Literature DB >> 24345913

Effect of penehyclidine hydrochloride on β-arrestin-1 expression in lipopolysaccharide-induced human pulmonary microvascular endothelial cells.

J Zhan1, F Xiao2, Z Z Zhang1, Y P Wang1, K Chen1, Y L Wang1.   

Abstract

β-arrestins are expressed proteins that were first described, and are well-known, as negative regulators of G protein-coupled receptor signaling. Penehyclidine hydrochloride (PHC) is a new anti-cholinergic drug that can inhibit biomembrane lipid peroxidation, and decrease cytokines and oxyradicals. However, to date, no reports on the effects of PHC on β-arrestin-1 in cells have been published. The aim of this study was to investigate the effect of PHC on β-arrestin-1 expression in lipopolysaccharide (LPS)-induced human pulmonary microvascular endothelial cells (HPMEC). Cultured HPMEC were pretreated with PHC, followed by LPS treatment. Muscarinic receptor mRNAs were assayed by real-time quantitative PCR. Cell viability was assayed by the methyl thiazolyl tetrazolium (MTT) conversion test. The dose and time effects of PHC on β-arrestin-1 expression in LPS-induced HPMEC were determined by Western blot analysis. Cell malondialdehyde (MDA) level and superoxide dismutase (SOD) activity were measured. It was found that the M3 receptor was the one most highly expressed, and was activated 5 min after LPS challenge. Furthermore, 2 μg/mL PHC significantly upregulated expression of β-arrestin-1 within 10 to 15 min. Compared with the control group, MDA levels in cells were remarkably increased and SOD activities were significantly decreased in LPS pretreated cells, while PHC markedly decreased MDA levels and increased SOD activities. We conclude that PHC attenuated ROS injury by upregulating β-arrestin-1 expression, thereby implicating a mechanism by which PHC may exert its protective effects against LPS-induced pulmonary microvascular endothelial cell injury.

Entities:  

Year:  2013        PMID: 24345913      PMCID: PMC3935276          DOI: 10.1590/1414-431X20133289

Source DB:  PubMed          Journal:  Braz J Med Biol Res        ISSN: 0100-879X            Impact factor:   2.590


Introduction

Oxidative stress is an imbalance between oxidants and antioxidants (1). Oxidative stress can cause serious damage to cellular structure and function, and can also modulate cell signaling pathways and gene expression. Biological lipid oxidation produces oxidative stress. Malondialdehyde (MDA) is the principal product of polyunsaturated fatty acid peroxidation. This aldehyde is a highly toxic molecule and should be considered as more than just a marker of lipid peroxidation (2). Superoxide dismutase (SOD) is an endogenous enzyme responsible for the dismutation of superoxide radicals. SOD plays a pivotal role in protecting tissues from damage by oxidative stress by scavenging superoxide anions, which prevents the formation of other more potent oxidants such as peroxynitrite and hydroxyl radicals (3). Arrestins are expressed proteins that were first described, and are well-known as negative regulators of G protein-coupled receptor (GPCR) signaling (4). There are four members of the arrestin family (arrestin-1 to -4). Arrestin-1 and arrestin-4, termed rod and cone arrestin, are expressed in photoreceptor cells and terminate rhodopsin and cone opsin signaling. Arrestin-2 (also called β-arrestin-1) and arrestin-3 (also called β-arrestin-2) are ubiquitously distributed and bind hundreds of different GPCRs (5,6). Arrestins play key roles in the regulation of multiple GPCR-dependent and -independent signaling pathways. Arrestins bind to the activated and phosphorylated state of these receptors, consequently blocking the ability of the receptors to activate G protein (7). β-arrestin-1 serves as a multifunctional adaptor protein that mediates receptor desensitization, receptor internalization, and links GPCRs to downstream pathways (8). Studies have also shown that, depending on the cellular context and receptor examined, β-arrestin-1 either mediates or inhibits receptor signaling (9). Furthermore, recent studies have also shown that β-arrestins function to negatively regulate the inflammatory response induced by lipopolysaccharide (LPS) (10). It has also been demonstrated that β-arrestins can regulate LPS-induced signaling and pro-inflammatory gene expression (11). Penehyclidine hydrochloride (PHC) is a new anti-cholinergic drug derived from hyoscyamine, which is an anticholinergic agent with a high degree of selectivity for M1 and M3 receptor subtypes (12). PHC could improve the outcome in patients with soman poisoning, and appears efficacious in improving the symptoms and the lung function of patients with chronic obstructive pulmonary disease, a lung disease defined by persistently poor airflow as a result of breakdown of lung tissue and dysfunction of the small airways (13,14). Other than the anticholinergic effects, PHC could inhibit biomembrane lipid peroxidation, and decrease cytokines and oxyradicals. Shen et al. (15) reported that PHC counteracted lipid peroxidation as indicated by reduced MDA content and increased activity of SOD. Moreover, our recent studies demonstrated that PHC could attenuate NO production and iNOS expression by suppressing the activation of the p38 MAPK pathway, and that β-arrestin-1 is closely related to p38 MAPK signaling pathway (16,17). However, to date, no reports on the effects of PHC on β-arrestin-1 in cells have been published. This study aimed to investigate the effect of PHC on β-arrestin-1 expression in LPS-induced human pulmonary microvascular endothelial cells (HPMEC), and explore the biological effect of PHC on LPS-induced MDA production and SOD activity in HPMEC in order to lay a solid foundation for future research of PHC in cells.

Material and Methods

Material

PHC was provided by Lisite Corporation (China). LPS (Escherichia coli 0111: B4) and RPMI 1640 were purchased from Sigma (USA). MDA and SOD assay kits were purchased from Jiancheng Biologic Project Company (China). Anti-β-arrestin-1 antibody was purchased from Abcam Incorporated (UK) (rabbit, Ab32099, 1:1000) and anti-β-actin antibody was provided by Santa Cruz Biotechnology (USA) (rabbit, Sc-1616r, 1:1000).

Cell lines and cell culture

HPMEC were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and were cultured in RPMI 1640, 10% standard newborn calf serum, 50 μg/mL streptomycin, 50 IU/mL penicillin, and 2 mM glutamine in a humidified, 5% CO2 atmosphere at 37°C (E191TC, SIM CO2 Incubator, USA).

Real-time quantitative PCR analysis

Cells were harvested and total RNA was extracted using Trizol Reagent (Invitrogen Life Technologies, USA) according to the manufacturer's instructions. Two micrograms total RNA was reverse transcribed using a Toyobo First-Strand cDNA synthesis kit (GeneCopoeia Inc., USA). Reverse transcription was performed at 70°C for 5 min, 0°C for 3 min, 42°C for 30 min, and 80°C for 5 min. The mRNA levels of M1, M2, M3, and M4 receptor subtypes were measured by quantitative PCR. qPCR amplifications were performed in triplicate using the SYBR Green I assay (Toyobo Inc., Japan). The reactions were carried out in 25-μL reaction solution containing 2.0 μL cDNA, 2.0 μL mixed gene-specific forward and reverse primers (10 mM each), 12.5 μL 2× qPCR Mix and 8.5 μL double-distilled H2O. The amplification reaction was carried out in an initial 1-min predenaturation at 95°C, 40 cycles at 95°C for 15 s, 58°C for 20 s, 72°C for 20 s, followed by the protocol for the melting curve with an increase of 1°C between each 20 s from 72° to 95°C. β-actin gene was used as an internal control for normalization of RNA quantity and quality differences in all samples. For each sample analyzed, qPCR provides a cycle time (CT) value where the fluorescence signal is detectable. All CTs were dependent on the starting amount of cDNA. The β-actin CT value was used to confirm the starting amount of cDNA in PCR quantifications. Gene expression was quantified using a modification of the 2-ΔΔCt method. Primer sequences were designed using the NCBI-Primer BLAST online tool and synthesized commercially (Invitrogen Biotechnology Co., Ltd., China). The sequences of the primers used in the present study were as follows: M1, CTCTTTCAAGGTCAACACGGAGTCACGGAGAAGTAGCGGT 241 bp (NM_000738); M2, CATCAACAGCACTATCAACCCCCTTGCCCACCTTCTATCTT 145 bp (NM_001006630); M3, TCTTGCTTGCCTTCATCATCACCGACTGTCTCTGCTGGTA 250 bp (NM_000740); M4, ACACTTCCAATGAGTCCAGCGTCTGCTTCGTCACAATCTG 175 bp (NM_000741); β-actin, GTCCACCGCAAATGCTTCTATGCTGTCACCTTCACCGTTC 190 bp (NM_001101).

Cell viability assay

Cell viability was assessed by the methyl thiazolyl tetrazolium (MTT) conversion test. Briefly, HPMECs were seeded on 96-well microtiter plates (20,000 cells/well) and allowed to adhere for 24 h. The cells were incubated without or with PHC (0.2, 1, 2, 10, 20, 100, 200 μg/mL) for 1 h followed by induction with LPS (0.1 µg/mL) for 24 h. We also added a PHC alone group (200 μg/mL) in order to investigate the cytotoxic effect of PHC. After incubation, 20 µL/well MTT (Amresco Inc., USA) solution (5 mg/mL) was added and incubated for 4 h. The medium was aspirated and replaced with 150 µL/well dimethyl sulfoxide solution (DMSO). The plates were shaken for 10 min, and absorbance was determined at 490 nm using an automated microplate reader (RT-6000, Shenzhen Rayto Life Science Limited Company, China). Each assay was performed on five plates.

Western blot analysis

Equal amounts of proteins (40 μg) were loaded onto SDS-polyacrylamide gels, transferred to nylon membranes, and incubated with primary antibody overnight at 4°C. Excess antibody was then removed by washing the membranes in PBS-0.05% Tween-20, and the membranes were incubated in secondary antibodies for 30 min. After washing in PBS-0.05% Tween 20, the bands were detected by enhanced chemiluminescence and the density of the individual bands was quantified by densitometry using the AlphaEase FC software (Alpha Innotech Inc., USA).

Measurement of MDA and SOD

Cells were collected to examine MDA content and SOD activity. Absorbance was measured at 532 nm (MDA) and 550 nm (SOD), on a DU-530 spectrophotometer (Beckman Instruments Inc., USA). MDA was measured after reaction with thiobarbituric acid using the MDA assay kit; SOD was determined by a method using inhibition of superoxide anions produced by the action of xanthine oxidase on xanthine using the SOD assay kit. MDA concentrations are reported as nmol/mL. SOD activities are reported in units per milliliter (U/mL).

Statistical analysis

Data are reported as means±SD. Analysis of variance (ANOVA) and the Student-Newman-Keuls Q-test were used for statistical comparison of values among all groups. A significant difference was presumed for a probability value of <0.05.

Results

LPS-induced HPMEC muscarinic receptor 3 activation

We identified muscarinic receptor subtypes M1-M4 in HPMEC, and found that the M3 receptor was the most highly expressed of the four (Figure 1). We then measured M3 receptor expression in LPS-induced HPMEC at 5-min time points from 5 to 30 min. It was shown that, in a time-dependent manner, maximum expression of M3 receptor was induced at 5 min and then declined gradually from 10 to 30 min (Figure 2).
Figure 1

Expressions of different types of muscarinic receptors in human pulmonary microvascular endothelial cells (n=5). M3 receptor had the highest expression among the four subtypes (M1-M4). Therefore, we tested M3 receptor expression in the subsequent experiment. *P<0.05, compared with M1, M2, and M4 receptors (ANOVA).

Figure 2

Changes of lipopolysaccharide-induced M3 receptor activation with time in human pulmonary microvascular endothelial cells (n=3). M3 receptor had the highest expression at 5 min, then attenuated gradually from 10 to 30 min. *P<0.05, compared with 0 min; #P<0.05, compared with 5 min (ANOVA).

MTT assays

Mitochondrial succinate dehydrogenase in living cells converts MTT into visible formazan crystals during incubation. The formazan crystals were then solubilized in DMSO. However, these reactions do not occur in dead cells. Absorbance thus represents the number of surviving cells. As shown in Figure 3, cell survival significantly decreased after LPS challenge, and PHC (200 μg/mL) alone exerted no effect on cell survival. Compared with the LPS group, there was a measurable increase in absorbance in all PHC groups. However, the increase was significant only in the 2 and 1 μg/mL PHC groups.
Figure 3

Comparison of methyl thiazolyl tetrazolium (MTT) assay results (n=5). PHC: penehyclidine hydrochloride (0.2-200 µg/mL) *P<0.05, compared with control group; #P<0.05, compared with lipopolysaccharide (LPS) group (ANOVA).

Dose and time of PHC on β-arrestin-1 expression in LPS-induced HPMEC

We chose 4 concentrations of PHC to determine the optimal dose of PHC on β-arrestin-1 expression in LPS-induced HPMEC. It was demonstrated that 2 μg/mL PHC upregulated expression of β-arrestin-1 most significantly (Figure 4).
Figure 4

Effect of different concentrations of penehyclidine hydrochloride (PHC) on β-arrestin-1 expression in lipopolysaccharide (LPS)-induced human pulmonary microvascular endothelial cells (HPMEC) (n=3). HPMEC were pretreated with different concentrations of PHC (1, 2, 5, and 10 μg/mL) for 1 h and stimulated with 0.1 μg/mL LPS for another 24 h. Equal amounts of protein in the cell lysates were electrophoresed and the levels of protein were determined using specific antibodies. PHC at a concentration of 2 µg/mL upregulated expression of β-arrestin-1 most significantly. *P<0.01, compared with control group; #P<0.05, ##P<0.01, compared with LPS group (ANOVA).

Then, the time point of PHC on β-arrestin-1 expression in LPS-induced HPMEC was observed. The effect of PHC on β-arrestin-1 expression in LPS-induced HPMEC decreased gradually from 0.5 to 24 h. The effect of PHC on β-arrestin-1 expression in LPS-induced HPMEC was measured at 5-min time points from 5 to 30 min. Maximum expression of β-arrestin-1 was induced between 10 and 15 min as shown (Figure 5).
Figure 5

Effect of penehyclidine hydrochloride (PHC) on β-arrestin-1 expression with time in lipopolysaccharide (LPS)-induced human pulmonary microvascular endothelial cells (HPMEC) (n=3). HPMEC were pre-incubated with 2 µg/mL PHC for 1 h and treated with 0.1 µg/mL LPS for different times. This figure is representative of the experiment. β-arrestin-1 protein expression is reported as respective absorbance/β-actin absorbance. β-arrestin-1 had the highest expression at 10 and 15 min. *P<0.01, compared with 0 h; #P<0.01, compared with 0.5 h; *P<0.01, compared with 0 min; #P<0.01, compared with 30 min (ANOVA).

LPS-induced oxidative stress and its modulation by PHC

To assess the antioxidant effects of PHC, we pre-incubated cells with 2 μg/mL PHC for 1 h, followed by 0.1 μg/mL LPS treatment for 1 h. Compared with the control group, the MDA content in cells was remarkably increased and SOD activity was significantly decreased in the LPS group (both P<0.01). Two microgram per milliliter PHC pretreatment markedly decreased LPS-induced MDA content and enhanced SOD activities (Figure 6). In addition, PHC alone had no effect on basal oxidative status in cells.
Figure 6

Inhibition of lipopolysaccharide (LPS)-induced malondialdehyde (MDA) increase and superoxide dismutase (SOD) decrease by penehyclidine hydrochloride (PHC) (n=5). Human pulmonary microvascular endothelial cells were pre-incubated with PHC for 1 h and treated with 0.1 µg/mL LPS for 1 h. LPS treatment significantly induced MDA increase and SOD decrease, which was attenuated by PHC pretreatment. In addition, PHC alone had no effect on basal MDA and SOD levels. Data are reported as means±SD. *P<0.01, compared to control; #P<0.05, compared to LPS treatment (ANOVA).

Discussion

The present study was undertaken to elucidate the biological effect of PHC on β-arrestin-1 expression, MDA production and SOD activity in LPS-induced HPMEC. To our knowledge, this is the first report regarding the effect of PHC on β-arrestin-1 expression at the cellular level. GPCRs are the largest family of cell surface receptors. GPCRs can be activated by multiple ligands and exhibit the capacity to couple to numerous intracellular signal transduction pathways (18). Oxidative stresses have recently been shown to be generated by agonists of several members of the GPCR superfamily (19). Muscarinic acetylcholine receptors, which are linked to a variety of intracellular second messenger systems through G-proteins, belong to the GPCR superfamily. Muscarinic receptors can regulate numerous central and peripheral physiological functions including control of memory, arousal, motor activity, and heart rate (20). Muscarinic receptors are divided into five distinct subtypes M1-M5, and we determined M1-M4 subtypes in HPMEC in this study. The M3 receptor was the most highly expressed of the four subtypes. Furthermore, M3 receptor activation occurred at 5 min after LPS challenge, at the same time as an increase in MDA level and reduction in SOD activity, which indicated lipid peroxidation damage emerged at 60 min and suggested that M3 activation may lead to oxidative stress generation in LPS-induced HPMEC. β-arrestins are scaffolding proteins originally noted for their role in GPCR desensitization (21). Recent studies have suggested that β-arrestins also play a role in cell signaling pathways, and in gene expression (22,23). The muscarinic receptor is a kind of GPCR, while β-arrestin-1 is known as a terminator of GPCR signaling. It is possible that β-arrestin-1 decreased oxidative stress through blocking M3 receptors and its downstream signal pathway. MDA is suggested to indicate induction of ROS activity and oxidative tissue damage (24). In this study, reduction in MDA concentration indicated less lipid peroxidation damage in the PHC group compared to the LPS group. SOD is the major intracellular antioxidant with multiple biological functions (25). With an increase in the antioxidant enzyme SOD, it could reasonably be expected that cellular biochemical markers of oxidative stress would be reduced after PHC treatment. As assessed by the MTT assay, the effects of PHC on these indices were not attributable to PHC cytotoxicity. It has been reported that anisodamine, a widely prescribed muscarinic receptor antagonist, could exert antiflammatory effects through upregulating β-arrestin-1 (26). PHC, which has fewer cardiovascular side effects than other anticholinergics, may exert antioxidant effects through upregulating β-arrestin-1. Yan et al. (27) studied the effect of PHC on strips of intestine isolated from guinea pigs, and found that PHC can effectively relieve intestine spasm in vitro at concentrations of 0.2, 2.0, 20.0 μg/mL. We also carried out MTT experiments to determine the optimum concentration based on the above study, and the concentrations of PHC (1 to 10 μg/mL) were chosen for β-arrestin-1 measurement. From the results of Western blot analysis, 2 μg/mL PHC had a significant protective effect on LPS-induced HPMEC compared with the other doses. Furthermore, the time of maximum peak of PHC on β-arrestin-1 expression in LPS-induced HPMEC was between 10 and 15 min. We conclude that PHC intervention had a beneficial protective effect, at an appropriate dose, on LPS-induced HPMEC. Its mechanisms of action probably involve the upregulation of β-arrestin-1 expression and suppression of lipid peroxidation. However, the current study has some limitations that need to be addressed. The effect of PHC on oxidative stress is attributable to either the inhibitory effects of PHC on M3 receptors, or blocking M3 receptor's downstream signal pathway through upregulating β-arrestin-1. Future studies would benefit from assessments of β-arrestin-1 or M3 receptor function using specific siRNAs.
  24 in total

1.  Anticonvulsant effects of phencynonate hydrochloride and other anticholinergic drugs in soman poisoning: neurochemical mechanisms.

Authors:  Yong-An Wang; Wen-Xia Zhou; Jiang-xiong Li; Yan-Qin Liu; Yong-Juan Yue; Jian-Quan Zheng; Ke-Liang Liu; Jin-Xiu Ruan
Journal:  Life Sci       Date:  2005-09-08       Impact factor: 5.037

Review 2.  International Union of Pharmacology. XVII. Classification of muscarinic acetylcholine receptors.

Authors:  M P Caulfield; N J Birdsall
Journal:  Pharmacol Rev       Date:  1998-06       Impact factor: 25.468

Review 3.  [Malondialdehyde (MDA) as a lipid peroxidation marker].

Authors:  Stefan Gaweł; Maria Wardas; Elzbieta Niedworok; Piotr Wardas
Journal:  Wiad Lek       Date:  2004

4.  Penehyclidine hydrochloride attenuates LPS-induced iNOS production by inhibiting p38 MAPK activation in endothelial cells.

Authors:  Jia Zhan; Zong-Ze Zhang; Chang Chen; Kai Chen; Yan-Lin Wang
Journal:  Mol Biol Rep       Date:  2011-05-21       Impact factor: 2.316

5.  Synthesis of the optical isomers of a new anticholinergic drug, penehyclidine hydrochloride (8018).

Authors:  Xiang-Yu Han; He Liu; Chun-He Liu; Bo Wu; Lan-Fu Chen; Bo-Hua Zhong; Ke-Liang Liu
Journal:  Bioorg Med Chem Lett       Date:  2005-04-15       Impact factor: 2.823

6.  Nonvisual arrestins function as simple scaffolds assembling the MKK4-JNK3α2 signaling complex.

Authors:  Xuanzhi Zhan; Tamer S Kaoud; Kevin N Dalby; Vsevolod V Gurevich
Journal:  Biochemistry       Date:  2011-11-09       Impact factor: 3.162

Review 7.  A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress.

Authors:  Daniele Del Rio; Amanda J Stewart; Nicoletta Pellegrini
Journal:  Nutr Metab Cardiovasc Dis       Date:  2005-08       Impact factor: 4.222

8.  Ambient particulate air pollution from vehicles promotes lipid peroxidation and inflammatory responses in rat lung.

Authors:  C E L Pereira; T G Heck; P H N Saldiva; C R Rhoden
Journal:  Braz J Med Biol Res       Date:  2007-08-14       Impact factor: 2.590

Review 9.  Using green fluorescent protein to understand the mechanisms of G-protein-coupled receptor regulation.

Authors:  S S Ferguson
Journal:  Braz J Med Biol Res       Date:  1998-11       Impact factor: 2.590

10.  Beta-arrestins 1 and 2 differentially regulate LPS-induced signaling and pro-inflammatory gene expression.

Authors:  Hongkuan Fan; Louis M Luttrell; George E Tempel; Joseph J Senn; Perry V Halushka; James A Cook
Journal:  Mol Immunol       Date:  2007-04-06       Impact factor: 4.407

View more
  2 in total

1.  Penehyclidine Hydrochloride Decreases Pulmonary Microvascular Endothelial Inflammatory Injury Through a Beta-Arrestin-1-Dependent Mechanism.

Authors:  Fei Zheng; Fei Xiao; Qing-Hong Yuan; Qiang-Sheng Liu; Zong-Ze Zhang; Yan-Lin Wang; Jia Zhan
Journal:  Inflammation       Date:  2018-10       Impact factor: 4.092

Review 2.  Pleiotropic effects and pharmacological properties of penehyclidine hydrochloride.

Authors:  Yaguang Wang; Yafen Gao; Jun Ma
Journal:  Drug Des Devel Ther       Date:  2018-10-05       Impact factor: 4.162

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.