Literature DB >> 24294234

Carbapenem and cefoxitin resistance of Klebsiella pneumoniae strains associated with porin OmpK36 loss and DHA-1 β-lactamase production.

Weifeng Shi1, Kun Li, Yun Ji, Qinbo Jiang, Yuyue Wang, Mei Shi, Zuhuang Mi.   

Abstract

Clinical isolates of carbapenem-resistant Klebsiella pneumoniae (K. pneumoniae) strains are being increased worldwide. Five pan-resistant K. pneumoniae strains have been isolated from respiratory and ICU wards in a Chinese hospital, and reveal strong resistance to all β-lactams, fluoroquinolones and aminoglycosides. Totally 27 β-lactamase genes and 2 membrane pore protein (porin) genes in 5 K. pneumoniae strains were screened by polymerase chain reaction (PCR). The results indicated that all of 5 K. pneumoniae strains carried blaTEM-1 and blaDHA-1 genes, as well as base deletion and mutation of OmpK35 or OmpK36 genes. Compared with carbapenem-sensitive isolates by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), the resistant isolates markedly lacked the protein band of 34-40 kDa, which might be the outer membrane proteins of OmpK36 according to the electrophoresis mobility. In addition, the conjugation test was confirmed that blaDHA-1 mediated by plasmids could be transferred between resistant and sensitive strains. When reserpine (30 μg/mL) and carbonyl cyanide m-chlorophenylhydrazone (CCCP) (50 μg/mL) were added in imipenem and meropenem, the MICs had no change against K. pneumoniae strains. These results suggest that both DHA-1 β-lactamase and loss or deficiency of porin OmpK36 may be the main reason for the cefoxitin and carbapenem resistance in K. pneumoniae strains in our hospital.

Entities:  

Keywords:  AmpC β-Lactamase; Klebsiella pneumoniae; Porin; molecular biology

Mesh:

Substances:

Year:  2013        PMID: 24294234      PMCID: PMC3833140          DOI: 10.1590/S1517-83822013000200015

Source DB:  PubMed          Journal:  Braz J Microbiol        ISSN: 1517-8382            Impact factor:   2.476


Introduction

K. pneumoniae is one of the most common pathogens in clinical infections, such as pneumonia, urinary tract infections, sepsis, wound infections, meningitis and other diseases. Multidrug-resistant K. pneumoniae strains are becoming a severe problem worldwide, and it usually carries one or more extended-spectrum β-lactamases (ESBLs) that confers the resistance to expanded-spectrum cephalosporins (Lee ; Huang and Hsueh, 2008). In recent years, K. pneumoniae strains have been reported to be resistant to most β-lactamas through mutation genes encoded in chromosome, acquisition of genes from mobile plasmids and integrons (Maltezou ; Munoz-Price and Quinn, 2009). Carbapenem antibiotics are very effective in the treatment of severe bacterial infections caused by ESBL- and AmpC enzymes-producing K. pneumoniae strains so that they have been widely used in clinics. Due to carbapenemases, metallo-β-lactamases and porin loss, carbapenem-resistant K. pneumoniae strains are increasing (Landman ; Pournaras ). Up to now, it has been reported that the outer membrane proteins of K. pneumoniae strains contain three known porins including OmpK35, OmpK36, and OmpK37 (Hernandez-Alles ; Kaczmarek ). Furthermore, porins OmpK35 and OmpK36 play critical roles in the penetration of antibiotics into the cells, and the loss of OmpK35 or OmpK36 can resist or reduce susceptibility to cephalosporins and carbapenems, particularly in strains containing Ambler group A, B, C, or D β-lactamase (Doumith ; Goldfarb ; Kontopoulou ). In 2010, we isolated 5 K. pneumoniae strains resistant to almost all antibiotics from clinical specimens. The minimal inhibitory concentrations (MICs) of piperacillin, piperacillin/tazobactam, amoxicillin/clavulanic acid, cefoperazone/sulbactam, cefoxitin, cefotaxime and aztreonam against 5 K. pneumoniae strains were larger than 128 μg/mL, and the MICs of imipenem and meropenem against 5 K. pneumoniae strains were larger than 32 μg/mL. In addition, these K. pneumoniae strains also revealed the resistance to ciprofloxacin, levofloxacin, gentamicin and amikacin (MIC ≥ 64 μg/mL). The objective of this study was to investigate the cause of high-level carbapenem resistance in K. pneumoniae strains. Except for blaTEM-1 and blaDHA-1 genes, carbapenem-resistant genes were not observed in 5 K. pneumoniae strains; however, the base deletion or mutation of OmpK35 and OmpK36 genes could lead to the alterations of amino acid sequences, protein configuration and pore size of porins, thus impeding the access of antimicrobials. Therefore, high-level resistance to cefoxitin and carbapenem in 5 K. pneumoniae clinical isolates is due to the combinatorial action from the production of blaDHA-1 beta-lactamase and the insertional inactivation or loss of porin OmpK36.

Methods

Strains and antimicrobial susceptibility testing

In 2010, 5 carbapenem-resistant K. pneumoniae (Kp01, Kp02, Kp03, Kp04 and Kp05) strains were isolated from sputum, urine and deep venous catheter specimens in a Chinese hospital. Among 5 patients, 1 case was from respiratory ward and 4 cases were from ICU ward. The MICs of piperacillin, peracillin/sulbactam, amoxicillin/clavulanic acid, cefoperazone/sulbactam, cefoxitin, cefotaxime, cefepime, aztreonam, imipenem, meropenem, ciprofloxacin, levofloxacin, gentamicin and amikacin were performed by E-test (Oxiod), and E. coli ATCC25922 was used as the control.

Extraction of β-lactamase and three-dimensional test

Briefly, a colony was inoculated into 5 mL of tryptic soy broth overnight and the culture was grown at 35 °C for 4 h. The cells were concentrated by centrifugation, and crude enzyme extract was prepared by repeated freeze-thawing cycle for five times. The surface of a Mueller-Hinton agar plate was inoculated with E.coli strains as described by the standard disk diffusion method. A 30 μg cefoxitin disk (Oxoid) was placed on the inoculated agar. With a sterile scalpel blade, 4 slit beginning 5 mm from the edge of the disk was cut in the agar in outward radial direction. By using a pipette, 40 μL of crude enzyme extract was dispensed into each slit, beginning near the disk and moving outward. Slit overfill was avoided. The inoculated media were incubated overnight at 35 °C. Enhanced growth of the surface organism at the point where the slit intersected the zone of inhibition was considered a positive three-dimensional testing result and was interpreted as the evidence in the presence of AmpC beta-lactamase or ESBL. K. pneumoniae ATCC700603 and Enterobacter cloacae (E. cloacae) 029 M were used as the control strains.

Transconjugation experiments

In order to determine if the resistance was transferable, transconjugation experiments were performed. Five isolates were used as the donors and EC600 (Rif r) was used as the recipient in transconjugation experiments. The organisms were inoculated into 5 mL of Luria-Bertani (LB) broth (Difco) and incubated at 35 °C for 20 h with shaking. Two organisms were mixed together at a proportion of 1 : 2, and then incubated overnight at 35 °C with shaking. After centrifugation for 5 min at 4,000 g, the precipitate was mixed with 1 mL of distilled water and inoculated onto MacConkey agar plates containing 600 μg/mL rifampin and 0.25 μg/mL cefotaxime. Transparent colonies were selected from the agar plates and inoculated into MacConkey agar again for activation. The drug-resistant profile and plasmid electrophoresis were further analyzed.

DNA extraction

Strains were grown overnight on MacConkey agar plates at 37 °C, and growth from approximately one-quarter of a plate was resuspended in 180 μL of distilled water. A total of 200 μL of buffer solution (0.01 mM Tris-HCl, pH 7.8; 0.005 M EDTA; 0.5% sodium dodecyl sulfate) and 20 μL of proteinase K (1 mg/mL) were added. The mixture was incubated at 55 °C for 2 h, and then 400 μL of phenol-chloroform solution was added, mixed with gentle agitation, and centrifuged at 12,000 g for 5 min. The supernatant was collected and DNA was precipitated after the addition of 0.5 volume of 7.5 M ammonium acetate and 2 volumes of ethanol. DNA was washed with 70% ethanol, dried, and resuspended with 100 μL of Tris-EDTA buffer.

Analysis of β-lactamase and porin genes

The oligonucleotide primers were designed on the basis of the nucleotide sequence in GenBank (Table 1). The 27 β-lactamase and 2 porin genes were screened by PCR. The primer pairs were shown in Table 1. The assay was carried out in 20 μL of reaction mixture containing 0.5 μM each primer, 10 mM KCl, 2 mM MgCl2, 8 mM (NH4)2SO4, 10 mM Tris-HCl (pH 9.0), 200 μM dNTP and 1 U Taq DNA polymerase. All amplification reactions were performed with an initial denaturation at 93 °C for 3 min followed by 35 cycles of denaturation at 93 °C for 1 min, annealing at 55 °C for 1 min and extension at 72 °C for 1 min. The final extension was performed at 72 °C for 7 min. Aliquot (20 μL) of each sample was subjected to electrophoresis by 2% agarose gels. The amplicons were purified with PCR Cleanup kits (Roche Molecular Biochemicals) and sequenced on an ABI PRISM 377 analyzer (Applied Biosystems).
Table 1

Primers used in this study.

Target genesPrimer sequence (3′ → 5′)Size (bp)GenBank accession no. of reference
Class A β-lactamases
TEMP1: AGGAAGAGTATGATTCAACA
P2: CTCGTCGTTTGGTATGGC535 bpX54604
SHVP1: TGCGCAAGCTGCTGACCAGC
P2: TTAGCGTTGCCAGTGCTCGA305 bpAY326946
CTX-M-1 groupP1: ATGGTTAAAAAATCACTGCGC
P2: TCCCGACGGCTTTCCGCCTT833 bpGU125714
CTX-M-2 groupP1: ATGATGACTCAGAGCATTCG
P2: TCCCGACGGCTTTCCGCCTT833 bpAY750915
CTX-M-8 groupP1: ATGATGAGACATCGCGTTAAGCGG
P2: TTAATAACCGTCGGTGACGATTTTCGCG876 bpAF189721

CTX-M-9 groupP1: CGGCCTGTATTTCGCTGTTG
P2: TCCCGACGGCTTTCCGCCTT793 bpAB205197
CTX-M-25 groupP1: ATGATGAGAAAAAGCGTAAGGCGGGCG
P2: TCCCGACGGCTTTCCGCCTT876 bpAY157676
PERP1: AGTCAGCGGCTTAGATA
P2: CGTATGAAAAGGACAATC978 bpAJ621265
GESP1: ATGCGCTTCATTCACGCAC
P2: CTATTTGTCCGTGCTCAGG846 bpAY219651
VEBP1: GCGGTAATTTAACCAGA
P2: GCCTATGAGCCAGTGTT961 bpAY536743
CARBP1: AAAGCAGATCTTGTGACCTATTC
P2: TCAGCGCGACTGTGATGTATAAAC588 bpS46063
KPCP1: ATGTCACTGTATCGCCGTCTA
P2: TTACTGCCCGTTGACGCCCAA882 bpGU086225
LAPP1: ATGAAAAAGATCCGCCTTATTATAA
P2: TTACCAGTTCTTAATTACTGAATC858 bpEF026092

Class B β-lactamases
IMPP1: CGGCCGCAGGAGAGGCTTT
P2: AACCAGTTTTGCCTTACCAT587 bpAJ223604
VIMP1: ATTCCGGTCGGAGAGGTCCG
P2: GAGCAAGTCTAGACCGCCCG633 bpAY509609
SPMP1: CTGCTTGGATTCATGGGCGCG784 bpAY341249
P2: CCTTTTCCGCGACCTTGCTCG
NDMP1: TCAGCGCAGCTTGTCGGCCA813 bpHQ738352
P2: ATGGAATTGCCCAATATTATGCA

Class C β-lactamases
LENP1: ATGCGTTATATTCGCCTGTG591 bpAM850914
P2: GGCGCTCAGATGCTGCGC
OKPP1: AAGCGCTTCCCGGCGACGTG362 bpAM051141
P2: TTAGCGTTGCCAGTGCTCGA
DHAP1: AACTTTCACAGGTGTGCTGGGT405 bpAY585202
P2: CCGTACGCATACTGGCTTTGC
ACTP1: TCGGTAAAGCCGATGTTGCGG303 bpEF508682
P2: CTTCCACTGCGGCTGCCAGTT
MOXP1: GCTGCTCAAGGAGCACAGGAT520 bpEU515248
P2: CACATTGACATAGGTGTGGTG
ACCP1: ACAGCCTCAGCAGCCGGTTA345 bpAJ133121
P2: TTCGCCGCAATCATCCCTAG
FOXP1: AACATGGGGTATCAGGGAGAT190 bpAY034848
P2: CAAAGCGCGTAACCGGATTGG

Class D β-lactamases
OXA-1 groupP1: CTGTTGTTTGGGTTTCGCAAG440 bpGQ438248
P2: CTTGGCTTTTATGCTTGATG
OXA-2 groupP1: CAGGCGCTGTTCGTGATGAGTT233 bpFJ855130
P2: GCCTTCTATCCAGTAATCGCC
OXA-10 groupP1: GTCTTTCAAGTACGGCATTA822 bpAY509609
P2: GATTTTCTTAGCGGCAACTTA

Porin
ompK35P1: ATGATGAAGCGCAATATTCTGGCAGTGG684 bpGU945384
P2: TCGGCTTTGTCGCCATTGCCGTCA
ompK36P1: ATGAAAGTTAAAGTACTGTCCCTC1076 bpHM000057
P2: GCCGGTATCTCTACCGACGAC

Outer membrane protein analysis

K. pneumoniae was inoculated overnight in 5 mL of LB medium at 35 °C with shaking, the culture was added in 200 mL of LB liquid medium at 35 °C with shaking for 5 h. After centrifugation (4 °C) for 5 min at 4,000 g, the supernatant was discarded. The precipitate was washed three times with 50 mM (pH 7.0) phosphate buffer solution (PBS), and suspended in 10 mM Tris-HCl (pH 7.4). The ultrasonic fragmentation of bacteria was performed in ice bath conditions. In order to remove unbroken bacteria, centrifugation was performed at 4,000 g for 30 min, and then the supernatant was centrifuged at 25,000 g for another 30 min. The precipitation was resuspended with buffer, and phenylmethylsulfonyl was added. The outer membrane protein was denatured at 100 °C for 5 min before electrophoresis and then separated by SDS-PAGE with Mini-sub cell horizontal electrophoresis tank (Biorad Co.). The gel concentration was 12.0%, and stained with Coomassie brilliant blue R250 for 30 min.

Inhibitory effects of reserpine and CCCP against efflux

Susceptibility test was carried out using agar dilution method. MIC changes were observed in the absence or presence of reserpine (J & K Chemical) and CCCP (Sigma) at concentrations of 30 μg/mL and 50 μg/mL, respectively. An inoculum of each isolate at the amount of 5 × 104 cfu/mL was inoculated onto MH medium containing serial dilutions of imipenem and meropenem. A phenotype for positive efflux was detectable after at least 4-fold dilutions of MIC for imipenem or meropenem in the absence or presence of reserpine and CCCP.

Results

Antimicrobial susceptibility test

In vitro tests showed that the MICs of piperacillin, piperacillin/tazobactam, amoxicillin/clavulanic acid, cefoperazone/sulbactam, cefoxitin, cefotaxime and aztreonam against 5 K. pneumoniae strains were larger than 128 μg/mL, and the MICs of imipenem or meropenem against 5 K. pneumoniae strains were larger than 32 μg/mL. In addition, 5 K. pneumoniae strains also revealed strong resistance to ciprofloxacin, levofloxacin, gentamicin and amikacin (Table 2).
Table 2

MICs of β-lactams, fluoroquinolones and aminoglycosides against K. pneumoniae strains.

Antimicrobial agentsMIC (μg/mL)

Kp01Kp02Kp03Kp04Kp05EC600
Piperacillin> 256> 256> 256> 256> 2561
Piperacillin/sulbactam> 256> 256> 256> 256> 2561
Amoxicillin/clavulanic acid> 256> 256> 256> 256> 2560.5
Cefoxitin> 256> 256> 256> 256> 2564
Cefotaxime> 256> 256> 256> 256> 2560.25
Cefoperazone/sulbactam> 256> 256> 256> 256> 256≤ 0.125
Cefepime128128> 256> 256128≤ 0.125
Aztreonam> 256> 256> 256> 256> 256≤ 0.125
Imipenem> 32> 32> 32> 32> 32≤ 0.125
Meropenem> 32> 32> 323232≤ 0.125
Ciprofloxacin> 128> 128> 12864128≤ 0.125
Levofloxacin> 128> 128> 1286464≤ 0.125
Gentamicin> 128> 128> 128> 128128≤ 0.125
Amikacin> 128> 128> 128128128≤ 0.125

Kp01, Kp02, Kp03, Kp04 and Kp05: carbapenem-resistant K. pneumoniae strains.

Three dimension test

All 5 isolates exhibited positive three-dimensional test results, and their extracts promoted the growth of one surface organism of E.coli ATCC25922 on MH agar. E. cloacae 029 M could produce AmpC enzyme to exhibit an interference with the growth of ATCC25922. ATCC700603 was used as the negative control (Figure 1).
Figure 1

Three-dimensional test for five strain isolates. (1A) Enhanced growth of E.coli ATCC25922 was observed near agar slits containing enzyme extracts of Kp01, Kp02 and E. cloacae 029 M. Except for ATCC700603, all of them were AmpC producers. (1B) Kp03, Kp04, Kp05 and E. cloacae 029 M could interfere with the growth of E. coli ATCC25922.

Sequence analysis of β-lactamase, OmpK35 and OmpK36 genes

The PCR and sequence analysis showed that Kp01, Kp02, Kp03, Kp04 and Kp05 contained TEM and DHA β-lactamase genes. Compared with blaTEM-1 (Accession No. FJ668746) and blaDHA-1 (Accession No. HM193083) in GenBank, these strains shared 100% identity. Similarly, OmpK35 and OmpK36 genes in 5 multidrug-resistant K. pneumoniae strains were detected by PCR amplification and sequence analysis. Among 5 K. pneumoniae strains, the base deletions of OmpK35 and OmpK36 genes were observed in Kp01 and Kp03 strains, and the base deletion of OmpK35 gene was also observed in Kp02 and Kp05. In OmpK36 gene, insertion and deletion as well as the mutations of short DNA fragment (1–5 bp) could result in the alteration of open reading frame and early termination of translation. In addition, mutations of OmpK35 gene occurred in Kp04 (Table 3). Compared with GU945384 in GenBank, OmpK35 gene mutations of G → C at base 465 and T → C at base 466 in Kp04 could also result in the substitution from Gln to His at position 155 and substitution from Tyr to His at position 156. A new subtype has been registered in GenBank (Accession No. HQ259027).
Table 3

Expression of two porins in five K. pneumoniae strains.

StrainsblaTEM-1blaDHA-1OmpK36 geneOmpK35 gene
Kp01++Base deletionBase deletion
Kp02++InsertionBase deletion
Kp03++Base deletionBase deletion
Kp04++InsertionMutation
Kp05++InsertionBase deletion

Transconjugation test of K. pneumoniae

EC600 was used as the recipient in the conjugation studies. In addition, blaDHA-1 resistant genes from Kp01, Kp02, Kp03 and Kp05 were transferred into the recipient EC600 and confirmed by PCR. EC600 resulted in drug resistance from Kp01, Kp02, Kp03 and Kp05 to a certain degree, and the MICs of piperacillin, piperacillin/sulbactam, amoxicillin/clavulanic acid and cefotaxime exhibited 2–16 fold increase (Table 4).
Table 4

The antimicrobial susceptibility of transconjugants.

Antimicrobial agentsMIC (μg/mL)

Tr01Tr02Tr03Tr05
Piperacillin81648
Piperacillin/sulbactam4884
Amoxicillin/clavulanic acid4844
Cefotaxime0.510.51
Cefoperazone/sulbactam0.250.1250.1250.25
Aztreonam0.250.250.250.5
Cefepime≤ 0.125≤ 0.125≤ 0.125≤ 0.125
Imipenem≤ 0.125≤ 0.125≤ 0.125≤ 0.125
Meropenem≤ 0.125≤ 0.125≤ 0.125≤ 0.125
Ciprofloxacin≤ 0.125≤ 0.125≤ 0.125≤ 0.125
Amikacin0.25≤ 0.1250.250.25

Transconjugants: Tr.

SDS-PAGE of outer membrane protein

The outer membrane proteins of 4 strains were detected by SDS-PAGE. Compared with the sensitive strains, the lack of outer membrane proteins in 3 carbepenem-resistant K. pneumoniae strains (Kp01, Kp02 and Kp04) were detected by SDS-PAGE, and molecular weights of these outer membrane proteins were 34–40 kDa, which suggested that only porin loss of OmpK36 in Kp01, Kp02 and Kp04 strains when compared with K. pneumoniae ATCC700603 and sensitive strains. In contrast, the porin of OmpK35 and OmpK36 was remained in Kp03 (Figure 2).
Figure 2

SDS-PAGE of outer membrane proteins. M: Marker; S1: ATCC700603; S2: sensitive strain.

Inhibitory effects of reserpine and CCCP on the efflux of K. pneumoniae

All strains with a concentration of 5 × 104 cfu/mL can grow in the presence of 256 μg/mL reserpine and 128 μg/mL CCCP. When reserpine (30 μg/mL) and CCCP (50 μg/mL) were added in imipenem and meropenem, no change of MICs was observed in the presence of reserpine and CCCP.

Discussion

In the present study, we screened 27 β-lactamase genes including Ambler class A, B, C and D by using PCR technique. The metallo-β-lactamases, OXA-type and KPC-type β-lactamases were not detected by PCR in 5 K. pneumoniae strains. However, all of 5 strains carried blaTEM-1 and blaDHA-1 β-lactamase genes. DHA-1, a plasmid-mediated AmpC type β-lactamase belonging to Ambler class C, can confer the resistance to oxyiminocephalosporins (cefotaxime and ceftazidime) and cephamycins (cefoxitin and moxalactam), and transfer of the resistance has been confirmed by transconjugation (Lee, 2007; Ding ; Yamada ). In the present study, blaDHA-1 resistant genes from Kp01, Kp02, Kp03 and Kp05 may be transferred into the recipient EC600, leading to 2–16 fold MIC increase of piperacillin, piperacillin/sulbactam, amoxicillin/clavulanic acid and cefotaxime. These findings indicate that blaDHA-1 β-lactamase gene can spread rapidly between the same and different bacteria. The base deletion of OmpK35 and OmpK36 genes in Kp01 and Kp03 was simultaneously observed. Similarly, the base deletion of OmpK35 also existed in Kp02 and Kp05. In addition, there were still genetic insertion of OmpK36 in Kp02, Kp04 and Kp05. SDS-PAGE analysis of the OMPs revealed the only loss of OmpK36 in Kp01, Kp02 and Kp04 strains when compared with K. pneumoniae ATCC700603 and a sensitive strains. However, the loss of porin was not observed in Kp03, which suggested that mutations or base deletions of porin-coding genes can lead to the alterations of open reading frame, amino acid sequences and protein configuration. Thus, the pore size of porin OmpK35 or OmpK36 can be affected and the accessibility of drugs can be impeded. Moreover, the porin OmpK36 plays an important role in the resistance or reduced susceptibility to carbapenems in K. pneumoniae strains (Hernandez-Alles, 1999; Wang ). In this study, high-level carbapenem resistance in 5 K. pneumoniae strains was associated with the deletion or mutation of porin genes. The lack or deficiency of outer membrane protein can result in the change of permeability and reduction of cell accessibility for antibiotics or other drugs, which plays an important role in the main channels (Martinez-Martinez, 2008; Endimiani ; Jiang ; Landman, 2009). Therefore, blaDHA-1 β-lactamases combined with the absence of outer membrane proteins may confer to the carbapenems and cefoxitin resistance in K. pneumoniae strains (Su ; Jiang ). Efflux systems that contribute to antibiotic resistance have been described for a number of clinically important bacteria (Guglierame ; Coyne ; Husain and Nikaido, 2010). The overexpression of multi-drug efflux pumps can lead to low-level multi-drug resistance (Guglierame, 2006; Piddock, 2006). It has been reported that reserpine and CCCP were used as the pumps inhibitors (Shi ). Reserpine is a well-established inhibitor of efflux pumps among Gram-positive microorganisms and non-fermenting Gram-negative microorganisms. CCCP can destroy the proton gradient of bacterial transcytoplasm membrane, causing transport proteins to lose energy supply and eventually leading to the increasing accumulation of drug concentration (Zhang ). In this study, when reserpine and CCCP were added, MIC changes of imipenem and meropenem were not observed. The results indicated that the resistance of K. pneumoniae strains to carbapenems seems to be irrelevant to efflux. Taken all together, the expression of porin OmpK36 coupled with blaDHA-1 β-lactamase genes plays an important role in conferring resistance of K. pneumoniae strains to carbapenems and cefoxitin in our hospital. Our findings highlight the urgent need to develop the strategies for the prevention and control of infections. Limited application of antimicrobials, especially for fluoroquinolones and cephalosporins, may be the effective strategies.
  25 in total

Review 1.  An epidemic of plasmids? Dissemination of extended-spectrum cephalosporinases among Salmonella and other Enterobacteriaceae.

Authors:  Lin-Hui Su; Chishih Chu; Axel Cloeckaert; Cheng-Hsun Chiu
Journal:  FEMS Immunol Med Microbiol       Date:  2007-12-18

Review 2.  Antimicrobial drug resistance in Taiwan.

Authors:  Yu-Tsung Huang; Po-Ren Hsueh
Journal:  Int J Antimicrob Agents       Date:  2008-11       Impact factor: 5.283

3.  The spread of Klebsiella pneumoniae carbapenemases: a tale of strains, plasmids, and transposons.

Authors:  L Silvia Munoz-Price; John P Quinn
Journal:  Clin Infect Dis       Date:  2009-12-01       Impact factor: 9.079

4.  High-level carbapenem resistance in a Klebsiella pneumoniae clinical isolate is due to the combination of bla(ACT-1) beta-lactamase production, porin OmpK35/36 insertional inactivation, and down-regulation of the phosphate transport porin phoe.

Authors:  Frank M Kaczmarek; Fadia Dib-Hajj; Wenchi Shang; Thomas D Gootz
Journal:  Antimicrob Agents Chemother       Date:  2006-10       Impact factor: 5.191

5.  Molecular mechanisms disrupting porin expression in ertapenem-resistant Klebsiella and Enterobacter spp. clinical isolates from the UK.

Authors:  Michel Doumith; Matthew J Ellington; David M Livermore; Neil Woodford
Journal:  J Antimicrob Chemother       Date:  2009-02-20       Impact factor: 5.790

Review 6.  Extended-spectrum beta-lactamases and the permeability barrier.

Authors:  L Martínez-Martínez
Journal:  Clin Microbiol Infect       Date:  2008-01       Impact factor: 8.067

7.  Detection of plasmid-mediated KPC-producing Klebsiella pneumoniae in Ottawa, Canada: evidence of intrahospital transmission.

Authors:  David Goldfarb; Sarah-Beth Harvey; Kelsi Jessamine; Peter Jessamine; Baldwin Toye; Marc Desjardins
Journal:  J Clin Microbiol       Date:  2009-04-08       Impact factor: 5.948

8.  Paradoxical effect of Klebsiella pneumoniae OmpK36 porin deficiency.

Authors:  Xiuhong Jiang; Bjorn A Espedido; Sally R Partridge; Lee C Thomas; Feng Wang; Jonathan R Iredell
Journal:  Pathology       Date:  2009       Impact factor: 5.306

9.  The prevalence of plasmid-mediated AmpC beta-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae from five children's hospitals in China.

Authors:  H Ding; Y Yang; Q Lu; Y Wang; Y Chen; L Deng; A Wang; Q Deng; H Zhang; C Wang; L Liu; X Xu; L Wang; X Shen
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2008-05-01       Impact factor: 3.267

10.  Outbreak of infections due to KPC-2-producing Klebsiella pneumoniae in a hospital in Crete (Greece).

Authors:  H C Maltezou; P Giakkoupi; A Maragos; M Bolikas; V Raftopoulos; H Papahatzaki; G Vrouhos; V Liakou; A C Vatopoulos
Journal:  J Infect       Date:  2009-02-26       Impact factor: 6.072

View more
  24 in total

1.  In Vitro and In Vivo Activities of β-Lactams in Combination with the Novel β-Lactam Enhancers Zidebactam and WCK 5153 against Multidrug-Resistant Metallo-β-Lactamase-Producing Klebsiella pneumoniae.

Authors:  Bartolome Moya; Isabel M Barcelo; Gabriel Cabot; Gabriel Torrens; Snehal Palwe; Prashant Joshi; Kushal Umarkar; Swapna Takalkar; Hariharan Periasamy; Sachin Bhagwat; Mahesh Patel; German Bou; Antonio Oliver
Journal:  Antimicrob Agents Chemother       Date:  2019-04-25       Impact factor: 5.191

2.  Effect of sub-minimum inhibitory concentration of ceftriaxone on the expression of outer membrane proteins in Salmonella enterica serovar Typhi.

Authors:  Sadanand Dangari Akshay; Karanth Padyana Anupama; Vijaya Kumar Deekshit; Anusha Rohit; Biswajit Maiti
Journal:  World J Microbiol Biotechnol       Date:  2022-08-16       Impact factor: 4.253

Review 3.  Class C β-Lactamases: Molecular Characteristics.

Authors:  Alain Philippon; Guillaume Arlet; Roger Labia; Bogdan I Iorga
Journal:  Clin Microbiol Rev       Date:  2022-04-18       Impact factor: 50.129

4.  Detection and genotype analysis of AmpC β-lactamase in Klebsiella pneumoniae from tertiary hospitals.

Authors:  Xiang-Qun Liu; Yong-Rui Liu
Journal:  Exp Ther Med       Date:  2016-04-27       Impact factor: 2.447

5.  Characterization of an IncFIB/IncHI1B Plasmid Encoding Efflux Pump TMexCD1-TOprJ1 in a Clinical Tigecycline- and Carbapenem-Resistant Klebsiella pneumoniae Strain.

Authors:  Xuemei Yang; Lianwei Ye; Edward Wai-Chi Chan; Rong Zhang; Sheng Chen
Journal:  Antimicrob Agents Chemother       Date:  2021-03-18       Impact factor: 5.191

6.  Outbreak of multidrug resistant NDM-1-producing Klebsiella pneumoniae from a neonatal unit in Shandong Province, China.

Authors:  Yan Jin; Chunhong Shao; Jian Li; Hui Fan; Yuanyuan Bai; Yong Wang
Journal:  PLoS One       Date:  2015-03-23       Impact factor: 3.240

7.  Whole genome sequence of Klebsiella pneumoniae U25, a hypermucoviscous, multidrug resistant, biofilm producing isolate from India.

Authors:  Zumaana Rafiq; Nithin Sam; Rama Vaidyanathan
Journal:  Mem Inst Oswaldo Cruz       Date:  2016-02       Impact factor: 2.743

8.  Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae clinical isolates recovered from Egyptian hospitals.

Authors:  Reham Wasfi; Walid F Elkhatib; Hossam M Ashour
Journal:  Sci Rep       Date:  2016-12-22       Impact factor: 4.379

9.  Acquisition of Tigecycline Resistance by Carbapenem-Resistant Klebsiella pneumoniae Confers Collateral Hypersensitivity to Aminoglycosides.

Authors:  Hua-le Chen; Yan Jiang; Mei-Mei Li; Yao Sun; Jian-Ming Cao; Cui Zhou; Xiao-Xiao Zhang; Yue Qu; Tie-Li Zhou
Journal:  Front Microbiol       Date:  2021-07-02       Impact factor: 5.640

10.  Multiresistant extended-spectrum β-lactamase-producing Enterobacteriaceae from humans, companion animals and horses in central Hesse, Germany.

Authors:  Judith Schmiedel; Linda Falgenhauer; Eugen Domann; Rolf Bauerfeind; Ellen Prenger-Berninghoff; Can Imirzalioglu; Trinad Chakraborty
Journal:  BMC Microbiol       Date:  2014-07-12       Impact factor: 3.605

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.