Development of a PCR based marker system for easy identification and classification of aerobic endospore forming bacilli.

Restriction fragment length analysis of 16S rRNA gene of 52 different aerobic endospore forming Bacilli (AEFB) strains with HaeIII enzyme has revealed the presence of a 460 bp long fragment in 50 AEFB strains. BLAST analysis revealed that the fragment was 463 bp long and it was located at 3' end of 16S rRNA gene. Further specificity of this fragment for AEFB strains was checked by PCR and in silico methods. In PCR based method a primer pair (463 F and 463R) specific to this fragment was designed and this primer pair has shown amplification of 463 bp fragment in AEFB strains only. In in silico methods homology of primer pair and presence of restriction enzyme site in 16S rRNA genes were checked in 268 species of AEFB. Almost all species of AEFB have shown positive results for both of the tests. Further multiple alignments of 463 bp sequences of different species of AEFB have shown that it is a good marker for identification and classification of AEFB.

Introduction

Aerobic endospore-formers have long been considered to be important components of the soil bacterial community (Mandic-Mulec and Prosser 2011). There is a great diversity of physiology among the aerobic spore formers. Their collective features include degradation of all substrates derived from plant and animal sources including cellulose, starch, pectin, proteins, agar, hydrocarbons and others, antibiotic production, nitrification, denitrification, nitrogen fixation, facultative lithotrophy, autotrophy, acidophily, alakliphily, psychrophily, thermophily and parasitism. Endospore formation, universally found in this group, is thought to be a strategy for survival even under adverse soil environment, where these bacteria predominate (Kumar et al. 2012). To get the beneficial effects of these AEFB it becomes very necessary to know how much diverse and abundant these microbes are in different soil ecosystems. Since 1990s various approaches based on phenotypic and genotypic characteristics have been applied to identify and classify the members of class Bacilli. Few decades before genus Bacillus was the only representative of class Bacilli among aerobic spore formers. Development of cultivation independent approaches have attracted microbiologist towards the molecular approaches for examining the microbes in a better way. Among different molecular methods, 16S rRNA gene sequencing is the best one. Since 1991, several new genera of aerobic spore formres like Amphibacillus (Niimura et al. 1990), Paenibacillus (Ash et al. 1991, 1993), Alicyclobacillus (Wisotzkey et al. 1992), Aneurinibacillus (Shida et al. 1996), Brevibacillus (Shida et al. 1996), Gracilibacillus (Waino et al. 1999), Salibacillus (Waino et al. 1999), Virgibacillus (Heyndrickx et al. 1998), Filobacillus (Schlesner et al. 2001), Geobacillus (Nazina et al. 2001), Jeotgalibacillus and Marinibacillus (Yoon et al. 2001) and Ureibacillus (Fortina et al. 2001) have been created based on this method. For phylogenetic arrangement of these newly discovered texa various markers based on 16S rDNA have been developed by different scientists (Priest et al. 1988; Ash et al. 1991; Gurtler and Stanisich 1996; Daffonchio et al. 1998a, b; Goto et al. 2000; Stackebrandt and Swiderski 2002; Xu and Cote 2003; De Clerck et al. 2004; Vardhan et al. 2011). Primer set developed by Garbeva et al. (2003) was found to be 100% specific for many of species of Bacillus and related genera. After a gap of years, Vardhan et al. (2011) developed a set of primers for identification of hyper variable region of 16S rDNA in different Bacillus species and partial sequencing of this hyper variable region behaves as an index for easy identification of species related to genera Bacillus.

With development of more advanced approaches to find cultivable and noncultivable diversity of microbes, lot of new species and genera, belonging to AEFB are discovering day by day. So, need of new marker systems is always there for proper identification and classification of these lineages. Hence the main objective of present study was to develop a simple and easy identification and classification tool for Bacillus and related genera which is an extension of research related to bacilli. The restriction digestion of amplified 16S rRNA gene by HaeIII enzyme has given a fragment of around 460 bp length in all species of Bacillus and related genera. Sequence information of this fragment (downloaded from NCBI) was used to find exact length of the fragment (463 bp) and to develop specific primers for amplification of this fragment in AEFB genera. Further sequence information and multiple alignment of 463 bp long sequences of different species of AEFB genera has revealed that this is an easy tool for identification and classification of the members of Bacillus and related genera. Another beneficial information provided by our study is that almost all species of Bacillus and related genera have restriction enzyme sites for Hae III enzyme which give a product of 460 bp. Restriction enzyme site for HaeIII are present at different positions in other bacterial lineages, therefore give product of different size after restriction digestion which clearly discriminate the Bacillus and related genera from others.

Material and methods

Bacterial strains

All of the bacterial strains used in the present study are Bacilli isolated from the rhizospheric soil of Phyllanthus amarus which were identified by 16S rRNA gene sequencing in our previous research work (Kadyan et al. 2013). Taxonomic information and accession numbers of isolates have been given in Table 1.

Table 1

Strain names and NCBI accession numbers of 52 AEFB strains isolated from rhizospheric soil of

Strain code	Bacterial isolate	Accession number	Strain code	Bacterial isolate	Accession number
1.P3	B. marisflavi JP44SK40	JX129227	15.P2	B. subtilis subsp. spizizenii JP44SK24	JX144714
2.P1	B. megaterium JP44SK1	JX144691	16.P1	B. simplex JP44SK25	JX144715
2.P2	B. megaterium JP44SK2	JX144692	16.P2	B. simplex JP44SK26	JX144716
3.P1	Lysinibacillus sphaericus JP44SK3	JX144693	17.P3	B. cereus JP44SK27	JX144717
3.P2	Lysinibacillus sphaericus JP44SK4	JX144694	18.P3	B. aquimaris JP44SK28	JX144718
3.P3	B. megaterium JP44SK5	JX144695	19.P1	B. simplex JP44SK29	JX144719
4.P1	B. licheniformis JP44SK6	JX144696	19.P2	B. simplex JP44SK30	JX144720
5.P3	Paenibacillus taiwanensis JP44SK7	JX144697	20.P1	B. simplex JP44SK31	JX144721
6.P1	B. mycoides JP44SK8	JX144698	20.P2	B. simplex JP44SK32	JX144722
6.P3	B. mycoides JP44SK9	JX144699	23.P1	B. cereus JP44SK33	JX144723
7.P1	B. aryabhattai JP44SK11	JX144701	23.P2	B. cereus JP44SK34	JX144724
7.P2	B. megaterium JP44SK10	JX144700	23.P3	B. megaterium JP44SK35	JX144725
7.P3	Lysinibacillus xylanilyticu s JP44SK52	JX155769	24.P1	B. mycoides JP44SK36	JX144726
8.P1	B. simplex JP44SK12	JX144702	24.P3	B. cereus JP44SK37	JX144727
8.P2	B. simplex JP44SK13	JX144703	25.P2	B. aryabhattai JP44SK38	JX144728
8.P3	B. arsenicus JP44SK14	JX144704	26.P3	B. megaterium JP44SK39	JX144729
9.P3	B. marisflavi JP44SK15	JX144705	27.P1	Brevibacillus laterosporus JP44SK41	JX155758
10.P3	B. firmus JP44SK16	JX144706	27.P3	B. cereus JP44SK42	JX155759
11.P1	B. firmus JP44SK17	JX144707	30.P1	B. cereus JP44SK43	JX155760
11.P3	B. megaterium JP44SK18	JX144708	31.P3	Jeotgalibacillus sp. JP44SK56	KC012993
12.P3	B. flexus JP44SK19	JX144709	36.P3	B. cereus JP44SK44	JX155761
13.P1	B. megaterium strain JP44SK21	JX144711	37.P3	B. cereus JP44SK45	JX155762
13.P3	B. firmus JP44SK20	JX144710	38.P3	Terribacillus saccharophilus JP44SK46	JX155763
14.P2	Brevibacillus laterosporus JP44SK51	JX155768	41.P3	Terribacillus goriensis JP44SK47	JX155764
14.P3	B. cereus JP44SK22	JX144712	43.P3	B. cereus JP44SK49	JX155766
15.P1	B. subtilis subsp. spizizenii JP44SK23	JX144713	44.P3	B. mycoides JP44SK50	JX155767

16S rRNA gene amplification and restriction digestion by HaeIII enzyme

Gene coding for 16S rRNA gene of all of the 52 AEFB strains along with 10 reference strains (Shigella Flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumonia ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marcescens MTCC4822, Bacillus subtilis MTCC7193, and Staphylococcus aureus MTCC7443) was amplified by using universal primers i.e. B27f (5'-AGAGTTTGATCCTGGCTCAG-3') and U1492R (5'- GGTTACCTTGTTACGACTT-3') in thermal cycler (Biorad). Further reaction mixture for restriction digestion was prepared by mixing 8.5 μl of purified PCR products, 5 U of restriction endonuclease, HaeIII (Fermentas) and 1.0 μl of 10X recommendation buffer. Reaction mixture was incubated overnight in water bath at 37°C. Restriction digested DNA was analysed by horizontal electrophoresis in 2% agarose gels with 100 bp DNA marker. The gels were visualized on a gel documentation system (Alpha Innotech). Photograph of gel has been shown in Figure 1(a&b).

Figure 1

Gel photograph showing ARDRA pattern of 52 AEFB strains (a) Gel photograph of ARDRA pattern of 52 AEFB strains digested with Hae III restriction enzyme.(b) Gel photograph of ARDRA pattern of 10 reference strains digested with Hae III restriction enzyme. (c) Gel photograph of PCR amplified 463 bp fragments in 52 strains of AEFB. (d) Gel photograph of PCR amplification result of 463 bp fragments in 10 reference strains. (a) Lane M - 100 bp DNA marker. Lanes 1–52 indicate bacterial strain codes (2.P1, 3.P1, 4.P1, 6.P1, 7.P1, 8.P1, 11.P1, 13.P1, 15.P1, 16.P1, 19.P1, 20.P1, 23.P1, 24.P1, 27.P1, 30.P1, M, 2.P2, 3.P2, 7.P2, 8.P2, 15.P2, 16.P2, 19.P2, 20.P2, 23.P2, 14.P2, M, 1.P3, 3.P3, 5.P3, 6.P3, 7.P3, 8.P3, 9.P3, 10.P3, 11.P3, 12.P3, 13.P3, 14.P3, 17.P3, 18.P3, 24.P3, M, 23.P3, 25.p2, 26.P3, 27.P3, 31.P3, 36.P3, 37.P3, 38.P3, 41.P3, 43.p3, 44.p3). (b) Lane M -100 bp DNA marker, lane 1–10 Shigella flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumoniae ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marrcescens MTCC4822, Bacillus subtilis MTCC7193, Staphylococcus aureus MTCC7443. Arrow indicates the size of 460 bp fragment in Bacillus subtilis MTCC7193. (c): M - 100 bp DNA marker, lane 1–52 (1.P3, 2.P1, 2.P2, 3.P1, 3.P2, 3.P3, 4.P1, 5.P3, 6.P1, 6.P3, 7.P1, 7.P2, 7.P3, 8.P1, 8.P2, 8.P3, 9.P3, 10.P3, 11.P1, 11.P3, 12.P3, 13.P1, 13.P3, 14.P2, 14.P3, 15.P1, 15.P2, 16.P1, 16.P2, 17.P3, 18.P3, 19.P1, 19.P2, 20.P1, 20.P2, 23.P1, 23.P2, 23.P3, 24.P1, 24.P3, 25.P2, 26.P3, 27.P1, 27.P3, 30.P1, 31.P3, 36.P3, 37.P3, 38.P3, 41.P3, 43.P3, 44.P3). Arrow indicates the size of fragment. (d): Bacterial strain Bacillus subtilis MTCC7193, present in lane no. 3 has shown amplification of 463bp fragment and other reference strains have not shown any amplification. Arrow indicates the size of fragment compared with marker of 100 bp present in lane M.

Restriction pattern analysis and designing of oligonucleotide primers

Restriction pattern analysis of HaeIII digested 16S rRNA gene has shown the presence of a fragment having length around 460 bp (Figure 1a) in all of the bacterial species belonging to Bacillus and related genera (except Bacillus arsenicus, Paenibacillus taiwanensis and 9 reference strains related to other bacterial lineages) (Figure 1b). On the basis of these observations it was assumed that this 460 bp fragment was specific for Bacillus and related genera. To find out the exact location and sequence information of this fragment, 16S rRNA gene sequence of all of the Bacillus isolates taken in our study was downloaded from NCBI gene bank database. All of the 16S rRNA gene sequences were checked for HaeIII enzyme cut sites (GG↓CC). Sequence between two cut sites having length of around 460 bp was found in all of the 16S rRNA gene sequences at same position. Further length of this region was found to be 461-463 bp. Primer pair specific to this region was designed by using software, Primer 3.0 and further synthesized from the facility available at Eurofins Genomics India Pvt. Ltd., Bangalore.

Sequence specificity of primer pair and occurrence of restriction enzyme site

The specificity of oligonucleotide primers was checked by PCR amplification of the 463 bp fragment in all of the 52 AEFB isolates along with 10 reference strains (Shigella Flexneri ATCC12022, Proteus mirabilus ATCC43071, Staphylococcus aureus ATCC259323, E. Coli ATCC25922, Salmonella typhimurium ATCC13311, Klebsiella pneumonia ATCC 700603, Pseudomonas fluorescens MTCC1749, Serretia marcescens MTCC4822, Bacillus subtilis MTCC7193, and Staphylococcus aureus MTCC7443). Reaction conditions for PCR were, initial denaturation at 94°C for 5 minutes, 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 20 seconds, extension at 72°C for 30 seconds and at last final extension at 72°C for 7 minutes. Theoretically primer pair was checked for its specificity in 16S rRNA gene sequences (downloaded from NCBI) in different species of Bacillus and related genera i.e. 153 different species of Bacillus, 20 Virgibacillus, 15 Geobacillus, 1 Filobacillus, 4 Jeotgalibacillus, 5 Ureibacillus, 21 Alicyclobacillus, 5 Amphibacillus, 5 Aneurinibacillus, 16 Brevibacillus, 9 Gracilibacillus, 5 Paenibacillus, 5 Lysinibacillus and 4 Terribacillus. A number of other bacterial lineages of Gram positive and negative bacteria were also checked for primer specificity which includes genera from phylum Firmicutes (other than Bacilli), Actinobacteria, Alpha Proteobacteria, Beta Proteobacteria and Gamma Proteobacteria.

Multiple alignment of 463 bp long partial 16S rDNA sequence of different species of Bacilli

To check the ability of marker for classification of Bacilli, we have done the multiple alignments of specific, 463 bp long sequences of 16S rRNA gene of 52 strains (taken in our study) with the reference sequences downloaded from NCBI. Multiple alignment of very closely related species of genus Bacillus (29 different species of Bacillus) lying in two nearby clusters in all species living tree by Yarza et al. (2010) has also been done to check the differentiation ability of this sequence. Software Clustal X 2.0 (Larkin et al. 2007) was used for alignment of different sequences and further alignment file was used in molecular evolutionary genetic analysis software version 5.1 (MEGA 5.1) (Tamura et al. 2011) for construction of phylogenetic tree.

Results

Oligonucleotide primers

Bacillus and related genera specific primers designed in our study were named as 463 F (5’CTAAAACTCAAAGGAATTGACG3’) and 463R (5’AATACGTTCCCGGGCCTT3’).

PCR amplification of 463 bp sequence

PCR amplification has confirmed the specificity of the primer pair in 52 AEFB strains and 10 reference strains. Out of total, 50 strains belonging to Bacillus and related genera have shown the amplification of the specific region. However, the region was not amplified in Bacillus arsenicus, Paenibacillus taiwanensis and 9 reference strains (Figure 1c & d).

Sequence homology of primers in 16S rRNA gene sequences of and related genera

Primer sequences were found to be 100% similar with the 16S rRNA gene sequences (downloaded from NCBI) of 120 species of genera Bacillus, 13 Geobacillus, 1 Filobacillus, 4 Jeotgalibacillus, 5 Ureibacillus, 7 Alicyclobacillus, 2 Brevibacillus and 5 Lysinibacillus. Number of other bacterial lineages of Gram positive and negative bacteria which includes genera from phyla Firmicutes (Staphylococcus chromogenes D83360, Streptococcus pyogenes AB002521, Enterococcus faecalis AB012212, Clostridium populeti X71853, Listeria monocytogenes X56153), Actinobacteria (Corynebacterium diphtheria X84248, Mycobacterium tuberculosis X58890, Nocardia asteroids AF430019, Streptomyces lavendulae subsp. Lavendulae D85116), Alpha proteobacteria (Rhizobium leguminosarum U29386, Azospirillum lipoferum Z29619, Acetobacterium woodii X96954), Beta proteobacteria (Burkholderia cepacia U96927, Bordetella pertussis U04950) and Gamma Proteobacteria (Pseudomonas aeruginosa X06684, Escherichia coli X80725, Klebsiella pneumoniae X87276, Shigella dysenteriae X96966) have not shown any sequence homology (Table 2).

Table 2

% similarity of 463 bp sequence of 16S rRNA gene of type sp. ( ) with 16S rRNA sequences of different AEFB strains (downloaded from NCBI), primer sequences in these AEFB strains, presence and absence of restriction enzyme site and position of specific fragment in AEFB strains

Sr. no.	Name of bacteria	NCBI accession no.	Sequence of primer pair in different AEFB strains	% similarity of 463 bp sequence and presence of restriction enzyme site	Position of 463 bp sequence in 16S rRNA gene
1	Alicyclobacillus sacchari	AB264020	AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	913-1374
2	Alicyclobacillus acidiphilus	AB076660	AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%-	913-1374
3	Alicyclobacillus acidoterrestris	AB042057	AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	910-1371
4	Alicyclobacillus hesperidum	AJ133633	AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	884-1345
5	Alicyclobacillus fastidiosus	AB264021	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	910-1371
6	Alicyclobacillus vulcanalis	AY425985	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	894-1355
7	Alicyclobacillus sendaiensis	AB084128	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	885-1346
8	Alicyclobacillus contaminans	AB264026	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	925-1386
9	Alicyclobacillus acidocaldarius subsp. acidocaldarius (Type sp)	AJ496806	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	87%+	902-1363
10	Alicyclobacillus aeris	FM179383	AATCC GTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	911-1372
11	Alicyclobacillus pomorum	AB089840	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	911-1372
12	Alicyclobacillus disulfidooxidans	AB089843	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	85%+	911-1372
13	Alicyclobacillus tolerans	Z21979	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	87%-	906-1365
14	Alicyclobacillus ferrooxydans	EU137838	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	913-1374
15	Alicyclobacillus cycloheptanicus	AB042059	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	911-1372
16	Alicyclobacillus macrosporangiidus	AB264025	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	87%-	927-1388
17	Alicyclobacillus kakegawensis	AB264022	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	86%+	924-1385
18	Alicyclobacillus shizuokensis	AB264024	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	87%+	924-1385
19	Alicyclobacillus herbarius	AB042055	AATC CGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	87%+	924-1385
20	Alicyclobacillus pohliae	AJ564766	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	88%+	904-1363
21	Alicyclobacillus tolerans	Z21979	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	87%-	906-1365
22	Amphibacillus sediminis	AB243866	AATACGTTCCCGGGTC TT CTGAAACTCAAAA GAATTGACG	96%-	928-1386
23	Amphibacillus jilinensis,	FJ169626	AATACGTTCCCGGGTC TT CTGAAACTCAAAA GAATTGACG	95%-	948-1406
24	Amphibacillus tropicus	AF418602	AATACGTTCCCGGGTC TT CTGAAACTCAAAA GAATTGACG	95%-	905-1362
25	Amphibacillus fermentum	AF418603	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT	93%-	910-1368
26	Amphibacillus xylanus, type sp.	D82065	AATACGTTCCCGGGTC TT CTGAAACTCAAAA GAATTGACG	94%-	948-1406
27	Aneurinibacillus aneurinilyticus type sp.	X94194	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	91%-	903-1369
28	Aneurinibacillus migulanus	X94195	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT	90%-	903-1359
29	Aneurinibacillus danicus	AB112725	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT	91%-	903-1354
30	Aneurinibacillus thermoaerophilus	X94196	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT	92%-	904- 1361
31	Aneurinibacillus terranovensis	AJ715385	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT	91%-	897-1353
32	Brevibacillus centrosporus	D78458	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	917-1377
33	Brevibacillus choshinensis	AB112713	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	894-1354
34	Brevibacillus reuszeri	AB112715	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	894-1354
35	Brevibacillus parabrevis	AB112714	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	894-1354
36	Brevibacillus brevis type sp.	AB271756	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	896-1356
37	Brevibacillus formosus	AB112712	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	894-1354
38	Brevibacillus agri	AB112716	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	895-1355
39	Brevibacillus limnophilus	AB112717	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	909-1369
40	Brevibacillus invocatus	AF378232	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	896-1356
41	Brevibacillus panacihumi	EU383033	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	902-1362
42	Brevibacillus borstelensis	AB112721	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	894-1354
43	Brevibacillus ginsengisoli	AB245376	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	873-1333
44	Brevibacillus laterosporus	D16271	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	896-1356
45	Brevibacillus fluminis	EU375457	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	896-1356
46	Brevibacillus levickii	AJ715378	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	897-1357
47	Brevibacillus thermoruber	Z26921	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	915-1376
48	Gracilibacillus lacisalsi	DQ664540	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	94%+	933-1393
49	Gracilibacillus thailandensis	FJ182214	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	94%+	942-1402
50	Gracilibacillus saliphilus	EU784646	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	94%+	917-1377
51	Gracilibacillus orientalis	AM040716	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	93%+	931-1391
52	Gracilibacillus dipsosauri	AB101591	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	95%+	923-1383
53	Gracilibacillus ureilyticus	EU709020	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	95%+	923-1383
54	Gracilibacillus boraciitolerans	AB197126	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	94%+	935-1395
55	Gracilibacillus halotolerans type sp.	AF036922	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	94%+	934-1394
56	Gracilibacillus halophilus	EU135704	CTGAAACTCAAAA GAATTGACG AATACGTTCCCGGGCCTT	94%+	924-1384
57	Paenibacillus polymyxa type sp.	D16276	AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG	90%-	913-1375
58	Paenibacillus antarcticus	AJ605292	AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG	90%-	915-1374
59	Paenibacillus macquariensis subsp. macquariensis	X60625	AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG	90%-	935-1394
60	Paenibacillus macquariensis subsp. defensor	AB360546	AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG	90%+	936-1395
61	Paenibacillus glacialis	EU815294	AATACGTTCCCGGGT CTT CTGAAACTCAAAGGAATTGACG	91%-	934-1393
62	Virgibacillus pantothenticus type sp.	D16275	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	95%-	919-1375
63	Virgibacillus proomii	AJ012667	CTGAAACTCAAAAGA ATTGACG AATACGTTCCCGGGTC TT	95%-	916-1372
64	Virgibacillus salexigens	Y11603	CTGAAACTCAAAAG AATTNACG AATACGTTCCCGGGCCTT	95%+	921-1379
65	Virgibacillus marismortui	AJ009793	AATACGTTCCCGGGCCTT CTGAAACTCAAAAG AATTGACG	95%+	947-1407
66	Virgibacillus salarius	AB197851	AATACGTTCCCGGGCCTT CTGAAACTCAAAA GAATTGACG	95%+	949-1409
67	Virgibacillus olivae	DQ139839	AATACGTTCCCGGGCCTT CTGAAACTCAAAAG AATTGACG	95%+	948-1409
68	Virgibacillus halodenitrificans	AY543169,	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	926-1386
69	Virgibacillus koreensis	AY616012	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	97%+	926-1386
70	Virgibacillus halophilus	AB243851	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	94%+	926-1386
71	Virgibacillus sediminis	AY121430	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	96%-	946-1406
72	Virgibacillus xinjiangensis	DQ664543	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	96%-	894-1354
73	Virgibacillus chiguensis	EF101168	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	96%-	919-1375
74	Virgibacillus dokdonensis	AY822043	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGT CTT	96%-	927-1383
75	Virgibacillus carmonensis	AJ316302	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	925-1385
76	Virgibacillus necropolis	AJ315056	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	925-1385
77	Virgibacillus arcticus	EF675742	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	809- 1269
78	Virgibacillus byunsanensis	FJ357159	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	923-1383
79	Virgibacillus salinus	FM205010	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	932-1392
80	Virgibacillus subterraneus	FJ746573	AATACGTTCCCGGC CCTT CTGAAACTCAAAAG AATTGACG	91%+	905-1362
81	Virgibacillus kekensis	AY121439	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	945-1405
82	Geobacillus stearothermophilus type sp.	AB021196,	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	912-1376
83	Geobacillus kaustophilus	X60618	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	933-1390
84	Geobacillus lituanicus	AY044055	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	933-1397
85	Geobacillus thermoleovorans	Z26923	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	918-1382
86	Geobacillus thermocatenulatus	AY608935	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	940-1404
87	Geobacillus jurassicus	AY312404	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	915-1379
88	Geobacillus uzenensis	AF276304	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	907-1370
89	Geobacillus subterraneus	AF276306	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	931-1395
90	Geobacillus thermodenitrificans	AY608961	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	939-1409
91	Geobacillus debilis	AJ564616	AATACGTTCT CGGGCCTT CTGAAACTCAAAGGAATTGACG	91%-	936-1398
92	Geobacillus toebii	AF326278	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	910-1374
93	Geobacillus thermoglucosidasius	AY608981	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	939-1405
94	Geobacillus caldoxylosilyticus	AF067651	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	925-1389
95	Geobacillus tepidamans	AY563003	G TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	872-1334
96	Geobacillus vulcani	AJ293805	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	920-1384
97	Filobacillus milosensis	AJ238042,	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	915-1375
98	Jeotgalibacillus alimentarius.	AF281158	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	911-1373
99	Jeotgalibacillus salarius	EU874389	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	910-1372
100	Jeotgalibacillus campisalis	AY190535	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	908-1370
101	Jeotgalibacillus marinus	AJ237708	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	918-1380
102	Ureibacillus thermosphaericus	AB101594	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	931-1392
103	Ureibacillus composti	DQ348071	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	929-1390
104	Ureibacillus thermophilus	DQ348072	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	931-1392
105	Ureibacillus suwonensis	AY850379	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%-	918-1379
106	Ureibacillus terrenus	AJ276403	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%-	900-1361
107	Lysinibacillus boronitolerans	AB199591	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	898-1360
108	Lysinibacillus xylanilyticus	FJ477040	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	826-1288
109	Lysinibacillus fusiformis	AJ310083	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	920-1382
110	Lysinibacillus sphaericus	AJ310084	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	920-1382
111	Lysinibacillus parviboronicapiens	AB300598	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	910-1372
112	Terribacillus goriensis	DQ519571	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	94%+	895-1355
113	Terribacillus saccharophilus	AB243845	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	94%+	922-1382
114	Terribacillus halophilus	AB243849	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	922-1382
115	Terribacillus aidingensis	FJ386524	CTGAAACTCAAAAG AATTGACG AATACGTTCCCGGGCCTT	95%+	922-1382
116	Bacillus massiliensis	AY677116	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	93%+	908-1370
117	Bacillus cecembensis	AM773821	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	93%+	931-1393
118	Bacillus odysseyi	AF526913	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	93%+	931-1393
119	Bacillus decisifrondis	DQ465405	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	85%+	843-1305
120	Bacillus psychrodurans	AJ277984	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	95%-	918-1380
121	Bacillus psychrotolerans	AJ277983	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	95%-	903-1365
122	Bacillus insolitus	AM980508	GAGGGGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	94%+	917-1378
123	Bacillus beijingensis	EF371374	AATACGTTCCCGGGTCTT CTGAAACTCAAAGGAATTGACG	96%-	929-1387
124	Bacillus ginsengi	EF371375	AATACGTTCCCGGGTCTT CTGAAACTCAAAGGAATTGACG	97%-	929-1387
125	Bacillus aquimaris	AF483625	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	99%+	910-1372
126	Bacillus vietnamensis	AB099708	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	98%+	903-1365
127	Bacillus marisflavi	AF483624	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	100%+	909-1371
128	Bacillus seohaeanensis	AY667495	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	98%+	872-1334
129	Bacillus mycoides	AB021192	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	97%+	907-1367
130	Bacillus weihenstephanensis	AB021199	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	97%+	925-1385
131	Bacillus thuringiensis	D16281	AATACGTTCCCGGGCCTT CTGAAACTCAAAGGAATTGACG	97%+	911-1371
132	Bacillus pseudomycoides	AF013121	CTGAAACTCAAAGGAT TTGACG AATACGTTCCCGGGCCTT	95%+	932-1392
133	Bacillus funiculus	AB049195	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	919-1379
134	Bacillus panaciterrae	AB245380	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	904-1364
135	Bacillus flexus	AB021185	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	923-1385
136	Bacillus megaterium	D16273	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	910-1372
137	Bacillus koreensis	AY667496	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	847-1309
138	Bacillus aerius	AJ831843	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	922-1382
139	Bacillus aerophilus	AJ831844	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	927-1387
140	Bacillus stratosphericus	AJ831841	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	927-1387
141	Bacillus sonorensis	AF302118	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	908-1368
142	Bacillus amyloliquefaciens	AB255669	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	909-1369
143	Bacillus siamensis	GQ281299	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%-	931-1352
144	Bacillus methylotrophicus	EU194897	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	898-1358
145	Bacillus subtilis subsp. subtilis	AJ276351	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	919-1379
146	Bacillus subtilis subsp. spizizenii	AF074970	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	907-1367
147	Bacillus vallismortis	AB021198	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	924-1384
148	Bacillus mojavensis	AB021191	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	920-1380
149	Bacillus atrophaeus	AB021181	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	909-1369
150	Bacillus pumilus	AY876289	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	879-1339
151	Bacillus safensis	AF234854	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	879-1339
152	Bacillus altitudinis	AJ831842	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	934-1394
153	Bacillus ginsengihumi	AB245378	TT GAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%-	914-1376
154	Bacillus acidiproducens	EF379274	TT GAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%-	879-1341
155	Bacillus acidicola	AF547209	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	99%+	934-1396
156	Bacillus oleronius	AY988598	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	934-1396
157	Bacillus sporothermodurans	U49078	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	904-1366
158	Bacillus carboniphilus	AB021182	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	910-1372
159	Bacillus chungangensis	FJ514932	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	890-1352
160	Bacillus endophyticus	AF295302	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	96%-	906-1362
161	Bacillus isabeliae	AM503357	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	912-1372
162	Bacillus shackletonii	AJ250318	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	909-1371
163	Bacillus circulans	AY043084	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	902-1364
164	Bacillus nealsonii	EU656111	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	928-1390
165	Bacillus korlensis	EU603328	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	889-1351
166	Bacillus siralis	AF071856	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	905-1367
167	Bacillus benzoevorans	X60611	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	95%-	931-1386
168	Bacillus firmus	D16268	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	907-1369
169	Bacillus infantis	AY904032	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	871-1333
170	Bacillus oceanisediminis	GQ292772	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	861-1323
171	Bacillus kribbensis	DQ280367	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%-	919-1381
172	Bacillus horneckiae	EU861362	TT GAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	796-1258
173	Bacillus badius	X77790	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%-	913-1370
174	Bacillus smithii	Z26935	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	924-1383
175	Bacillus aeolius	AJ504797	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%-	901-1361
176	Bacillus coagulans	AB271752	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%-	911-1373
177	Bacillus alveayuensis	AY605232	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	934-1396
178	Bacillus thermoamylovorans	L27478	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	92%+	930-1391
179	Bacillus fordii	AY443039	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	892-1354
180	Bacillus fortis	AY443038	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	927-1389
181	Bacillus farraginis	AY443036	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	838-1300
182	Bacillus galactosidilyticus	AJ535638	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	904-1367
183	Bacillus ruris	AJ535639	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%-	901-1363
184	Bacillus lentus	AB021189	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	928-1390
185	Bacillus novalis	AJ542512	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	908-1370
186	Bacillus vireti	AJ542509	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	908-1370
187	Bacillus bataviensis	AJ542508	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	908-1370
188	Bacillus drentensis	AJ542506	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	844-1306
189	Bacillus soli	AJ542513	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	908-1370
190	Bacillus fumarioli	AJ250056	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	909-1371
191	Bacillus niacini	AB021194	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	921-1383
192	Bacillus pocheonensis	AB245377	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	910-1372
193	Bacillus boroniphilus	AB198719	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	930-1392
194	Bacillus selenatarsenatis	AB262082	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	870-1332
195	Bacillus jeotgali	AF221061	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	908-1370
196	Bacillus thioparans	DQ371431	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	908-1370
197	Bacillus foraminis	AJ717382	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	922-1384
198	Bacillus canaveralius	DQ870688	CTGAAACTCAAAGGAATTGACG SEQUENEWAS SHORT	97%	887-1323
199	Bacillus infernus	U20385	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTN	95%+	921-1383
200	Bacillus methanolicus	AB112727	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	909-1372
201	Bacillus butanolivorans	EF206294	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	914-1380
202	Bacillus simplex	AJ439078	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	920-1379
203	Bacillus muralis	AJ316309	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	909-1371
204	Bacillus psychrosaccharolyticus	AB021195	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	900-1362
205	Bacillus asahii	AB109209	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	909-1373
206	Bacillus indicus	AJ583158	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	918-1381
207	Bacillus cibi	AY550276	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	896-1358
208	Bacillus idriensis	AY904033	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	889-1351
209	Bacillus niabensis	AY998119	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	904-1366
210	Bacillus fastidiosus	X60615	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	930-1386
211	Bacillus litoralis	AY608605	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	908-1370
212	Bacillus herbersteinensis	AJ781029	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	908-1370
213	Bacillus galliciensis	FM162181	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	908-1370
214	Bacillus alkalitelluris	AY829448	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	911-1373
215	Bacillus humi	AJ627210	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%	910-1372
216	Bacillus halmapalus	X76447	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	98%+	908-1370
217	Bacillus horikoshii	AB043865	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	929-1391
218	Bacillus cohnii	X76437	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	910-1372
219	Bacillus acidiceler	DQ374637	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	916-1376
220	Bacillus luciferensis	AJ419629	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	909-1369
221	Bacillus azotoformans	AB363732	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	909-1370
222	Bacillus taeanensis	AY603978	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	917-1378
223	Bacillus macauensis	AY373018	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	88-1350
224	Bacillus rigui	EU939689	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%-	903-1365
225	Bacillus solisalsi	EU046268	CTGAAACTCAAAA GGAATTGACG AATACGTTCCCGGGCCTT	95%-	887-1349
226	Bacillus gelatini	AJ551329	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	909-1371
227	Bacillus arsenicus	AJ606700	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%-	928-1390
228	Bacillus barbaricus	AJ422145	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%-	882-1342
229	Bacillus algicola	AY228462	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	931-1393
230	Bacillus hwajinpoensis	AF541966	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	909-1371
231	Bacillus decolorationis	AJ315075	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	909-1371
232	Bacillus okuhidensis	AB047684	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	874-1335
233	Bacillus lehensis	AY793550	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	95%-	939-1395
234	Bacillus oshimensis	AB188090	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	95%-	937-1393
235	Bacillus patagoniensis	AY258614	AATACGTTCCCGGGTC TT T TGAAACTCAAAGGAATTGACG	95%-	913-1369
236	Bacillus clausii	X76440	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	95%-	913-1369
237	Bacillus gibsonii	X76446	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	912-1372
238	Bacillus murimartini	AJ316316	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	913-1373
239	Bacillus plakortidis	AJ880003	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	906-1366
240	Bacillus pseudalcaliphilus	X76449	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	909-1371
241	Bacillus trypoxylicola	AB434284	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	911-1373
242	Bacillus alcalophilus	X76436	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	909-1371
243	Bacillus bogoriensis	AY376312	CTGAAACTCAAAGGAATTGAGC AATACGTTCCCGGGCCTT	97%+	911-1374
244	Bacillus akibai	AB043858	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	950-1411
245	Bacillus krulwichiae	AB086897	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	912-1374
246	Bacillus okhensis	DQ026060	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	916-1378
247	Bacillus wakoensis	AB043851	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	930-1392
248	Bacillus hemicellulosilyticus	AB043846	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	940-1402
249	Bacillus macyae	AY032601cpf	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	916-1378
250	Bacillus alkalinitrilicus	EF422411	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	919-1381
251	Bacillus pseudofirmus	X76439	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	97%+	910-1372
252	Bacillus qingdaonensis	DQ115802	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	913-1375
253	Bacillus halochares	AM982516	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%-	881-1343
254	Bacillus aidingensis	DQ504377	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%-	946-1407
255	Bacillus salarius	AY667494	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	858-1320
256	Bacillus persepolensis	FM244839	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	940-1402
257	Bacillus agaradhaerens	X76445	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGT CTT	96%+	925-1385
258	Bacillus neizhouensis	EU925618	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	96%+	905-1367
259	Bacillus beveridgei	FJ825145	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	944-1409
260	Bacillus chagannorensis	AM492159	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%+	945-1407
261	Bacillus saliphilus	AJ493660	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	919-1381
262	Bacillus aurantiacus	AJ605773	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	929-1381
263	Bacillus vedderi	Z48306	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%-	905-1367
264	Bacillus cellulosilyticus	AB043852	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%-	924-1386
265	Bacillus clarkii	X76444	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	95%+	926-1328
266	Bacillus polygoni	AB292819	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	94%-	945-1408
267	Bacillus horti	D87035	CTGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	93%+	923-1378
268	Bacillus mannanilyticus	AB043864	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	96%-	955-1413
	Actinobacteria (High GC content gram positive bacteria)
269	Corynebacterium diphtheriae	X84248	CTA AAACTCAAAGGAATTGACG AATACGTNCCCGGGCCTT	83%-	880-1341
270	Mycobacterium tuberculosis	X58890	CTAAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	85%-	1541-2002
271	Nocardia asteroides	AF430019	CTA AAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	84%-	875-1376
272	Streptomyces lavendulae subsp. lavendulae	D85116	CTA AAACTCANAGGAATTGACG AATACGTTCCCGGGCCTT	81%-	893-1361
	Low GC content Firmicutes (gram +ve)
273	Staphylococcus chromogenes	D83360	AATACGTTCCCGGGTC TT CTGAAACTCAAAGGAATTGACG	92%+	913-1371
274	Streptococcus pyogenes	AB002521	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	89%+	890-1350
275	Enterococcus faecalis	AB012212	T TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	91%+	939-1395
276	Clostridium populeti	X71853	A TGAAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT	86%-	903-1359
277	Listeria monocytogenes.	X56153	AATACGTTCCCGGGCCTN T TGAAACTCAAAGGAATTGACG	94%+	936-1392
	Alpha proteobacteria
278	Rhizobium leguminosarum	U29386	TTA AAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	86%-	913-1371
279	Azospirillum lipoferum	Z29619	TTA AAACTCAAAGGAATTGACG AATACGTTCCCGGGCCTT	84%-	845-1305
280	Acetobacterium woodii	X96954	T TGAAACTCAAAGGAATTGACG AATG CGTTCCCGGGTCTT	90%-	840-1305
	Beta proteobacteria
281	Burkholderia cepacia	U96927	AATACGTTCCCGGGTC TT TTA AAACTCAAAGGAATTGACG	82%-	870-1322
282	Bordetella pertussis	U04950	TTA AAACTCAAAGGAATTGACG AATACGTTCCCGGGTC TT	81%-	922-1375
	Gamma proteobacteria
283	Pseudomonas aeruginosa	X06684	AATACGTC CCCGGGCCTT TTA AAACTCAAATGAATTGACG	86%-	923-1384
284	Escherichia coli	X80725	TTA AAACTCAAATGAATTGACG AATACGTTCCCGGGTC TT	83%-	921-1379
285	Klebsiella pneumoniae subsp. pneumoniae	X87276	TT AAAACTCAAATGAATTGACG AATACGTTCCCGGGTC TT	82%-	920-1381
286	Shigella dysenteriae	X96966	TTA AAACTCAAATGAATTGACG AATACGTTCCCGGGTC TT	83%-	908-1362

Multiple alignments of 463 bp sequences of different strains of Bacilli

Dendrogram prepared on the basis of alignment of 463 bp sequence has been given in Figure 2(a&b). Dendrogram prepared for 52 different strains of Bacillus and related genera (taken in our study) and some reference sequences downloaded from NCBI has been shown in Figure 2(a). Dendrogram has been divided in to 7 different groups (I-VII). Group I contains strains belonging to species Bacillus aquimaris and marisflavi. Strains belonging to genera Lysinibacillus (sphaericus and xylanilyticus) and Jeotgalibacillus are present in Group II. Group III contains strains belonging to Genera Terribacillus (sacharrophilus and goriensis), Bacillus subtilis sub sp. spizizinii and Bacillus licheniformis. Group IV contains strains belonging to species, Bacillus mycoides and Bacillus cereus. Group V contains strains belonging to genera Paenibacillus and Brevibacillus and strains belonging to species Bacillus simplex and Bacillus firmus have shared the group VI. Bacillus arsenicus has not shown any grouping with any other species or genera and Bacillus megaterium and Bacillus flexus have shared a single group VII while some strains of Bacillus megaterium, Bacillus flexus and Bacillus aryabhattai have not shown any grouping with any other strain. Second dendrogram (Figure 2b) containing 29 different closely related species has been divided in to two major clusters and only one species Bacillus siamensis GQ281299 has not shown any grouping with any other member. 7 bacterial species i.e. Bacillus aquaemaris AF483625, Bacillus marisflavi AF483624, Bacillus seohaeanensis AY667495, Bacillus vietnamensis AB099708, Bacillus flexus AB021185, Bacillus megaterium D16273, Bacillus koreensis AY667496 lie in one cluster. Other, 21 bacterial strains have shared the other major cluster.

Figure 2

Dendrograms showing the phylogenetic relationship (a) 52 AEFB strains with reference sequences (b) 29 closely related species of genera based on 463 bp long 16S rRNA sequences.

Discussion

When we use molecular approaches to study microbial communities then the use of universal primers is not fully successful in finding the clear picture of community. Various researchers have faced such type of problems as Van Elsas et al. (2002) faced the problem when they studied two 16S rDNA clone libraries (one from grassland and one from arable land) prepared with bacterial primers and most of the isolated strains were found to be belonging to phylum Proteobacteria and the number of clones related to Bacilli were very few. When the same microbial communities were studied by Garbeva et al. (2003), by using Bacillus specific primers then a lot of Bacillus clones were isolated. The problem faced by universal primers can be overcome by the use of group specific primers and various researchers have used group specific primers in their studies to overcome this problem. Heuer and Smalla (1997) used Actinomycete specific primers to monitor Actinomycete communities in the potato rhizosphere. Similarly Boon et al. (2001) used several group specific nested PCR systems to identify a lot of groups under same DGGE conditions. So the need of group specific primers is there to find out the diversity and identity of the members of a specific group.

In the present research we have focused on identification and classification of AEFB by using a specific fragment of 16S rRNA gene. So in the following session we have discussed the research related to identification and classification of bacilli by using 16S rRNA gene. As Many researchers have developed a lot of different Bacillus specific primers i.e. Goto et al. (2000), synthesized a Bacillus specific prime pair which was used to amplify a 275 bp sequence near the 5’ end of 16S rDNA gene and this sequence was very specific for identification and classification of Bacillus strains. Garbeva et al. (2003) developed a Bacillus specific primer pair (Bac F and Bac R). Specificity of both primers was checked independently and some species of Bacillus and other related genera have shown 100% similarity with primer Bac F and likewise the reverse primer has shown similarity with 31 different species of Bacillus and related genera. Vardhan et al. (2011) developed a primer pair specific for amplification of a hyper variable region in 16S rDNA gene of Bacillus and related genera.

In the present study we found that a restriction digestion product of 16S rRNA gene (460 bp) by HaeIII enzyme was specific for Bacillus and related genera. Position of this fragment was near the 3’ end of 16S rDNA gene and primer pair specific to this 463 bp fragment has been designed. Primer pair when checked for specificity has shown amplification of a 463 bp long fragment in strains belonging to genera Bacillus, Lysinibacillus, Terribacillus, Brevibacillus and Jeotgalibacillus. No any amplification was seen in two AEFB strains i.e. Bacillus arsenicus and Paenibacillus taiwanensis and 9 different strains of bacterial lineages other than AEFB (Figure 1c&d). Reason for no amplification of this fragment in Bacillus arsenicus and Paenibacillus taiwanensis is may be due to the reason that during the course of evolution these have faced some variations because of which the restriction enzyme sites for Hae III enzymes were deleted at that position and primer pair designed in the present study includes the restriction site which causes the non specificity for primer.

Results of our study indicate that primer pair designed here is specific for Bacillus and related genera and not for other bacterial lineages. Primer pair when checked for homology (in silico) has shown 100% homology with 16S rDNA sequences of 120 species related to genera Bacillus. Bacillus species which do not have shown 100% similarity of these primers have acquired anomalous positions in the classification based on 16S rRNA gene (Yarza et al. 2010). While some species i.e. B. pseudomycoides AF013121, B. ginsengihumi AB245378, B. acidiproducens EF379274, B. endophyticus, AF295302, B. benzoevorans, X60611, B. horneckiae EU86136 have shown anomalous positions with other bacterial lineages according to classification systems based on 16S rRNA gene (Yarza et al. 2010) in spite of having homology with primer pair in our study. Bacilli strains other than the genus Bacillus have also shown the primer pair similarity and these genera are Virgibacillus (7), Geobacillus (5), Filobacillus (1), Jeotgalibacillus (4) and Ureibacillus (5). Almost all the species checked for primer pair homology has shown 100% similarity except Virgibacillus pantothenticus D16275, Virgibacillus proomii and AJ012667. All of these genera belong to the family Bacillaceae except Jeotgalibacillus which belong to the family Planococcaceae. Bacillus related genera which don’t have shown primer pair similarity are Alicyclobacillus (7), Amphibacillus (5), Aneurinibacillus (5), Brevibacillus (16), Gracilibacillus (9) and Paenibacillus (5). Only a few members of these genera have shown homology with primer pair and these are Alicyclobacillus acidocaldarius AJ496806, Alicyclobacillus tolerans Z21979, Brevibacillus invocatus AF378232, Brevibacillus panacihum. Genera which do not have shown primer specificity belong to different species other than Bacillaceae except Amphibacillus, Gracilibacillus and Terribacillus. In our study genera belonging to family Bacillaceae have shown primer specificity and genera belonging to family other than Bacillaceae have not shown primer specificity except some genera which have shown primer specificity in reverse order.

Phylogenetic relationship based on 463 bp sequence of 52 bacilli strains (taken in our study) along with reference sequences (downloaded from NCBI) (Figure 2a) has shown that different bacterial strains belonging to same species and genera have shared a single group except some strains belonging to Bacillus megaterium, B. aryabhattai and B. flexus. As strains belonging to species Bacillus megaterium have not grouped in one cluster. Out of total 8 strains of B. megaterium, only two strains belonging to species B. megaterium have made grouping with B. flexus. Another 6 strains of B. megaterium and two strains of B. aryabhattai have not shown any grouping with any other strain, however all these eight strains lie below B. megaterium and B. flexus group. This shows that different strains of B. megaterium and B. aryabhattai (close relative of B. megaterium) have remarkable strain to strain genetic variations. Grouping of strains belonging to Bacillus related genera in between the strains related to Bacillus indicates that during the course of evolution these genera have been evolved from the older one genera i.e. Bacillus which is similar to the classifications according to others (Xu and Cote 2003; Yarza et al. 2010; Vardhan et al. 2011). Further the phylogenetic relationship of some closely related strains of genera Bacillus, sharing a single cluster in the all species living tree (Yarza et al. 2010) have shown the same phylogenetic relationship in our study (Figure 2b). The only exception is Bacillus siamensis GQ281299 which has not shown any grouping with any other Bacillus species. However, in all species living tree this strain has shown relationship with other Bacillus species which lie in the lower cluster in our study (Figure 2b).

From the present study we can conclude that the restriction digestion of 16S rRNA gene by HaeIII enzyme and amplification of 463 bp fragment with specific primers designed in our study are easy methods for identification of Bacillus and related genera. Further the sequence information and multiple alignment of 463 bp fragment of Bacillus and related genera have been proved to be a good identification and classification tool for Bacillus and related genera.