Parkinson's disease (PD) is a neurodegenerative disorder characterised by the loss of substantia nigra dopaminergic neurons that leads to a reduction in striatal dopamine (DA) levels. Replacing lost cells by transplanting dopaminergic neurons has potential value to repair the damaged brain. Salidroside (SD), a phenylpropanoid glycoside isolated from plant Rhodiola rosea, is neuroprotective. We examined whether salidroside can induce mesenchymal stem cells (MSCs) to differentiate into neuron-like cells, and convert MSCs into dopamine neurons that can be applied in clinical use. Salidroside induced rMSCs to adopt a neuronal morphology, upregulated the expression of neuronal marker molecules, such as gamma neuronal enolase 2 (Eno2/NSE), microtubule-associated protein 2 (Map2), and beta 3 class III tubulin (Tubb3/β-tubulin III). It also increased expression of brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and nerve growth factor (NGF) mRNAs, and promoted the secretion of these growth factors. The expression of dopamine neurons markers, such as dopamine-beta-hydroxy (DBH), dopa decarboxylase (DDC) and tyrosine hydroxylase (TH), was significantly upregulated after treatment with salidroside for 1-12 days. DA steadily increased after treatment with salidroside for 1-6 days. Thus salidroside can induce rMSCs to differentiate into dopaminergic neurons.
Parkinson's disease (PD) is a neurodegenerative disorder characterised by the loss of substantia nigra dopaminergic neurons that leads to a reduction in striatal dopamine (DA) levels. Replacing lost cells by transplanting dopaminergic neurons has potential value to repair the damaged brain. Salidroside (SD), a phenylpropanoid glycoside isolated from plant Rhodiola rosea, is neuroprotective. We examined whether salidroside can induce mesenchymal stem cells (MSCs) to differentiate into neuron-like cells, and convert MSCs into dopamine neurons that can be applied in clinical use. Salidroside induced rMSCs to adopt a neuronal morphology, upregulated the expression of neuronal marker molecules, such as gamma neuronal enolase 2 (Eno2/NSE), microtubule-associated protein 2 (Map2), and beta 3 class III tubulin (Tubb3/β-tubulin III). It also increased expression of brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and nerve growth factor (NGF) mRNAs, and promoted the secretion of these growth factors. The expression of dopamine neurons markers, such as dopamine-beta-hydroxy (DBH), dopa decarboxylase (DDC) and tyrosine hydroxylase (TH), was significantly upregulated after treatment with salidroside for 1-12 days. DA steadily increased after treatment with salidroside for 1-6 days. Thus salidroside can induce rMSCs to differentiate into dopaminergic neurons.
Parkinson’s disease (PD) is a neurodegenerative disorder characterised by the loss of
substantia nigra dopaminergic neurons that leads to a reduction in striatal dopamine (DA) levels.
Replacing lost cells by transplanting dopaminergic neurons has the potential value to repair the
damaged brain (Ben et al., 2004). Many kinds of cells, such as
primary mesencephalic cultures (Erceg et al., 2008), embryonic
stem cells (Montzka et al., 2009), and sympatho-adrenal cells
(Wu et al., 1998), have the potential to differentiate into
dopaminergic neurons. However, these cells face at least two major challenges: on the one hand,
because they are from normal tissues, it is very difficult to obtain them, but easy to damage the
function of their normal host tissues. On the other hand, the socio-ethical problems of embryonic
stem cells limit their clinical application. To address these issues, bone marrow-derived
mesenchymal stem cells (MSCs) have been used for neuron-like differentiation. MSCs have the
potential to differentiate into several types of cells, including osteogenic, chondrogenic,
adipogenic and neuronal lineages in response to stimulation by multiple environmental factors (Jiang
et al., 2002; Pereira et al., 1995), they thus possess tremendous clinical potential for use in regenerative medicine. So
far, serum deprivation and/or treatment with cyclic AMP (cAMP) analogs, retinoic acid (RA), bone
morphogenetic proteins (BMPs) (Tio et al., 2010), nerve
growth factor (NGF) (Brederlau et al., 2002), brain-derived
neurotrophic factor (BDNF) (Shi et al., 2012), glial
cell-derived neurotrophic factor (GDNF) and other factors (Trzaska et al., 2009) have been used for neuron-like differentiation of several mouse and human
cells. Despite their effectiveness as inducers to differentiate into dopaminergic neurons, a new
type of inducer that can rapidly and reliably produce desired quantities of dopaminergic neurons
with a long-term survival rate is urgently needed.Kirilow Rhodiola Root and Rhizome is a traditional Chinese medicinal herb with multiple
pharmacological effects, such as anti-hypoxia, anti-oxidant and neuroprotective effects (Choe et
al., 2012; Xu and Li, 2012). Salidroside, the active constituent, has multiple biological effects (Zhang et al.,
2011). An important role for salidroside is to protect the
central nerve, and thus it is reasonable to hypothesise that salidroside can induce MSCs to
differentiate into neuron-like cells, perhaps also into dopaminergic neurons.To test this hypothesis, we have investigated the effects of salidroside on the induction of rat
MSCs (rMSCs) to differentiate into dopaminergic neurons in comparison to RA. Salidroside effectively
induces dopaminergic neuron differentiation of rMSCs by upregulating the expression of BDNF,
neurotrophin-3 (NT-3), and NGF.
Materials and methods
Isolation and culture of rMSCs
Animal experiments were carried out in accordance with the National Institutes of Health Guide
for the Care and Use of Laboratory Animals, and the protocols were approved by the Committee for
Animal Research at the General Hospital of Lanzhou Military Command of the PLA. Bone marrow-derived
MSCs were isolated and harvested from bone marrow of the tibias of 2- to 3-month-old male
Sprague–Dawley rats by inserting a 21-ga needle into the shaft of the bone and flushing it
with 30 mL Dulbecco’s modified Eagle/F12 medium (DMEM/F-12; Gibco, Grand Island, NY)
supplemented with 10% fetal bovine serum (FBS, Grand Island, NY). After centrifugation and
resuspension, isolated cells were grown in a culture flask and cultured under a routine condition
(37°C, air plus 5% CO2) for 48 h. Non-adherent cells were removed by
changing the medium and the resulting monolayer of cells was trypsinised. Aliquots were cultured
further, or frozen and stored. The MSCs were used for the following experiments when they were at
the third passage.
Flow-cytometric determination of cell-surface antigen profiles
One millilitre of CD106-PE, CD90-FITC, CD45-PE or CD34-FITCrat-specific antibodies (BD
Pharmingen, San Diego, CA) was added to the bottom of tubes, after which 100 µL
(6 × 106 cells/mL) of a single-cell suspension of cultured
rMSCs was added. The mixture was incubated for 30 min at 4°C in the dark and washed.
Positive cells were detected by flow cytometry (Becton-Dickinson, Franklin Lakes, NJ). Rat IgG1-FITC
and IgG1-PE (BD Pharmingen) were used as isotype controls.
Cell morphology
Cells were seeded at 1 × 104 cells/mL in 24-well plates
containing DMEM/F-12 and 10% FBS for 24 h, and then induced by 100 µg/mL
salidroside (Purity ≥ 99.8%, Chinese Institute for Drug Assay, Beijing,
China) for 24–72 h. They were fixed with 4% paraformaldehyde and incubated at
4°C overnight with rabbit monoclonal anti-β-tubulin antibody (1:500, Santa Cruz
Biotechnology, Inc., Santa Cruz, CA). After three washes with PBS, the cells were incubated at
37°C for 1 h with secondary antibodies conjugated to fluorescein isothiocyanate (FITC,
Abcam, Cambridge, MA). The cell number in each experimental condition was determined by counting the
cells in four different fields on each coverslip in at least three independent experiments. The
images were taken with an Olympus fluorescence microscope BX61 (Olympus, Tokyo, Japan).
Immunocytochemistry
rMSCs were seeded at 1 × 104 cells/well on 24-well plates
with poly-l-lysine-coated coverslips, and treated with 100 µg/mL of
salidroside for varying times. Cells were fixed with 4% paraformaldehyde at room temperature
for 15 min, rinsed thrice with phosphate-buffered saline (PBS), and blocked for 1 h in
PBS containing 0.1% Triton X-100 and 2% goat serum. They were labelled with mouse
monoclonal anti-neuron-specific enolase (NSE) antibody (1:1,000, Abcam), mouse monoclonal
anti-microtubule associated protein-2 (MAP2) antibody (1:1,000, Abcam), mouse monoclonal anti-beta 3
class III tubulin (Tubb3/β-tubulin III) antibody (1:500, Abcam), goat polyclonal anti-glial
fibrillary acidic protein (GFAP) antibody (1:500, Abcam), mouse monoclonal anti-tyrosine hydroxylase
(TH) antibody (1:1,000, Santa Cruz Biotechnology), mouse monoclonal anti-dopamine-beta-hydroxy (DBH)
antibody (1:1,000), or mouse monoclonal anti-dopa decarboxylase (DDC) antibody (1:1,000). After
three washes with PBS, cells were incubated at 37°C for 30 min with secondary
antibodies conjugated to FITC or Cy3 (1:1,000, Abcam). Cell nuclei were stained with DAPI. Images
were taken with a fluorescence microscope (BX61; Olympus) under 20× objective. To determine
the percentage of specific cell types in a particular condition, the total number of cells and the
number of cells with a specific immunoreactivity were counted in 10–12 randomly selected
fields of two or three different coverslips. Each experiment was repeated at least three times.
Real-time PCR analysis
Total RNA was extracted by using Trizol reagent (Invitrogen, Carisbad, CA) according to the
manufacturer’s instructions. cDNA was generated from 2 µg total RNA reacting
with M-MLV reverse transcriptase (Applied TaKaRa Company, Dalian, China) and an oligo (dT) 18
primer. Real-time PCR amplification was done in 25 µL containing 600 ng cDNA,
20 µM each primer (Table1), and
12.5 µL of the Power SYBR Green PCR Master Mix (Applied TaKaRa). The conditions were
set as an initial denaturation of 10 min at 95°C, and 30 cycles of 95°C for
30 s and 60°C for 31 s. The fluorescent signals were normalised to that of
glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and the threshold cycle
(Ct) was set within the exponential phase of the PCR. The relative
expression level between treatments was calculated using the following equation: relative gene
expression = 2−(DCt
sample − DCt control) (Livak and Schmittgen, 2001). The results were presented as the fold change in gene
expression in the differentiated cells compared to that in the undifferentiated cells.
Table 1
Real-Time PCR primer sequences
mRNA (GenBank accession number)
Sequence
NSE (NM_013509.2)
Sense
TCTGAACGTCTGGCGAAGTACAA
Antisense
CAGAGTGACTATGGCAGGTCAGG
MAP2 (NM_008632.2)
Sense
AGTTTGGCTGAAGGTAGCTGAA
Antisense
GTCCGCTCTCTTCATTCATTC
β-tubulinIII (NM_013613.1)
Sense
GCGATGAGCACGGCATAGAC
Antisense
GAAGGCACCACGCTGAAGGT
BDNF (NM_012513.3)
Sense
ATCCACTGAGCAAAGCCGAAC
Antisense
CAGCCTTCATGCAACCGAAGTA
NT-3 (NM_031073.2)
Sense
CATGTCGACGTCCCTGGAAATAG
Antisense
GGATGCCACGGAGATAAGCAA
NGF (NM_001277055.1)
Sense
TCACTGGATCACGACTCCCAAC
Antisense
CAACTGGCACTCGGCATCA
TH (NM_012740.3)
Sense
AGCTGTGCAGCCCTACCAAGA
Antisense
GTGTGTACGGGTCAAACTTCACAGA
GAPDH (NM_008084.2)
Sense
TGTGTCCGTCGTGGATCTGA
Antisense
TTGCTGTTGAAGTCGCAGGAG
Real-Time PCR primer sequences
ELISA analysis
rMSCs were treated with 100 µg/mL of salidroside or 10 µg/mL of RA
for 1–12 days. ELISA was used on cell supernatants to quantify BDNF, NT-3, NGF, and Dopamine
(DA) (ELISA Ready-SET-GO, eBioscience, CA; Cat. Nos. 88-7346 and 88-7106, respectively). The
absorbance at 450 nm (less 690 nm background) was read using a Microplate Reader
(Bio-RAD Model 3550-UV, GMI, Inc., Ramsey, MN, USA).
Western blot analysis
Cultured rMSCs were rinsed with PBS and lysed for 30 min on ice in RIPA-B buffer
(0.5% Nonidet P-40, 20 mM Tris (pH 8.0), 50 mM NaCl, 50 mM NaF,
100 µM Na3VO4, 1 mM DTT, and 50 µg/mL
phenylmethanesulfonylfluoride (PMSF)). The lysate was centrifuged at 14,000g for
30 min at 4°C, and supernatant containing 20 µg protein was run on
12% SDS–PAGE followed by Western blot analysis. The blots were blocked in TBS (PBS
containing 5% BSA and 0.05% Tween-20). The membrane was incubated at 4°C
overnight with the appropriate primary antibodies (anti-NSEmouse monoclonal antibody (1:1,000,
Abcam), anti-β-tubulin III rabbit monoclonal antibody (1:2,000, Abcam) and anti-TH mouse
monoclonal antibody (1:1,000, Santa Cruz Biotechnology). After incubating with primary antibodies,
the blots were washed extensively in TBS. Thereafter, the samples were treated with a
peroxidase-conjugated anti-rabbit and/or anti-mouse secondary antibody (Santa Cruz Biotechnology).
The proteins were subsequently detected and visualised by electrochemiluminescence (ECL, Millipore
Corporation, Billerica, USA). The results of two-dimensional gel electrophoresis were quantitated
using the Alpha Imager 2000 (Alpha Innotech, San Leandro, CA) and Image-Pro Plus Version 6.0 (Media
Cybernetics, Inc., MD, USA). The average area and band intensity from three to five independent
blots were used for each data point. Actin levels were used to correct for loading in each sample,
and fold changes were calculated.
Statistical analyses
Statistical analyses used SPSS for Windows version 17.0 (SPSS, Inc., Chicago, IL). The data are
expressed as the mean ± SD unless otherwise indicated. Data were analysed by
the Student’s t-test for two group comparisons and
P < 0.05 was considered significant.
Results
Salidroside induces rMSCs to adopt a neuronal morphology
rMSCs surface antigen profiles determined by staining with rat-specific monoclonal antibodies
followed by flow cytometry revealed that rMSCs were strongly positive for typical MSCs markers CD106
and CD90, whereas they were negative for the hematopoietic markers CD45 and CD34 (Figure 1A). Thus, the cells retained the MSC phenotype. Cell
morphology after 100 µg/mL of salidroside was examined along with staining for
beta-tubulin (green). After 24 h of salidroside treatment,
33 ± 4.6% MSCs had phenotypes ranging from simple bipolar cells to large
branched multipolar cells (Figure 1E: 24 h). The
number of branched multipolar cells reached 64 ± 4.3% and
71.5 ± 2.7% by 48 and 72 h treatments, respectively (Figures 1F: 48 h and 1G: 72 h). Spindle-shaped cells predominated, but a few branched multipolar were seen
in untreated MSCs (Figures 1B–1D).
Figure 1
Salidroside induces rMSCs to adopt a neuronal morphology in vitro. MSCs were isolated from the
tibias of rat and cultured in D/F12 medium, and subcultured for 24 h (A), 48 h (B) and
72 h (C). Neuronal morphology of rMSCs treated with 100 µg/mL salidroside for
24 h (D), 48 h (E), and 72 h (F). rMSC surface antigen profiles determined by
staining with rat-specific monoclonal antibodies followed by flow cytometry (G). The images were
taken by fluorescence microscopy (Olympus, U-TV1 X) under 40× objective. The images shown are
a representative of three independent experiments.
Salidroside induces rMSCs to adopt a neuronal morphology in vitro. MSCs were isolated from the
tibias of rat and cultured in D/F12 medium, and subcultured for 24 h (A), 48 h (B) and
72 h (C). Neuronal morphology of rMSCs treated with 100 µg/mL salidroside for
24 h (D), 48 h (E), and 72 h (F). rMSC surface antigen profiles determined by
staining with rat-specific monoclonal antibodies followed by flow cytometry (G). The images were
taken by fluorescence microscopy (Olympus, U-TV1 X) under 40× objective. The images shown are
a representative of three independent experiments.
Salidroside induces rMSCs to differentiate into neuron-like cells
To determine whether salidroside can induce rMSCs to differentiate into neuron-like cells in
vitro, selected neuronal markers were assessed by immunostaining assay after MSCs were treated with
salidroside (100 µg/mL) for 24–72 h (Figure 2A). With the time of induction increased the percentage of cells expressing NSE,
MAP2, and β-tubulin III significantly increased from 24 to 72 h. These neural markers
were expressed in a time-dependent manner after treatment with salidroside for 24–72 h
(Figure 2B), whereas GFAP expression in cells treated with
salidroside was lower at 24–72 h (Figure
2C).
Figure 2
Salidroside induces rMSCs to differentiate into neuronal-like cells in vitro. (A and B) rMSCs
were incubated in conditioned medium with 100 µg/mL salidroside for
24–72 h. Immunocytochemical detection of the markers of neuronal cells. The images
shown are a representative of three independent experiments. Arrows: rMSCs expressing the neuronal
markers NSE (green), MAP2 (red), β-tubulin III (green) and (C) GFAP (red), Nuclei were
stained with DAPI (blue). Scale bar: 20 µm. (D) Real time-PCR analysis of the
expression of NSE, MAP2 and β-tubulin III
mRNAs in rMSCs treated with 100 µg/mL salidroside (SD) for 24 h. GAPDH was used
as an internal control. Data are shown as mean ± SEM of three independent
experiments. *P < 0.05,
**P < 0.01 versus control. (E and F) Western
blot analysis of the expression of NSE and β-tubulin III
proteins in rMSCs treated with 100 µg/mL salidroside (SD) for 24 h. The blot
shown is a representative of three independent experiments. The results of two-dimensional gel
electrophoresis were quantitated using the Alpha Imager 2000 and Image-Pro Plus Version 6.0. The
average area and band intensity from three to five independent blots were used for each data point.
Actin levels were used to correct for loading in each sample, and fold changes were calculated.
*P < 0.05,
**P < 0.01 versus control.
Salidroside induces rMSCs to differentiate into neuronal-like cells in vitro. (A and B) rMSCs
were incubated in conditioned medium with 100 µg/mL salidroside for
24–72 h. Immunocytochemical detection of the markers of neuronal cells. The images
shown are a representative of three independent experiments. Arrows: rMSCs expressing the neuronal
markers NSE (green), MAP2 (red), β-tubulin III (green) and (C) GFAP (red), Nuclei were
stained with DAPI (blue). Scale bar: 20 µm. (D) Real time-PCR analysis of the
expression of NSE, MAP2 and β-tubulin III
mRNAs in rMSCs treated with 100 µg/mL salidroside (SD) for 24 h. GAPDH was used
as an internal control. Data are shown as mean ± SEM of three independent
experiments. *P < 0.05,
**P < 0.01 versus control. (E and F) Western
blot analysis of the expression of NSE and β-tubulin III
proteins in rMSCs treated with 100 µg/mL salidroside (SD) for 24 h. The blot
shown is a representative of three independent experiments. The results of two-dimensional gel
electrophoresis were quantitated using the Alpha Imager 2000 and Image-Pro Plus Version 6.0. The
average area and band intensity from three to five independent blots were used for each data point.
Actin levels were used to correct for loading in each sample, and fold changes were calculated.
*P < 0.05,
**P < 0.01 versus control.To investigate the effects of salidroside treatment on rMSCs differentiation, Real time-PCR and
Western blot analysis were used to measure expression of NSE, MAP2, and β-tubulin III after
salidroside treatment for 24 h. Treatment with 100 µg/mL salidroside increased
the expression of NSE, MAP2, and β-tubulin
III mRNAs (Figure 2D) and NSE and β-tubulin
III proteins (Figure 2E). NSE,
MAP2 and β-tubulin III reached their mRNA peaks at
24 h (Figure 2C). Both NSE and β-tubulin
III reached their highest protein levels after 48 h (Figure 2F).
Salidroside upregulates the expression of BDNF, NT-3 and NGF mRNAs and promotes their
secretion in rMSCs
To determine whether salidroside can induce rMSCs to express and secrete BDNF, NGF, and NT-3,
Real-time PCR and ELISA analysis were used. At 100 µg/mL salidroside or
10 µg/mL RA for 1–12 days, expression of BDNF,
NT-3 and NGF mRNAs significantly increased in with salidroside for
1–6 days, but had decreased by day 12, with a similar pattern being seen in RA-treated rMSCs
(Figures 3A–3C). ELISA analysis showed that BDNF levels were significantly increased in cells treated
with salidroside for 1–12 days in comparison with untreated controls (Figure 3D), NT-3 and NGF increased for 1–3 days in comparison with
untreated (Figures 3E–3F). The levels of BDNF, NT-3 and NGF increased in cells treated with salidroside
for 1–3 days in comparison with RA treated, but there were no differences between RA and
salidroside treated for 6 and 12 days (Figures
3D–3F).
Figure 3
Salidroside upregulates the expression of BDNF, NT-3 and NGF mRNAs and promotes their secretion
in rMSCs. (A–C) Real-time PCR analysis of the expression of BDNF,
NT-3 and NGF mRNAs in rMSCs treated with 100 µg/mL
salidroside or 10 µg/mL retinoic acid (RA) for 1–12 days.
*P < 0.05,
**P < 0.01,
***P < 0.001 versus control;
#P < 0.01 versus salidroside-treated group.
(D–F) ELISA analysis of the secretion of BDNF, NT-3 and NGF in rMSCs treated with
100 µg/mL salidroside or 10 µg/mL retinoic acid (RA) for
1–12 h. Data are shown as mean ± SEM of three independent
experiments. Different asterisk above each column in the bar graph indicate significant differences.
Statistical analysis was done by the Student’s t-test for two group
comparisons. *P < 0.05,
**P < 0.01 versus control;
#P < 0.01 versus RA-treated group.
Salidroside upregulates the expression of BDNF, NT-3 and NGF mRNAs and promotes their secretion
in rMSCs. (A–C) Real-time PCR analysis of the expression of BDNF,
NT-3 and NGF mRNAs in rMSCs treated with 100 µg/mL
salidroside or 10 µg/mL retinoic acid (RA) for 1–12 days.
*P < 0.05,
**P < 0.01,
***P < 0.001 versus control;
#P < 0.01 versus salidroside-treated group.
(D–F) ELISA analysis of the secretion of BDNF, NT-3 and NGF in rMSCs treated with
100 µg/mL salidroside or 10 µg/mL retinoic acid (RA) for
1–12 h. Data are shown as mean ± SEM of three independent
experiments. Different asterisk above each column in the bar graph indicate significant differences.
Statistical analysis was done by the Student’s t-test for two group
comparisons. *P < 0.05,
**P < 0.01 versus control;
#P < 0.01 versus RA-treated group.
Salidroside induces rMSCs to differentiate into dopaminergic neurons
To characterise the property of salidroside-induced rMSCs-differentiated neurons, the expression
of DBH, DDC, and TH, the markers of dopaminergic neurons, were analysed by immunostaining assay,
which showed that 100 µg/mL salidroside or 10 µg/mL RA for 1–12
days significantly increased the percentage of DBH + or DDC+
cells compare to the control (Figures 4A–D).
Expression of TH was also increased in salidroside (Figure
5C) compared with cells treated with RA (Figure 5B)
and untreated control (Figure 5A). TH mRNA
expression was increased after 1–6 days of treatment (Figure
5D), which was confirmed by Western blotting, compared with control or RA-treated cells
(Figures 5F and G). ELISA was used to measure DA in MSCs
that were treated with salidroside in comparison with the cells treated with RA or control for
1–12 days. DA was readily increased after treatment with salidroside for 1–3 days, but
dropped off by 12 days (Figure 5E). These results suggest
that increased DA is consistent with that of TH expression after treatment with salidroside for
1–3 days.
Figure 4
Salidroside increases the percentage of DBH + or DDC+ cells
in rMSCs. rMSCs were treated with 100 µg/mL salidroside or 10 µg/mL
retinoic acid (RA) for 1–12 days, followed by immunocytochemical analyses (A) DBH, (B) DDC.
The images shown are a representative of three independent experiments. Scale bar:
50 µm. To determine the percentage of DBH (C) and DDC (D) positive cells in a
particular condition, the total number of cells and the number of cells with a specific
immunoreactivity were counted in 10–12 randomly selected fields of 2–3 different
coverslips. Each experiment was repeated at least three times. Data are shown as
mean ± SEM. *P < 0.05,
**P < 0.01 versus control. Different asterisk
above each column in the bar graph indicate significant differences. Statistical analysis was done
by the Student’s t-test for two group comparisons.
Figure 5
Salidroside increases the percentage of TH+ cells and upregulates the
expression of TH mRNA and protein in rMSCs. (A–C) rMSCs were treated with
100 µg/mL salidroside or 10 µg/mL retinoic acid (RA) for 3 days,
followed by immunocytochemical analyses TH. The images shown are a representative of three
independent experiments. Scale bar: 50 µm. (D) rMSCs were harvested for RNA
preparations at 1–12 days after induction. Samples were analysed by Real Time-PCR to examine
the expressions of TH mRNA. The data represent the mean ± SEM
of three independent experiments. *P < 0.05,
**P < 0.01 versus control. (E) ELISA analysis of
the secretion of DA in rMSCs treated with 100 µg/mL salidroside or
10 µg/mL retinoic acid (RA) for 1–12 days. Data are shown as
mean ± SEM. Of three independent experiments.
*P < 0.05,
**P < 0.01 versus control. (F and G) The
expression of TH protein in rMSCs treated with 100 µg/mL salidroside
or 10 µg/mL retinoic acid (RA) for 1–12 days was determined by Western blot.
Actin levels were used to correct for loading in each sample, and fold changes were calculated. Data
are shown as mean ± SEM. Of three independent experiments.
**P < 0.01 versus control,
##P < 0.01 versus RA-treated.
Salidroside increases the percentage of DBH + or DDC+ cells
in rMSCs. rMSCs were treated with 100 µg/mL salidroside or 10 µg/mL
retinoic acid (RA) for 1–12 days, followed by immunocytochemical analyses (A) DBH, (B) DDC.
The images shown are a representative of three independent experiments. Scale bar:
50 µm. To determine the percentage of DBH (C) and DDC (D) positive cells in a
particular condition, the total number of cells and the number of cells with a specific
immunoreactivity were counted in 10–12 randomly selected fields of 2–3 different
coverslips. Each experiment was repeated at least three times. Data are shown as
mean ± SEM. *P < 0.05,
**P < 0.01 versus control. Different asterisk
above each column in the bar graph indicate significant differences. Statistical analysis was done
by the Student’s t-test for two group comparisons.Salidroside increases the percentage of TH+ cells and upregulates the
expression of TH mRNA and protein in rMSCs. (A–C) rMSCs were treated with
100 µg/mL salidroside or 10 µg/mL retinoic acid (RA) for 3 days,
followed by immunocytochemical analyses TH. The images shown are a representative of three
independent experiments. Scale bar: 50 µm. (D) rMSCs were harvested for RNA
preparations at 1–12 days after induction. Samples were analysed by Real Time-PCR to examine
the expressions of TH mRNA. The data represent the mean ± SEM
of three independent experiments. *P < 0.05,
**P < 0.01 versus control. (E) ELISA analysis of
the secretion of DA in rMSCs treated with 100 µg/mL salidroside or
10 µg/mL retinoic acid (RA) for 1–12 days. Data are shown as
mean ± SEM. Of three independent experiments.
*P < 0.05,
**P < 0.01 versus control. (F and G) The
expression of TH protein in rMSCs treated with 100 µg/mL salidroside
or 10 µg/mL retinoic acid (RA) for 1–12 days was determined by Western blot.
Actin levels were used to correct for loading in each sample, and fold changes were calculated. Data
are shown as mean ± SEM. Of three independent experiments.
**P < 0.01 versus control,
##P < 0.01 versus RA-treated.
Discussion
The ability of MSCs to differentiate in vitro along a neural lineage allows potential therapeutic
applications for the treatment of neurological diseases and CNS trauma. MSCs have the potential to
trans-differentiation into neuronal phenotypes in vitro (Woodbury et al., 2000; Abouelfetouh et al., 2004). Our data
clearly demonstrate that rMSCs transdifferentiate into neuronal phenotype in vitro. Clearly, after
72 h of induction, a neuronal-like phenotype accounted for >64% of the total
population, which agrees with the expressions of neuronal markers, salidroside induced rMSCs to
increase the percentage of NSE+, MAP2+ and β-tubulin
III+ cells (Figure 2A), and the
upregulation of the expression of NSE, MAP2, and
β-tubulin III mRNAs (Figures 2B and
C), and NSE and β-tubulin III proteins (Figures 2D
and E) for 24–72 h. The data indicate that salidroside induced rMSCs to differentiate
into neuron-like cells in vitro.To date, many ectogenic factors, such as cAMP analogs, RA, BMPs (Tio et al., 2010), NGF (Brederlau et al., 2002), BDNF (Shi et al., 2012), GDNF and other
factors (Trzaska et al., 2009) have been used for neuron-like
differentiation. The innate capacity of MSCs to influence neural cell growth, survival and
differentiation, is to express the endogenic neurotrophic factors. Crigler et al. (2006) demonstrated that specific subpopulations of hMSCs expressed
BDNF and β-NGF but not neurotrophin-3 and -4. They used a co-culture assay to demonstrate
that BDNF expression levels correlated with the ability of MSC subclones to induce survival and
neurite outgrowth in the SH-SY5Yneuroblastoma cell line. The effects were only partially inhibited
by a neutralizing anti-BDNF antibody, indicating that other factors secreted by the MSCs also had
neuroregulatory effects. Neurite extension MSCs secrete neurotrophic factors involving NGF and BDNF,
and these neurotrophic factors can upregulate TH gene expression in PC12 cells and neural stem cells
(Jin et al., 2008). In this study, salidroside induced rMSCs
to upregulate the expression of BDNF, NT-3 and
NGF mRNAs and the secretion of these growth factors (Figure 3), especially, salidroside increase NT-3 expression,
these endogenic factors play a vital role in regulating MSCs differentiate into dopamine neurons in
the presence of salidroside.DBH and DDC are key synthetases of dopamine, which are responsible for the conversion of dopa to
dopamine (Smeyne and Jackson-Lewis, 2005). TH is the
rate-limiting enzyme in the synthesis of catecholamine and is widely used as a marker of
dopaminergic cells (O’Byrne et al., 2000). In this
study, to determine the efficacy of differentiation, cells were tested with the related markers of
dopamine neurons. Immunostaining confirmed that salidroside increases the percentage of DBH
+, DDC+ or TH+ cells in the MSCs treated with
salidroside in comparison with cells treated with RA (Figures
4 and 5A–C), Expression of TH
mRNA and protein were upregulated after treatment with salidroside (Figures 5D, 5F and 5G). We also have demonstrated that the level of dopamine (DA) in MSCs increased in the
presence with salidroside. DA release indicates that in vitro-generated DA neurons induced with
salidroside are functional. Salidroside not only induced MSCs to differentiate into dopaminergic
neuron, but increased DA release. This is supported by the fact that salidroside enhanced secretion
of BDNF, NT-3 and NGF may be responsible for MSCs expression of DBH, DDC and TH, which converted
MSCs into dopaminergic neurons. It is interesting that the expression of BDNF,
NT-3, NGF, DBH, DDC, TH and DA was clearly decreased after
treatment with salidroside or RA for 12 days. There may be several reasons: (i) in our study, the
longest time that salidroside induced MSCs is 12 days, but these growth factor or the markers of
dopamine change over a longer time, which is unclear. (ii) Change of the growth factor or the
markers of dopamine in MSCs after treatment with salidroside is different during the induction
period; increase was rapid in early differentiation, whereas these effects were slow in the later
period. (iii) The inducing effect of salidroside may be important in early differentiated stage of
MSCs, which conduce to dopaminergic neurons differentiation for early treatment of
Parkinson’s disease with MSCs in clinic. These reason may give impetus to future studies
involving dopaminergic neurons of MSCs treated with salidroside.This report provides a novel tactic for the application of active constituents of traditional
Chinese medicinal herbs to the induction of MSCs differentiation towards dopaminergic neurons, which
could have potential in clinical treatment.
Authors: Yuehua Jiang; Balkrishna N Jahagirdar; R Lee Reinhardt; Robert E Schwartz; C Dirk Keene; Xilma R Ortiz-Gonzalez; Morayma Reyes; Todd Lenvik; Troy Lund; Mark Blackstad; Jingbo Du; Sara Aldrich; Aaron Lisberg; Walter C Low; David A Largaespada; Catherine M Verfaillie Journal: Nature Date: 2002-06-20 Impact factor: 49.962
Authors: Tamir Ben-Hur; Maria Idelson; Hanita Khaner; Martin Pera; Etti Reinhartz; Anna Itzik; Benjamin E Reubinoff Journal: Stem Cells Date: 2004 Impact factor: 6.277
Authors: R F Pereira; K W Halford; M D O'Hara; D B Leeper; B P Sokolov; M D Pollard; O Bagasra; D J Prockop Journal: Proc Natl Acad Sci U S A Date: 1995-05-23 Impact factor: 11.205