA, 50 μL of D2O, 1 μL of 10
mM p-fluorophenylalanine, and 217 μL of 50
mM Tris/25 mM Mes/25 mM acetic acid buffer. To one tube was added
25 μL of water, and to the other was added 25 μL of 100
mM TCEP. The final PA concentration in each tube was 150 μM.
Crystallization and Data Collection
5-FTrpPA was concentrated
to 10 mg/mL in 150 mM NaCl and 10 mM Tris (pH 8.0) for crystallization.
Screeing was conducted in Compact Jr. (Emerald biosystems) sitting
drop vapor diffusion plates at 20 °C using equal volumes of protein
and crystallization solution. Plate-shaped crystals (∼200 μm
× 100 μm) were obtained in 1 day from the Index HT screen
(Hampton Research) condition E8 [35% (v/v) pentaerythritol propoxylate
(5/4 PO/OH), 0.05 M HEPES (pH 7.5), and 0.2 M potassium chloride]
equilibrated against 100 μL of the crystallization solution
at 20 °C. Single crystals were transferred to a fresh drop of
the crystallization solution (Index E8), which served as the cryoprotectant,
and frozen in liquid nitrogen prior to the collection of data. Initial
X-ray diffraction data were collected in house using a Bruker Microstar
microfocus rotating anode generator equipped with Helios MX multilayer
optics and a Platinum-135 CCD detector. Data were processed using
the Proteum2 software package (Bruker-AXS). High-resolution data were
collected at the Advanced Photon Source IMCA-CAT beamline 17ID using
a Dectris Pilatus 6M pixel array detector.
Structure Solution and
Refinement
Intensities were
integrated using XDS,[23] and Laue class
analysis and data scaling were performed with Aimless,[24] which suggested that the highest-probability
Laue class was mmm and space group P212121. The structure was determined
by molecular replacement with Molrep[25] using
a previously determined structure of the protective antigen as the
search model [Protein Data Bank (PDB) entry 3MHZ)] as the search
model. The in-house X-ray diffraction data, processed to 2.2 Å
resolution, were used for the initial structure solution and refinement,
and the higher-resolution synchrotron data were used for refinement
of the final model. Structure refinement using and manual model building
were conducted with Phenix[26] and Coot,[27] respectively. TLS refinement[28] was incorporated in the final stages to model anisotropic
motion. Structure validation was conducted with Molprobity,[29] and figures were prepared using the CCP4MG package.[30] Coordinates and structure factors for 5-FTrpPA
were deposited to the Protein Databank with the accession code 4NAM.
Results
PA was labeled with commercially available 5-FTrp using the tryptophan
auxotroph DL41, and proteins were >95% labeled as determined by
electrospray
mass spectrometry (ESI-MS) (Table S1 and Figure S1 of the Supporting Information). To determine the effect
of labeling on the structure and stability of PA, we compared labeled
and unlabeled proteins by far-UV circular dichroism (CD) to compare
secondary structural content and measured the stability of the proteins
to urea and pH using fluorescence. The fluorescence emission spectrum
(excitation at 280 or 295 nm) is shown in Figure 1A. The spectrum of the 5-FTrp-labeled PA (5-FTrpPA) is red-shifted
relative to that of the unlabeled WT by ∼8 nm, with excitation
at either 280 or 295 nm. We also observe an increase in the amplitude
of the emission spectrum of 5-FTrpPA via excitation at 280 or 295
nm compared to that of the unlabeled WT protein, with an increase
that is somewhat smaller than those observed in other studies labeling
with this amino acid.[31] The CD spectra
of the WT and labeled proteins were similar (Figure 1B), except for the absence of a small shoulder in the 5-FTrpPA
spectrum at 198 nm.
Figure 1
Effect of 5-FTrp labeling on the spectroscopic properties
and stability
to urea and pH of PA. (A) Emission spectra (excitation at 280 or 295
nm) of WT PA and 5-FTrpPA at 1 μM in 50 mM Tris/25 mM Mes/25
mM AcOH buffer (pH 8.0) at 20 °C. (B) Circular dichroism spectra
of WT (―) and 5-FTrpPA (---) at 8 μM in 10 mM Hepes/OH
(pH 8.0) at 20 °C. (C) Unfolding of WT and 5-FTrpPA as a function
of pH at 0.8 μM in 50 mM Tris/25 mM Mes/25 mM AcOH buffer at
20 °C. Fluorescence data were acquired using an excitation wavelength
of 295 nm, and solid lines through the data are fits to the Henderson–Hasselbalch
equation. (D) Unfolding of WT (●) and 5-FTrpPA (○) as
a function of urea concentration. The inset shows unfolding of PA20 and 5-FTrpPA20. Data were collected in 50 mM
Tris/25 mM Mes/25 mM AcOH buffer (pH 8.0) at 20 °C, via excitation
at 295 nm and collection of the emission intensity at 330 nm (unlabeled)
and 333 nm (5-FTrp-labeled). The concentration of all proteins was
0.8 μM. Solid lines represent nonlinear least-squares fits to
the data.
Effect of 5-FTrp labeling on the spectroscopic properties
and stability
to urea and pH of PA. (A) Emission spectra (excitation at 280 or 295
nm) of WT PA and5-FTrpPA at 1 μM in 50 mM Tris/25 mM Mes/25
mM AcOH buffer (pH 8.0) at 20 °C. (B) Circular dichroism spectra
of WT (―) and5-FTrpPA (---) at 8 μM in 10 mM Hepes/OH
(pH 8.0) at 20 °C. (C) Unfolding of WT and5-FTrpPA as a function
of pH at 0.8 μM in 50 mM Tris/25 mM Mes/25 mM AcOH buffer at
20 °C. Fluorescence data were acquired using an excitation wavelength
of 295 nm, and solid lines through the data are fits to the Henderson–Hasselbalch
equation. (D) Unfolding of WT (●) and5-FTrpPA (○) as
a function of urea concentration. The inset shows unfolding of PA20 and5-FTrpPA20. Data were collected in 50 mM
Tris/25 mM Mes/25 mM AcOH buffer (pH 8.0) at 20 °C, via excitation
at 295 nm and collection of the emission intensity at 330 nm (unlabeled)
and 333 nm (5-FTrp-labeled). The concentration of all proteins was
0.8 μM. Solid lines represent nonlinear least-squares fits to
the data.We used fluorescence to determine
if the stability of PA to pH
andurea was affected by the incorporation of 5-FTrp (Figure 1C,D). The unfolding of 5-FTrpPA as a function of
pH is similar to that of the WT protein, with a pKapp of 5.3 compared to a pKapp of 5.8 for the WT protein. In contrast to pH unfolding, which exhibits
a single transition, the unfolding of PA and5-FTrpPA by urea at 20
°C and pH 8.0 exhibits two transitions, one with a midpoint (CM) at ∼1 M urea and a second that occurs
at a CM of ∼4 M urea.[19] The results from the pH andurea studies are
summarized in Table 1. The isolated PA20 (residues 1–167) (see below) domain exhibits an unfolding
transition that matches the second transition observed in the fluorescence
unfolding of PA (inset of Figure 1D), and thus,
we assign the unfolding of the PA63 region comprising domains
1′ to domain 4 (residues 168–734; domain 1′ includes
residues from the furin cleavage site to the beginning of domain 2)
to the first transition at 1 M urea and the unfolding of PA20 to the second, smaller amplitude transition that occurs at ∼4
M urea.
Table 1
Equilibrium Unfolding Thermodynamic
Parameters of WT and 5-FTrp-Labeled PA and PA20
experimenta
pKapp
ΔG°N↔I (kcal mol–1)
ΔG°I↔U (kcal mol–1)
mN↔I (kcal mol–1 M–1)
mI↔U (kcal mol–1 M–1)
CM,N↔I (M)
CM,I↔U (M)
WT PA
5.8 ± 0.06b
6.2 ± 0.9c
9.1 ± 3.4
4.8 ± 0.7
2.4 ± 0.9
1.3 ± 0.02
3.8 ± 0.1
5-FTrpPA
5.3 ± 0.05
3.8 ± 0.4
4.4 ± 0.5
3.2 ± 0.3
1.0 ± 0.1
1.2 ± 0.02
4.4 ± 0.2
ΔG°N↔Ud (kcal mol–1)
mN↔U (kcal mol–1 M–1)
CM,N↔U (M)
PA20
ND
7.4 ± 1.1
2.0 ± 0.3
3.7 ± 0.05
5-FTrpPA20
ND
5.0 ± 0.4
1.2 ± 0.1
4.2 ± 0.08
All data were recorded
at 20 °C
using a Cary Eclipse spectrofluorimeter.
Errors in pKapp were determined
by best fit to the Henderson–Hasselbalch
equation, and errors in m and CM were obtained from nonlinear least-squares fitting of the
data to a three-state model in Kaleidagraph.[19]
Errors in ΔG° were determined using the relationship [m2(seCM2) + CM2(sem2)]1/2, where seCM2 and sem2 are the standard
errors in CM and m, respectively.
PA20 ΔG° values were determined for a single two-state N
↔ U
transition with sloping baselines.[21]
All data were recorded
at 20 °C
using a Cary Eclipse spectrofluorimeter.Errors in pKapp were determined
by best fit to the Henderson–Hasselbalch
equation, and errors in m and CM were obtained from nonlinear least-squares fitting of the
data to a three-state model in Kaleidagraph.[19]Errors in ΔG° were determined using the relationship [m2(seCM2) + CM2(sem2)]1/2, where seCM2 and sem2 are the standard
errors in CM and m, respectively.PA20 ΔG° values were determined for a single two-state N
↔ U
transition with sloping baselines.[21]
Urea Unfolding of 5-FTrp-Labeled PA by NMR
and Assignment of
the PA20 Resonances
Figure 2A shows the 400 MHz 19F NMR spectrum of 5-FTrpPA at pH
8.0 and 20 °C. The spectrum shows at least nine separate resonances
with varying amplitudes and line widths over an ∼8 ppm range.
To make initial resonance assignments, we took advantage of the fact
that urea denaturation occurs with two separate transitions and postulated
that we may be able to identify those resonances that arise from PA20 by following the resonances as a function of urea concentration
(Figure 2B). The amplitudes of resonances at
−42.3, −42.9, −44.8, −45.6, and −49.4
ppm decrease, and those resonances disappear at ∼1.9 M urea.
However, the amplitudes of the small resonances at −43.4 and
−45.8 ppm increase up to ∼4 M urea, and then disappear
at 5.5 M urea, consistent with the second transition observed in the
fluorescence experiments. The amplitude of the resonance at −46.6
ppm increases, and the resonance shifts upfield to −46.8 ppm
up to 4 M urea; then a second shift to −47 ppm is observed
at 5.5 M urea. Because these latter resonances persist at higher denaturant
concentrations and generally follow the second transition observed
by fluorescence, we tentatively assigned these resonances to the PA20 domain. The resonance at −47.2 ppm, the magnitude
of which increases as the denaturant concentration is increased, was
assigned to denatured resonances, because it resonates close to the
frequency for free 5-FTrp (−47 ppm). Because the spectrum is
not proton-decoupled, we could not distinguish individual resonances
in the unfolded state at high urea concentrations, and therefore,
this resonance likely encompasses the sum denatured states of a majority
of the labeled tryptophans.
Figure 2
(A) 19F NMR spectrum of 5-FTrpPA
(230 μM). This
spectrum represents 12000 transients in 50 mM Tris/25 mM Mes/25 mM
AcOH buffer (pH 8.0) with 10% D2O. Data were referenced
to an internal standard of 0.02 mM pF-Phe and processed with 10 Hz
line broadening. (B) Urea denaturation of 5-FTrpPA as measured using 19F NMR. Each spectrum represents 7000 transients recorded
at 20 °C at 300 μM in 50 mM Tris/25 mM Mes/25 mM AcOH (pH
8.0) with 10% D2O. (C) Comparison of 19F NMR
spectra of 5-FTrp PA20 to that of full-length PA (PA83) at 3.2 M urea. The PA20 spectrum was recorded
at 150 μM and represents 16000 transients recorded at 20 °C.
Note that the resonances in PA83 at −43.5, −46,
and −46.8 ppm are at positions identical to those of PA20. Data were referenced to an internal standard of 0.02 mM
pF-Phe.
(A) 19F NMR spectrum of 5-FTrpPA
(230 μM). This
spectrum represents 12000 transients in 50 mM Tris/25 mM Mes/25 mM
AcOH buffer (pH 8.0) with 10% D2O. Data were referenced
to an internal standard of 0.02 mM pF-Phe and processed with 10 Hz
line broadening. (B) Urea denaturation of 5-FTrpPA as measured using 19F NMR. Each spectrum represents 7000 transients recorded
at 20 °C at 300 μM in 50 mM Tris/25 mM Mes/25 mM AcOH (pH
8.0) with 10% D2O. (C) Comparison of 19F NMR
spectra of 5-FTrpPA20 to that of full-length PA (PA83) at 3.2 M urea. The PA20 spectrum was recorded
at 150 μM and represents 16000 transients recorded at 20 °C.
Note that the resonances in PA83 at −43.5, −46,
and −46.8 ppm are at positions identical to those of PA20. Data were referenced to an internal standard of 0.02 mM
pF-Phe.On the basis of these observations,
we assigned the resonances
that disappear at ∼2 M urea to that of the PA63 region
and the remaining folded resonances that persist up to 4 M urea to
the PA20 domain. To confirm this assignment, we conducted
limited proteolysis of the labeled PA with trypsin, which can be used in lieu of furin to cleave PA20 from PA83, isolated PA20, and compared the resonances at 0 and
3.2 M urea to that of the WT protein (Figure 2C). First, the isolated PA20 without urea exhibits six
resonances for three tryptophans, suggesting these tryptophans are
in slow chemical exchange. Although these resonances show differences
in the number of peaks and chemical shifts relative to those of PA,
the resonances observed at 3.2 M urea are nearly identical in chemical
shift and intensity to that observed in the full-length protein. On
the basis of this comparison, we assign the resonances from the native
spectrum of PA (−43.4, −45.9, and −46.6 ppm)
to that of PA20.
Mutagenesis To Assign Resonances in the PA63 Region
At this point, we decided not to pursue
assignment of the PA20 resonances by mutagenesis but rather
focus on those resonances
that would be found in the heptameric prepore state. To assign the
resonances in the PA63 region, we introduced relatively
conserved mutations (Trp → Phe or Tyr) that in theory would
not disrupt stability or folding and thus not perturb the 19F NMR spectrum; the mutation would result only in a loss of one of
the resonance peaks.[32] The following mutants
were made: Trp206Tyr, Trp226Phe, Trp346Tyr, andTrp477Phe. We could
not produce the labeled Trp226Phe andTrp477Phe proteins, probably
because of an effect on the stability of the protein. Trp226 is relatively
solvent exposed but is located ∼5 Å from the two calcium
ions in the structure, and the carbonyl of Trp226 forms a hydrogen
bond with the amidehydrogen of Asp235, which coordinates one of the
calcium ions. Thus, a tryptophan at position 226 may provide a necessary
conformational constraint for calcium binding that cannot be achieved
if this residue is a phenylalanine. Trp477 is near the N-terminus
of the domain 2α3 helix that bridges interactions
with domain 3, and local contacts aroundTrp477 include Pro232 andTyr233 (domain 1′) andPro260, Pro373, andIleu459 (domain
2), forming a hydrophobic pocket. A phenylalanine at this position
may disrupt the local van der Waals contacts, potentially destabilizing
contacts that span a range of ∼200 residues.We could
produce the labeled Trp346Tyr, but only at very low levels. In initial
experiments, we tried labeling the Trp346Phe mutant for which we have
a three-dimensional crystal structure;[11] however, this labeled protein proved to be too unstable, and we
could not accumulate enough pure protein for a spectrum. We were able
to obtain enough labeled protein for a spectrum of Trp346Tyr (Figure 3A), but this mutant was also unstable and showed
significant chemical shift changes in the native spectrum that made
assignment of this resonance difficult. We note that the resonance
at −49.5 ppm is missing; however, this may have shifted downfield
to the new resonance that appears at −48 ppm.
Figure 3
19F NMR peak
assignment through mutagenesis. (A) 19F NMR spectra of
WT PA, Trp206Tyr PA, and Trp346Tyr PA. Data
were recorded at 20 °C and 230 μM (WT), 250 μM (Trp206Tyr),
or 200 μM (Trp346Tyr) in 50 mM Tris/25 mM Mes/25 mM AcOH buffer
(pH 8.0) with 10% D2O. Spectra represent 12000, 11000,
and 14000 transients, respectively, with a 5 s relaxation delay. (B)
Comparison of WT and Trp206Tyr at 3.2 M urea. Both are at 150 μM
and 16000 transients. Data were referenced to an internal standard
of 0.02 mM pF-Phe.
19F NMR peak
assignment through mutagenesis. (A) 19F NMR spectra of
WT PA, Trp206Tyr PA, andTrp346Tyr PA. Data
were recorded at 20 °C and 230 μM (WT), 250 μM (Trp206Tyr),
or 200 μM (Trp346Tyr) in 50 mM Tris/25 mM Mes/25 mM AcOH buffer
(pH 8.0) with 10% D2O. Spectra represent 12000, 11000,
and 14000 transients, respectively, with a 5 s relaxation delay. (B)
Comparison of WT andTrp206Tyr at 3.2 M urea. Both are at 150 μM
and 16000 transients. Data were referenced to an internal standard
of 0.02 mM pF-Phe.The Trp206Tyr protein
exhibits a spectrum that is nearly identical
to that of the WT labeled protein, and the only loss in intensity
that we observe is the loss of the small peak at −47.2 ppm
(Figure 3A). We had initially assigned this
resonance to a partially denatured form of PA that exists in the absence
of denaturant (Figure 3A) but may be due to
the Trp206 resonance. In any case, the lack of resonance intensity
for this tryptophan suggests that Trp206 may be undergoing moderately
fast chemical exchange, which could result in significant line broadening.
Consistent with this notion, the B factors in this
region are typically high across crystal structures of PA determined
to date, suggesting that this residue may be able to sample multiple
conformational environments.To determine whether the line broadening
of Trp206 was due to factors
that depended on the protein conformation, we purified both the labeled
PA andTrp206Tyr proteins and partially denatured these at 3.2 M urea,
which is at the midpoint between the two identified transitions. The
addition of denaturant to the approximate midpoint of the transition
should lead to unfolded resonances corresponding to Trp206, -226,
-346, and -477, while the resonances corresponding to PA20 should remain largely folded. For Trp206Tyr, the unfolded resonance
should exhibit a smaller amplitude, corresponding to the loss of a
single fluorine. At 3.2 M urea, we observe a major resonance at −47.2
ppm, and three smaller resonances (−43.6, −46, and −47
ppm) (Figure 3B). The three smaller resonances
we attribute to the PA20 domain (see Figure 3B for comparison). Importantly, at 3.2 M urea, we observe
a loss in the unfolded resonance intensity, likely due to the loss
of a fluorine resonance from the Trp206Tyr mutation.
Crystallization
of the 5-FTrp-Labeled W206Y Mutant
To further determine if
there are structural changes upon labeling,
we crystallized the W206Y mutant, the structure of which was determined
to 1.7 Å resolution. The structure is shown in Figure 4, and data collection and refinement statistics
are listed in Table 2. The structure overlays
well with those of the WT and 2-FHis-labeled protein (PDB entries 3Q8B and 3MHZ, respectively),
again indicating that 5-FTrp labeling only minimally perturbs the
structure of the protein. However, there are some subtle structural
changes and new contacts to the fluorine atoms that are formed, in
particular within the PA20 domain.
Figure 4
(A) X-ray crystal structure
of 5-FTrpPA (Trp206Tyr) refined to
1.7 Å resolution. The positions of the 5-fluorotryptophan (FTrp)
(gray) and Tyr206 residue are represented as cylinders. PA is colored
as follows: magenta for the PA20 portion of domain 1, orange
for domain 1′, green for domain 2, blue for domain 3, and cyan
for domain 4. The domain 2β2–2β4 loop that contacts the receptor is colored red, and Ca2+ ions are shown as gold spheres. (B) Superposition of WT
PA (PDB entry 3Q8B) drawn in worm style (gray). The Trp residues in WT PA are colored
green. (C) Representative electron density map (Fo – Fc omit) for residue
FTrp 226 contoured at 3σ. (D) Loop spanning Ser168–Val175
that could be traced to the electron density in the current structure.
(E) Thr169 in the PA 5-FTrp structure (magenta) would clash with Asp93
as shown for PDB entries 3MHZ (green) and 3Q8B (cyan). Therefore, Asp93 in PA 5-FTrp is moved away
from the Ser168–Val175 loop as indicated by the arrow. Note
that the side chain was disordered for Asp93 in the PA 5-FTrp structure.
This results in a change in the backbone carbonyl conformation of
Asp92 as indicated by the asterisks. (F) Contacts between Lys117 and
the Ser168–Val175 loop. A water-mediated contact is formed
with Thr174.
Table 2
Crystallographic
Data for Protective
Antigen 5-FTrp (W206Y)
Data Collection
unit cell parameters (Å)
a = 71.30, b = 93.95, c = 117.70
space group
P212121
resolution (Å)a
46.98–1.70 (1.73–1.70)
wavelength (Å)
1.0000
temperature (K)
100
no. of observed reflections
348394
no. of unique reflections
86339
⟨I/σ(I)⟩a
12.4 (1.8)
completeness (%)a
99.8 (99.0)
multiplicitya
4.0 (4.1)
Rmerge (%)a,b
6.6 (71.7)
Rmeas (%)a,d
7.6 (83.5)
Rpim (%)a,d
3.7 (39.8)
CC1/2a,e
0.998 (0.792)
Refinement
resolution (Å)a
46.98–1.70
no. of reflections (working/test)a
78632/4149
Rfactor/Rfree (%)a,c
17.9/20.9
no. of atoms (protein/Ca2+/water)
5351/2/400
Model Quality
rmsd
bond lengths
(Å)
0.009
bond angles (deg)
1.108
average B factor (Å2)
all atoms
27.4
protein
27.2
Ca2+
13.5
water
29.6
coordinate error (maximum
likelihood) (Å)
0.15
Ramachandran
plot (%)
most favored
96.9
additionally
allowed
3.1
Values in parentheses
are for the
highest-resolution shell.
Rmerge = ∑∑|I(hkl) – ⟨I(hkl)⟩|/∑∑I(hkl), where I(hkl) is
the intensity measured for the ith reflection and
⟨I(hkl)⟩ is the average
intensity of all reflections with indices hkl.
Rfactor = ∑||Fobs(hkl)| – |Fcalc(hkl)||/∑|Fobs(hkl)|; Rfree is calculated in an identical manner using
5% of the randomly selected reflections that were not included in
the refinement.
Rmeas equals the redundancy-independent (multiplicity-weighted) Rmerge.[24,40]Rpim equals the precision-indicating (multiplicity-weighted) Rmerge.[41,42]
CC1/2 is the correlation
coefficient of the mean intensities between two random half-sets of
data.[43,44]
(A) X-ray crystal structure
of 5-FTrpPA (Trp206Tyr) refined to
1.7 Å resolution. The positions of the 5-fluorotryptophan (FTrp)
(gray) andTyr206 residue are represented as cylinders. PA is colored
as follows: magenta for the PA20 portion of domain 1, orange
for domain 1′, green for domain 2, blue for domain 3, and cyan
for domain 4. The domain 2β2–2β4 loop that contacts the receptor is colored red, andCa2+ ions are shown as gold spheres. (B) Superposition of WT
PA (PDB entry 3Q8B) drawn in worm style (gray). The Trp residues in WT PA are colored
green. (C) Representative electron density map (Fo – Fc omit) for residue
FTrp 226 contoured at 3σ. (D) Loop spanning Ser168–Val175
that could be traced to the electron density in the current structure.
(E) Thr169 in the PA5-FTrp structure (magenta) would clash with Asp93
as shown for PDB entries 3MHZ (green) and 3Q8B (cyan). Therefore, Asp93 in PA5-FTrp is moved away
from the Ser168–Val175 loop as indicated by the arrow. Note
that the side chain was disordered for Asp93 in the PA5-FTrp structure.
This results in a change in the backbone carbonyl conformation of
Asp92 as indicated by the asterisks. (F) Contacts between Lys117 and
the Ser168–Val175 loop. A water-mediated contact is formed
with Thr174.Values in parentheses
are for the
highest-resolution shell.Rmerge = ∑∑|I(hkl) – ⟨I(hkl)⟩|/∑∑I(hkl), where I(hkl) is
the intensity measured for the ith reflection and
⟨I(hkl)⟩ is the average
intensity of all reflections with indices hkl.Rfactor = ∑||Fobs(hkl)| – |Fcalc(hkl)||/∑|Fobs(hkl)|; Rfree is calculated in an identical manner using
5% of the randomly selected reflections that were not included in
the refinement.Rmeas equals the redundancy-independent (multiplicity-weighted) Rmerge.[24,40]Rpim equals the precision-indicating (multiplicity-weighted) Rmerge.[41,42]CC1/2 is the correlation
coefficient of the mean intensities between two random half-sets of
data.[43,44]For example, when comparing the structure of 5-FTrp to those of
the WT (PDB entry 3Q8B) and2-fluorohistidine-labeled (PDB entry 3MHZ) forms,[33,34] we noticed that particular regions could be traced to the electron
density maps in the former that were disordered in the latter two
structures. This includes the Lys72-Lys73 backbone, Glu51–Glu54,
and the Ser168–Val175 loop. The Ser168–Val175 loop is
in the proximity (3.5–4.0 Å) of Trp90 (Figure 4D). This results in a conformational change in the
nearby loop spanning Trp90–Gln94 relative to PDB entries 3Q8B and 3MHZ. Specifically, Asp93
moves away from the Ser168–Val175 loop as it would clash with
Thr169, which results in a change in the backbone conformation at
Asp92 (Figure 4E). This permits the formation
of a water-mediated contact to the backbone carbonyl of Gln115. Stabilization
of the Ser168–Val175 loop occurs by interactions with Lys117
as shown in Figure 4F.
Assignment of the Trp346
Resonance Using PRE
Because
of the instability of the Trp346Tyr mutant, we could not conclusively
assign this resonance (Figure 3) and thus used
paramagnetic relaxation enhancement (PRE) to aid us in assigning this
resonance. We did this by generating a cysteine mutant of a nearby
residue located in domain 4, Glu712Cys. There are no cysteines naturally
in PA, and thus the Glu712Cys mutant is the only residue available
for labeling and does not affect the function of PA.[11,35] The Cα–Cα distance between Glu712Cys andTrp346
is ∼16 Å (Figure 5), within the
range for which PRE can be observed.[36]
Figure 5
19F NMR peak assignment through paramagnetic relaxation
enhancement. Glu712Cys PA was labeled with the nitroxide spin-label
MTSL. Cys712 is the only cysteine present in PA. The closest tryptophan
to Cys712 is Trp346, and the Cα–Cα distance is
16.1 Å (top). Spectra with or without the reducing agent TCEP
are shown. Data were recorded at 20 °C and 150 μM in 50
mM Tris/25 mM Mes/25 mM AcOH buffer (pH 8.0) with 10% D2O. Spectra represent 8800 transients, with a 5 s relaxation delay.
Data were referenced to an internal standard of 0.02 mM pF-Phe.
19F NMR peak assignment through paramagnetic relaxation
enhancement. Glu712CysPA was labeled with the nitroxide spin-label
MTSL. Cys712 is the only cysteine present in PA. The closest tryptophan
to Cys712 is Trp346, and the Cα–Cα distance is
16.1 Å (top). Spectra with or without the reducing agent TCEP
are shown. Data were recorded at 20 °C and 150 μM in 50
mM Tris/25 mM Mes/25 mM AcOH buffer (pH 8.0) with 10% D2O. Spectra represent 8800 transients, with a 5 s relaxation delay.
Data were referenced to an internal standard of 0.02 mM pF-Phe.We labeled Glu712Cys with MTSL
[S-(2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl methanesulfonothioate] and compared
the spectrum of MTSL-labeled PA to that of MTSL-labeled PA treated
with TCEP, which reduces the paramagnetic nitroxide spin-label to
a diamagnetic species.[37] The 19F NMR spectrum of MTSL-labeled PA, in the absence and presence of
TCEP, is shown in Figure 5. The resonance at
−49.5 ppm exhibited the largest increase in amplitude in the
presence of TCEP, and thus, we assigned this resonance to Trp346.
Assignment of this tryptophan was also corroborated by measurements
of pH sensitivity and receptor binding (see below).
19F NMR Experiments as a Function of pH
Figure 6A shows the effect of pH on the resonances
of PA. The most dramatic change is the loss of the Trp346 resonance
at low pH (pH 5), and this is most likely due to an increase in the
level of chemical exchange. We did not observe a significant loss
of the other remaining resonances, suggesting that this resonance
alone was sensitive to pH. We also note that the intensity of the
unfolded resonance at −47.2 ppm increases as the pH is lowered,
which is concomitant with the decrease in intensity observed for the
folded Trp346 resonance. We reasoned that, because the domain 2β3–2β4 loop binds in a groove on the
receptor surface, receptor binding should result in an environmental
change in Trp346. Furthermore, receptor binding results in stabilizing
contacts to the domain 2β3–2β4 loop[13] and is known to stabilize the
prepore against variations in pH that result in pore formation (pH
5–6),[14] and thus, the Trp346 should
be less prone to undergoing chemical exchange when it is bound to
the receptor. In Figure 6B, we compare spectra
of PA and PA with a 2-fold excess of CMG2 at pH 8.0 and 5.0. There
is a substantial chemical shift change in the Trp346 resonance (from
−49.6 to −49 ppm) at pH 8.0, but very little change
in the other resonances, again indicating that the resonance at −49.6
ppm is the Trp346 resonance. At pH 5, the resonance has moved to −49.4
ppm but remains visible, and there is a lack of a discernible unfolded
resonance. This indicates that receptor binding has stabilized the
protein to variations in pH.
Figure 6
19F NMR spectra of 5-FTrpPA alone
(A) and in the presence
of the host receptor capillary morphogenesis protein 2 (CMG2) (B)
as a function of pH. Spectra in panel A represent 12000 transients
and were recorded at 5 °C and 250 μM in 50 mM Tris/25 mM
Mes/25 mM AcOH buffer with 10% D2O and referenced to an
internal standard of pF-Phe (0.02 mM). In panel B, spectra represent
16000 transients and were recorded as described for panel A but with
150 μM 5-FTrpPA and 300 μM CMG2.
19F NMR spectra of 5-FTrpPA alone
(A) and in the presence
of the host receptor capillary morphogenesis protein 2 (CMG2) (B)
as a function of pH. Spectra in panel A represent 12000 transients
and were recorded at 5 °C and 250 μM in 50 mM Tris/25 mM
Mes/25 mM AcOH buffer with 10% D2O and referenced to an
internal standard of pF-Phe (0.02 mM). In panel B, spectra represent
16000 transients and were recorded as described for panel A but with
150 μM 5-FTrpPA and 300 μM CMG2.
19F NMR Experiments as a Function of Temperature
We wanted to further explore the effect of receptor binding on
the structure of the protein, focusing on the temperature dependence
of the resonances. Our expectation was that the Trp346 resonance would
experience an increase in the level of chemical exchange as the temperature
increased, reducing the resonance amplitude. The results of our temperature
experiments in the absence of receptor are shown in Figure 7A and in the presence of receptor in Figure 7B. In Figure 7A, the amplitudes
of two of the resonances that correspond to PA20 (−43.4
and −45.9 ppm) undergo a sharp increase at 37 °C. Also,
at 37 °C, the unfolded resonance (−47.2 to −47.6
ppm) appears as a broad peak with four distinct resonances. These
are likely the unfolded resonances within the PA63 region.
For Trp346, this resonance experienced the largest chemical shift
change, moving from −49.6 ppm at 5 °C to −49.2
ppm at 37 °C. With the exception of the PA20 resonances,
the amplitude of the resonances decreased as the temperature increased,
and by the same degree. Thus, Trp346 seemed to be as sensitive to
temperature as the remaining PA63 resonances.
Figure 7
19F NMR spectra of 5-FTrpPA alone (A) and in the presence
of the host receptor capillary morphogenesis protein 2 (CMG2) (B)
as a function of temperature. Spectra in panel A represent 12000 transients
at 250 μM in 50 mM Tris/25 mM Mes/25 mM AcOH buffer with 10%
D2O. In panel B, spectra represent 9000 transients and
were recorded as described for A but with 300 μM 5-FTrpPA and
600 μM CMG2. Note the lack of an unfolded resonance at 37 °C
in panel B compared to panel A. Data were referenced to an internal
standard of 0.1 mM pF-Phe.
19F NMR spectra of 5-FTrpPA alone (A) and in the presence
of the host receptor capillary morphogenesis protein 2 (CMG2) (B)
as a function of temperature. Spectra in panel A represent 12000 transients
at 250 μM in 50 mM Tris/25 mM Mes/25 mM AcOH buffer with 10%
D2O. In panel B, spectra represent 9000 transients and
were recorded as described for A but with 300 μM 5-FTrpPA and
600 μM CMG2. Note the lack of an unfolded resonance at 37 °C
in panel B compared to panel A. Data were referenced to an internal
standard of 0.1 mM pF-Phe.In Figure 7B, we added a 2-fold excess
of
the receptor CMG2 and conducted sets of experiments identical to that
described in 7A. Again we observe the downfield
shift in the Trp346 resonance when the receptor is bound, but as the
temperature is increased, the Trp346 resonance does not shift any
further. The major difference we observe is the significantly reduced
amplitude of the unfolded resonances. Furthermore, while there is
a small increase in the amplitudes of the two PA20 resonances
(−43.4 and −45.9 ppm), the increase is smaller than
that observed in the absence of the receptor, suggesting that the
effect of receptor binding is not simply a local effect but can be
transmitted to residues within domain 1.
Discussion
PA
undergoes several structural changes during the course of anthrax
toxin pathogenesis, including receptor binding followed by oligomerization
and endocytosis, and at acidic pH the formation of a membrane-spanning
pore.[38] In an effort to improve our understanding
of these structural changes at a residue-specific level, we have conducted
an initial study whereby we have biosynthetically incorporated 5-FTrp
into the monomeric, 83 kDa form of PA and have used 19F
NMR to probe the structure of the protein under a variety of conditions.To determine the effect of fluorine labeling on the stability of
the protein, we conducted pH andurea denaturation experiments, following
unfolding by monitoring the changes in tryptophan fluorescence. The
results of these experiments, which again are summarized in Table 1, suggest that while 5-FTrpPA is slightly more stable
to acidic pH than the WT, the 5-FTrp-labeled PA or PA20 domain exhibits a small decrease in the ΔG° of unfolding to urea, which seems mainly attributable to differences
in the m values. However, an important caveat in
the interpretation of these differences is the fact that the fluorescence
properties of the 5-FTrp andTrp are different[31] (see Figure 1A), and the pre- and
post-transition baselines are not well-defined. Clearly, further work
is needed to elucidate the potential thermodynamic differences between
the fluorine-labeled and unlabeled proteins.We also report
the 1.7 Å crystal structure of the 5-FTrp-labeled
PA Trp206Tyr, and the structure shows some small differences in comparison
to that of the WT protein, most notably the fact that we are able
to observe regions of electron density that are missing in the WT
structure. Importantly, both structures overlay well with one another
(Figure 4B), indicating that 5-FTrp labeling
is minimally perturbing to the structure. Because the native state
structures of the labeled and unlabeled proteins are similar, this
lends strong support to the conclusions we draw with the 5-FTrp-labeled
PA, that the effects that we observe by NMR (pH sensitivity and effects
of CMG2 binding, for instance) are likely to be similar to that of
the WT protein.The ability to assign the Trp346 resonance,
which lies near the
interface between PA andCMG2,[13] allowed
us to probe how this resonance changes in the presence of the receptor
and whether the Trp346 resonance is sensitive to variations in pH.
The first crystal structure of PA[10] postulated
that the domain 2β3–2β4 loop
was sensitive to pH and that at lower pH values the electron density
within this region became disordered. We have also crystallized PA
and compared structures a low and high pH; in some structures, we
could observe an increase in the level of disorder at low pH (∼5),
whereas the WT protein, surprisingly, showed no increase in the level
of disorder.[11] We find that the resonance
intensity of Trp346 specifically decreases as the pH is lowered, providing
strong evidence that the domain 2β3–2β4 loop undergoes conformational exchange at low pH. The mechanism
of the structural change that occurs in this loop as the pH is lowered
has yet to be determined.Receptor binding clearly has a stabilizing
influence on the structure
of the protein. While Trp346 undergoes a substantial chemical shift
change (∼0.6 ppm) upon receptor binding, we did not observe
the same loss of intensity of this resonance either at low pH or at
higher temperatures. Also, the unfolded resonance intensity is attenuated
(low pH or higher temperatures) when the receptor is bound. The effects
that we observe on the temperature dependence of the resonances suggest
that the receptor stabilization is not only local to the binding interface
but also more long-range. This effect is consistent with studies following
histidinehydrogen–deuterium exchange kinetics,[11] in which the rates of histidinehydrogen–deuterium
exchange were slowed upon receptor binding, even for residues >40
Å from the binding interface.The studies presented here
provide an initial step toward following
the conformational changes that occur in the anthrax toxin at low
pH. On the basis of the experiments reported here, the feasibility
of using 19F NMR to follow structural changes in PA is
warranted. One important question we wish to address using this method
is the order of events leading to the formation of a pore. It has
been proposed[38] that an initial step in
the formation of the pore from the prepore state is the closure of
the φ-clamp, a ring of phenylalanines (Phe427) located within
the lumen of the pore that clamps down on its substrate (either edema
factor or lethal factor) and is required for protein translocation.[9] In initial experiments, we have used mutagenesis
to replace this phenylalanine with a tryptophan and have labeled the
protein with 5-FTrp, and we are able to observe this resonance (F-Trp427)
in the prepore and pore states. Therefore, in the future, we should
be able to follow this resonance during the process of pore formation
in real time.[22,39] In any case, 19F NMR
opens the possibility of exploring structural changes in this protein
at a residue-specific level.
Authors: D Borden Lacy; Darran J Wigelsworth; Roman A Melnyk; Stephen C Harrison; R John Collier Journal: Proc Natl Acad Sci U S A Date: 2004-08-23 Impact factor: 11.205
Authors: Heather M Scobie; G Jonah A Rainey; Kenneth A Bradley; John A T Young Journal: Proc Natl Acad Sci U S A Date: 2003-04-16 Impact factor: 11.205
Authors: Michael Mourez; Ming Yan; D Borden Lacy; Lisa Dillon; Lori Bentsen; Amy Marpoe; Clémence Maurin; Eileen Hotze; Darran Wigelsworth; Ruth-Anne Pimental; Jimmy D Ballard; R John Collier; Rodney K Tweten Journal: Proc Natl Acad Sci U S A Date: 2003-11-17 Impact factor: 11.205
Authors: Fabiana Freire Mendes de Oliveira; Sireesha Mamillapalli; Srinivas Gonti; Robert N Brey; Han Li; Jarad Schiffer; Arturo Casadevall; James G Bann Journal: mSphere Date: 2020-01-15 Impact factor: 4.389