Literature DB >> 28004732

Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae clinical isolates recovered from Egyptian hospitals.

Reham Wasfi1, Walid F Elkhatib2,3, Hossam M Ashour4,5.   

Abstract

Klebsiella pneumonia infection rates have increased dramatically. Molecular typing and virulence analysis are powerful tools that can shed light on Klebsiella pneumonia infections. Whereas 77.7% (28/36) of clinical isolates indicated multidrug resistant (MDR) patterns, 50% (18/36) indicated carpabenem resistance. Gene prevalence for the AcrAB efflux pump (82.14%) was more than that of the mdtK efflux pump (32.14%) in the MDR isolates. FimH-1 and mrkD genes were prevalent in wound and blood isolates. FimH-1 gene was prevalent in sputum while mrkD gene was prevalent in urine. Serum resistance associated with outer membrane protein coding gene (traT) was found in all blood isolates. IucC, entB, and Irp-1 were detected in 32.14%, 78.5% and 10.7% of MDR isolates, respectively. We used two Polymerase Chain Reaction (PCR) analyses: Enterobacterial Repetitive Intergenic Consensus (ERIC) and Random Amplified Polymorphic DNA (RAPD). ERIC-PCR revealed 21 and RAPD-PCR revealed 18 distinct patterns of isolates with similarity ≥80%. ERIC genotyping significantly correlated with resistance patterns and virulence determinants. RAPD genotyping significantly correlated with resistance patterns but not with virulence determinants. Both RAPD and ERIC genotyping methods had no correlation with the capsule types. These findings can help up better predict MDR Klebsiella pneumoniae outbreaks associated with specific genotyping patterns.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 28004732      PMCID: PMC5177892          DOI: 10.1038/srep38929

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


K. pneumonia belongs to family Enterobacteriaceaea and is related to other genera, such as Enterobacter, Escherichia, and Salmonella1. K. pneumoniae is considered one of the most common Gram negative bacteria2. It is also an important pathogen in nosocomial infections in Egypt34. A number of factors contribute to virulence and pathogenicity in K. pneumoniae such as the capsular serotype, lipopolysaccharide, iron-scavenging systems and adhesions5. Iron acquisition systems are essential for the growth of pathogenic bacteria6. Moreover, the iron chelator siderophore allows bacteria to take up protein-bound iron from the host cells7. The incidence of microbial infections has been increasing in the past few decades. This has led to the continuous and uncontrolled use of antimicrobial drugs for prevention and treatment in several parts of the world. This, in turn, led to the emergence of specific drug and multidrug resistance among various strains of microorganisms including K. pneumonia8. Gram-negative bacteria have developed several mechanisms of resistance to currently used antimicrobials. One of the successful mechanisms for transmitting multiple-druge resistance among bacterial pathogens is horizontal transfer9. The spread of MDR isolates in the clinic has been attributed to commonly shared plasmids across bacteria such as K. pneumoniae, K. oxytoca, Escherichia coli, Enterobacter sp., and Salmonella sp1011. The efflux pump systems are among the most important causes of MDR12. Efflux pump systems in K. pneumoniae include AcrAB and mdtK systems, These belong to the Resistance Nodulation Division (RND) and Multi Antimicrobial Extrusion (MATE) family efflux pumps, respectively. The AcrAB-TolC pump is composed of an outer-membrane channel (TolC), a secondary transporter located in the inner membrane (AcrB), and a periplasmic component (AcrA)13. This pump is responsible for resistance to quinolones, tetracyclines, and chloramphenicol in various MDR isolates14. The MATE pumps, such as the mdtK system, transport some of those antimicrobial agents15. Porins such as OmpK35 and OmpK36 are crucial for the penetration of antibiotics into the cells and for susceptibility to cephalosporins and carbapenems16. Carbapenems have been used for the treatment of infections caused by Enterobacteriaceae17. The percentage of Carbapenem-resistant Enterobactericeae (CRE) has been on the rise18. One of the most prominent recent increases of MDR was observed with Klebsiella sp. In the period from 2001 through 201118. It is noteworthy that patients with infections due to carbapenemase-producing enterobacteriaceae, such as K. pneumoniae experience high mortality rates192021. Normally, these MDR infections are hard-to-treat with limited available choices of antibiotics such as tigecycline, colistin, fosfomycin, and aminoglycosides2223. Molecular typing and virulence analysis of clinical isolates are powerful tools that can shed light on multidrug resistant (MDR) Klebsiella pneumonia infections. We also used two Polymerase Chain Reaction (PCR) genotyping analyses: Enterobacterial Repetitive Intergenic Consensus (ERIC) and Random Amplified Polymorphic DNA (RAPD) to assess correlations of each with resistance patterns, virulence determinants, or capsule types of K. pneumoniae isolates.

Results

Primers

Primers used for amplification are listed in Table 1. More detail is provided under materials and methods.
Table 1

List of primers, expected amplicon size, and annealing temperatures.

GenePrimer Sequence (5′-----3′)Amplicon size (bp)Tm °CReference
RmpAFor: ACTGGGCTACCTCTGCTTCARev: CTTGCATGAGCCATCTTTCA53553Siu, et al.62
fimH-1For: GCCAACGTCTACGTTAACCTGRev: ATATTTCACGGTGCCTGAAAA18043The current study
mrkDFor: CCACCAACTATTCCCTCGAARev: ATGGAACCCACATCGACATT22643El Fertas-Aissani, et al.45
arbFor: TGGGGCAAAGAGGCGCTG GAGRev: CAGCCAGCGACACGGATTCTC63651The current study
entBFor: CTGCTGGGAAAAGCGATTGTCRev: AAGGCGACTCAGGAGTGGCTT38549The current study
irP-1For: TGAATCGCGGGTGTCTTATGCRev: TCCCTCAATAAAGCCCACGCT23849El Fertas-Aissani, et al.45
traTFor: GGTGTGGTGCGATGAGCACAGRev: CACGGTTCAGCCATCCCTGAG28855El Fertas-Aissani, et al.45
AcrABFor: ATCAGCGGCCGGATTGGTAAARev: CGGGTTCGGGAAAATAGCGCG31253The current study
tolCFor: ATCAGCAACCCCGATCTGCGTRev: CCGGTGACTTGACGCAGTCCT52751The current study
mdtkFor: GCGCTTAACTTCAGCTCARev: GATGATAAATCCACACCAGAA45343The current study
OmpK35For: CTCCAGCTCTAACCGTAGCGRev: GGTCTGTACGTAGCCGATGG24151The current study
OmpK36For: GAAATTTATAACAAAGACGGCRev: GACGTTACGTCGTATACTACG30543The current study
K1For: GGTGCTCTTTACATCATTGCRev: GCAATGGCCATTTGCGTTAG128347Fang, et al.63
K2For: GGATTATGACAGCCTCTCCTRev: CGACTTGGTCCCAACAGTTT90845Fang, et al.63

Clinical isolates

Thirty six of K. pneumoniae clinical isolates were collected as described under materials and methods. Isolates were recovered from specimens of urine (n = 16), wound (n = 4), cerebrospinal fluid CSF (n = 1), blood (n = 7), sputum (n = 8) on MacConkey’s agar. Colonies showing lactose fermenting ability were further identified both microscopically and biochemically.

Antimicrobial susceptibility pattern and detection of genes coding for MDR efflux pumps and outer membrane porins

As determined by disc diffusion antimicrobial susceptibility testing method, a percentage 77.7% (28/36) of isolates showed multidrug resistance (MDR) patterns, but all these MDR isolates were sensitive to colisitin (10 μg). All MDR isolates were resistant to beta lactam antibiotics and 64.28%, 82.15%, and 85.7% showed resistance to carbapenem, quinolone, and aminoglycosides, respectively. Tetracycline and chloramphenicol were effective against 61.1% of carbapenem-resistant isolates. The tested isolates were distributed into 24 antimicrobial resistance patterns (Table 2). Most patterns showed resistance to cephalosporin and beta lactam/beta lactamase inhibitors. The most predominant pattern was A6 and A8.
Table 2

Antimicrobial sensitivity patterns of multidrug resistant Klebsiella pneumoniae isolates and prevalence of genes coding for MDR efflux pumps (AcrAB & MdtK) and outer membrane porins (OmpK35 & OmpK36).

Anti-biotypeIsolate No.Antimicrobial resistance profileGenes coding for porins and efflux pumps
OmpK35OmpK36MdtKTolCAcrAB
A11wAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP-AMK-CN-TOB-CIP-NA-C+++++
A23 sAMP-AMC- CAZ-CXM-AZM-TE-DOX-NA-SXT++
A36wAMP-AMC-TZP-FOX-CAZ-CXM-AZM-CN-TOB-CIP-NA-SXT-++++
A47 sAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP-CN-TOB++
A58 sAMP-CAZ-CXM-AZM-TOB-TE-SXT-C+++
A69 uAMP-AMC-TZP-FOX-CAZ-CXM- IMP-ETP-AK-CN-TOB-CIP-NA++++
21c+++++
26w++++
A710 uAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP-AK-TOB-CIP-NA-SXT-C+++++
A811 uAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP-AK-CN-TOB-TET-DOX-SXT-CIP-NA-C++++
40b+++
48b+++
A915 uAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP-AK-CN-TOB- SXT-CIP-NA-C++++
A1018 uAMP-AMC-CAZ-CXM-AZM- TET-DO-SXT- C+++
A1120 sAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP-AK-CN-TOB- DO-SXT-CIP-NA-C++++
A1228 sAMP-AMC-TZP-FOX-CAZ-CXM-AZM-AK- ETP-TET-DO-SXT-CIP-NA++++
A1333 uAMP-AMC-TZP-FOX-CAZ-CXM-IMP-ETP-AK-CN-TOB- CIP-NA+++
A1435bAMP-AMC-TZP-FOX-CAZ-CXM-IMP-ETP-AK-CN-TOB- DO-TET-SXT-CIP-NA+++++
A1536 uAMP-AMC-TZP- CAZ-CXM-AZM-CN-TOB-TET-AK-DO-SXT-CIP-NA++++
A1641bAMP-AMC-TZP-FOX-CAZ-CXM-IMP-ETP-AK- TOB-CIP+++
A1746wAMP-AMC-CAZ-CXM- CN-TOB-TET-DOX-CIP- SXT++++
A1847bAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP- AK-CN-TOB-TET-DO- CIP-NA-SXT+++++
A1950 uAMP-AMC-TZP-FOX-CAZ-CXM-AZM - CN- DO-SXT-CIP-NA++++
A2051 uAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP-CN-TOB-AK-CIP-NA-SXT+++
A2153 uAMP-AMC-TZP-CXM-AZM- CN-TOB-TET-DO-SXT-CIP-NA-C+++
A2256 uAMP-AMC-TZP-FOX-CAZ-CXM-AZM-IMP-ETP-CN-TOB-AMK-TET-DO-CIP-NA-SXT++++
A2357 uAMP-AMC-TZP-FOX-CAZ-CXM-CN-TOB- TET-SXT-CIP-NA-C++++
A2458 uAMP-AMC-TZP-FOX-CAZ-CXM-AZM-SXT-NA- C++++

Abbreviations: u: urine, w- wound, s: sputum, c: CSF, b: blood.

∆Intermediate sensitivity.

AMP: ampicillin; AMC: Amoxicillin/clavulanic acid; TZP: Piperacillin/tazobactam; CAZ: Ceftazidime; CXM: Cefuroxime; FOX: Cefoxitin; AZM: Azteronam; IMP: Imipenem; ETP: Ertapenem; AK: Amikacin; TET: Tetracycline; DO: Doxycycline; CN: Gentamicin; TOB: Tobramycin; CIP: Ciprofloxacin; NA: Nalidixic acid; SXT: Co-trimoxazole; C: Chloramphenicol.

Gene prevalence for the AcrAB efflux pump system (82.14%) was more than that of the mdtK efflux pump (32.14%) in the MDR isolates. Incomplete AcrAB efflux pump system was detected in the remaining five isolates. The genes coding for porin protein (ompK35) and (ompK36) were not detected in six and four MDR isolates, respectively. Genes coding for the porins (ompK 35 and ompK36) were detected in all isolates recovered from wound and CSF specimens. The presence of these two porin-coding genes was variable in blood, sputum, and urine samples.

Detection of virulence genes

The prevalence and distribution of virulence factors are shown in Table 3. The fimH-1 and mrkD genes, encoding type 1 and type 3 fimbrial adhesins, were present in all wound and blood isolates. The fimH-1 gene was prevalent in sputum isolates whereas mrkD gene was prevalent in all urine samples. Serum resistance associated with the outer membrane protein coding gene (traT) was detected in all blood isolates.
Table 3

Distribution of virulence genetic profiles of K. pneumoniae isolates among capsule genotypes.

Isolate code*Capsule serotypeVirulence geneVirulence genetic profile
rmpAfimH-1mrkDtraTentBIrp-1IucC
1wNon K1/K2+++++++V1
3sK1++++V2
6wK2++++V3
7sNon K1/K2++++V4
8sK1+++++V5
10u
41b
48b
53u
9uK2++++V6
11uK1++++++V7
15uNon K1/K2+++V8
20s
46w
18uNon K1/K2++++V9
26w
35b
56u
58u
21cNon K1/K2+++++V10
50u
57u
28sNon K1/K2++++V11
33uNon K1/K2++V12
36uNon K1/K2++++V13
40bK1++++V14
47bNon K1/K2++++++V15
51uNon K1/K2+++++V16

Abbreviations: u: urine, w- wound, s: sputum, c: CSF, b: blood. Non K1/K2 = Non typable as K1 or K2 capsule genotypes.

The iron siderophores, aerobactin synthase gene (IucC), enterobactin biosynthesis gene (entB) and Yersinibactin biosynthesis gene (Irp-1) were detected in 32.14%, 85.7% and 28.5% of MDR isolates, respectively. The prevalence of capsule K genotypes in the 28 MDR isolates revealed that K1 (n = 8), K2 (n = 2) and the remaining isolates were non-typable as K1 or K2 genotypes. Isolates showing K1 genotypes were obtained from urine, blood, and sputum specimens, while K2 isolates was recovered from urine and wound samples. There were 16 virulence profiles according to detected virulence genes. It is noteworthy that virulence genetic profiles indicated that virulence determinants were variable among K. pneumoniae strains that possess the same capsule genotype (Table 3).

Genotyping of Klebsiella pneumoniae isolates by RAPD and ERIC analyses

According to the dendrograms, Enterobacterial Repetitive Intergenic Consensus (ERIC) and Random Amplified Polymorphic DNA (RAPD) analyses revealed 21 and 18 distinct patterns of K. pneumoniae isolates with similarity >80%, respectively (Figs 1 and 2). The 21 ERIC genotypes were designated E1 to E21 while the RAPD genotypes were designated R1 to R18 and each of their variant subtypes were indicated by a letter suffix. Dendrogram analysis of ERIC genotyping showed three clusters (A–C): clusters A, B, and C contained 12/28, 9/28, and 7/28 of the MDR isolates, respectively. The isolates (18 and 21) and (28, 35, 51, and 56) showed high similarity which may suggest that those isolates constitute a clonal lineage (Fig. 1). On the other hand, the RAPD genotyping revealed different pattern with 6 clusters (A–F). The isolates (15 and 58), (20 and 21), (9 and 18), and (36 and 56) showed high similarity (Fig. 2). Based on Simpson’s index of diversity, the discriminatory potential of different typing techniques used with K. pneumoniae isolates varied from 0.519 to 0.984 (Table 4). The high Simpson’s index of diversity for the antibiotyping, virulence, RAPD, and ERIC typing indicates greater diversity. Kendall’s tau-b correlation coefficient was calculated between RAPD and ERIC genotyping methods versus resistance patterns, virulence determinants, and capsule types of K. pneumoniae. Based on the statistical correlation tests (Table 5), the ERIC genotyping significantly correlates with resistance patterns (p < 0.01) and virulence determinants (p < 0.05). On the other hand, the RAPD genotyping significantly correlates with resistance patterns (p < 0.05) but not with virulence determinants (p > 0.05). Both RAPD and ERIC genotyping methods have no correlation with the capsule types (p > 0.05).
Figure 1

Dendrogram generated with Dice coefficient and the UPGMA clustering method, showing the genetic similarity among K. pneumoniae isolates by Enterobacterial Repetitive Intergenic Consensus (ERIC) genotyping.

Figure 2

Dendrogram generated with Dice coefficient and the UPGMA clustering method, showing the genetic similarity among K. pneumoniae isolates by Random Amplified Polymorphic DNA (RAPD) genotyping.

Table 4

Discriminatory potential of typing techniques for K. pneumoniae isolates.

Isolate codeAntibiogramVirulence gene pattern typingCapsule serotypingERIC typingRAPD typing
1wA1V1Non K1/K2E1R1
3sA2V2K1E2R2
6wA3V3K2E3R3a
7sA4V4Non K1/K2E4R4
8sA5V5K1E5R5
9uA6V6K2E6R6a
10uA7V5K1E7aR7
11uA8V7K1E8aR8a
15uA9V8Non K1/K2E20R9
18uA10V9Non K1/K2E9aR6a
20sA11V8Non K1/K2E10R10
21cA6V10Non K1/K2E9aR10
26wA6V9Non K1/K2E9bR11
28sA12V11Non K1/K2E13R3b
33uA13V12Non K1/K2E21R12
35bA14V9Non K1/K2E13R13
36uA15V13Non K1/K2E19R3d
40bA8V14Non K1/K2E11R14
41bA16V5K1E14R15a
46wA17V8Non K1/K2E18R18
47bA18V13Non K1/K2E7bR17
48bA8V5K1E15R15b
50uA19V10Non K1/K2E12R16
51uA20V15Non K1/K2E13R3c
53uA21V5K1E17R6b
56uA22V9Non K1/K2E13R3d
57uA23V10Non K1/K2E8bR8b
58uA24V9Non K1/K2E16R9
Simpsons index of diversity0.9840.9250.5190.9690.955
Table 5

Kendall’s tau-b correlation coefficient of Random Amplified Polymorphic DNA (RAPD) and Enterobacterial Repetitive Intergenic Consensus (ERIC) genotyping methods versus resistance patterns, virulence determinants, and capsule types of K. pneumoniae isolates.

Genotyping methodResistance patternVirulence determinantCapsule type
RAPD0.306* (p < 0.05)0.268 (p = 0.053)0.106 (p = 0.497)
ERIC0. 520* (p < 0.01)0.352* (p < 0.05)0.210 (p = 0.181)

*Correlation is significant at p < 0.05 (two-tailed).

Discussion

K. pneumoniae is the causative agent of several different healthcare-associated infections, such as bloodstream infections, wound infections, pneumonia, and meningitis. The extensive use of antimicrobials led to high incidence of resistance in K. pneumoniae24. In our study, K. pneumoniae isolates showing multidrug resistance comprised 71.1% of total samples. Rates as high as 66.7% of MDR K. pneumoniae isolates were also detected in other studies25. The high rates of antimicrobial resistance detected in our study can be attributed to the lack of strict policies that govern the use of antibiotics in Egypt3. Antibiotic efflux pumps represent one of the most important antimicrobial resistance mechanisms used by K. pneumoniae clinical isolates2627. The increased efflux of the antimicrobial agent leads to the reduction of its intracellular concentration, which can enhance bacterial survival28. The AcrAB efflux pump was more common than mdtK. The presence of the multidrug efflux pump system (AcrAB-TolC) was significantly correlated with the MDR pattern. On the other hand, five MDR isolates was missing either the AcrAB efflux pump or the TolC outer membrane protein or both. Gram negative bacterial outer membranes are poorly permeable to both hydrophobic and hydrophilic molecules. Thus, most antimicrobial agents other than β-lactam must cross the membrane in order to reach their intracellular drug targets and so require the presence of porin to bypass the asymmetric bilayer of phospholipid and lipopolysaccharide membrane29. Consequently, it has been reported that loss of porins ompK 35 and ompK 36 led to an increase in carbapenem, ciprofloxacin, and chloramphenicol resistance30. Surprisingly, in our research, porin loss was not significantly correlated to the MDR pattern (P > 0.05). This could be attributed to the presence of point mutations, disruption in the protein coding sequence, or promoter region mutations31. In the current study, about fifty percent of the total isolates showed resistance to both imipenem and ertapenem. In this context, there has been a significant increase in carbapenem resistance among K. pneumoniae isolates in Egypt during the last few years (from 13.9% to 44.4%)33233. K. pneumoniae isolates possess several mechanisms to evade the activity of carbapenems. These include AmpC production or ESBL production together with porin loss, carbapenemase production, and production of acquired Metallobetalactamase (MBL)34. Contrary to the New Delhi metallo-β-lactamase, which is a broad spectrum carbapenemase with ability to inactivate β-lactams except aztreonam35, all carabapenem resistant isolates in our study were also resistant to aztreonem. This may be due to the development of a new antimicrobial resistance pattern in Egyptian hospitals. In all tested carbapenem-resistant isolates (n = 18), there was no simultaneous porin loss with AmpC or ESBL production. In another study36, Szabó et al. showed that OmpD and OmpF in an ertapenem-resistant E. coli strain were less permeable than those of a susceptible control strain. This suggested that the possession of these two porins could lead to higher resistance due to an associated pump system36. This is relevant to our study given the fact that OmpF genes in E. coli are homologues to OmpK35 genes in K. pneumoniae29. Carbapenemase-producing enterobacteriaceae, such as K. pneumonia, can cause deadly infections2021. Colistin was used to treat Gram-negative infections but was abandoned because of its toxicity. Recently, it has been revived again as a treatment for life-threatening infections caused by some resistant Gram-negative bacteria, such as Pseudomonas aeruginosa and Acinetobacter baumannii37. Interestingly, all the tested K. pneumoniae isolates in this study were sensitive to colistin. Both OmpK35 and OmpK36 play a role in K. pneumoniae virulence and infection. Deletion of OmpK36 or OmpK35/OmpK36 can lead to the reduction in virulence of highly virulent strains and can increase their susceptibility to neutrophil phagocytosis3839. In our investigation, both Ompk 35 and OmpK36 porin- coding genes were simultaneously detected in all K. pneumoniae isolates recovered from wound and CSF samples. Their presence was variable though in sputum, blood, and urine samples. A direct correlation between efflux pumps and virulence of pathogenic bacteria was reported by Padilla et al40. Several genes essential for intracellular invasion and survival were downregulated in mutant strains lacking acrAB-tolC efflux pumps41. Type 1 fimbriae are the most common adhesive organelles in enterobacteriaceae and can lead to urinary tract infections42. Type 3 fimbrial adhesin can mediate the binding of K. pneumoniae to endothelial cells and to epithelial cells of the respiratory and urinary tracts. MrkD protein is a crucial factor in binding bacteria to the collagen molecules of the mammalian cells43. Many K. pneumoniae clinical isolated normally express both type 1 and type 3 fimbrial adhesins44. In the current study, the two genes coding for these adhesive structures (Type 3 fimbrial adhesin and MrkD) were detected in all wound, blood, and CSF isolates and in about 80% of sputum and urine isolates. The plasmidic traT gene encodes an outer membrane protein involved in bacterial conjugation and blocks the complement-mediated cascade, and act as an invasin45. We detected the traT gene in twenty two K. pneumoniae isolates (78.5%). The prevalence of traT gene in our isolates was relatively high as it was frequently associated with the K1 capsule serotype. Most enterobacteriaceae strains contain genes encoding iron uptake systems, such as enterochelin or aerobactin46. These siderophores have dual roles as they can also inhibit T cell proliferation in addition to their role in enhancing iron uptake47. The iron siderophores aerobactin synthase gene (IucC), enterobactin biosynthesis gene (entB), and yersinibactin biosynthesis gene (Irp-1) were detected in 32.14%, 78.5%, and 10.7% of MDR K. pneumoniae isolates, respectively. Highly pathogenic Yersinia strains have high-pathogenicity island (HPI) that contain the gene Irp-1. This HPI is also prevalent in Klebsiella and other enterbocateria48, such as E. coli, K. oxytoca, K. pneumonia, Citrobacter species, and Enterobacter species46. The capsular serotypes K1 and K2 are associated with the predominant virulent strains of K. pneumoniae49. Feizabadi et al. has shown that K1 and K2 serotypes represented 11.2% and 14.6%, respectively, of the total K. pneumoniae isolates50. In our study, K1 and K2 serotypes represented 28.5% and 7.14% of the MDR K. pneumoniae isolates. Molecular typing is a potent tool for the study of nosocomial infections51. RAPD is a widely used genotyping tool for K. pneumoniae strains with ESBLs production (Gori et al., 1996). Out of a total of 28 MDR K. pneumoniae isolates in the current investigation, ERIC-PCR revealed 21 and RAPD-PCR revealed 18 distinct patterns of K. pneumoniae isolates. This may be attributed to the genetic variation in pathogenic these K. pneumoniae strains. Our data confirms the observations of Lai et al.52 that pathogenic K. pneumoniae is highly heterogeneous, due to differences in nucleotide sequences. The large number of serotypes in this species could also explain this genetic diversity highlighted by the RAPD-PCR genotypic analysis53. Correlations between RAPD-PCR genotyping and antibiotic resistance patterns of K. pneumonia were observed by Ashayeri-Panah et al.54 and Espinar et al.55. In the current study, both RAPD-PCR and ERIC-PCR genotypic analyses revealed correlations with resistance patterns of K. pneumonia. The highest correlation coefficients were observed with ERIC genotyping, indicating that the latter may be more valuable in prediction of resistance patterns of K. pneumoniae as compared to the RAPD-PCR genotyping method. Moreover, ERIC, but not RAPD-PCR, revealed statistically significant correlations with virulence determinants of K. pneumoniae. Finally, both RAPD-PCR and ERIC-PCR showed no statistically significant correlation with the detected capsule types of K. pneumoniae isolates. Results included in this study can help up better predict MDR Klebsiella pneumoniae outbreaks associated with specific genotyping patterns in the future.

Materials and Methods

Bacterial strains

Thirty six K. pneumonia clinical isolates were recovered from patients at Kasr El Aini Hospitals, Cairo, Egypt. Approvals from the institutional review board of the hospitals and the Research Ethics committee of the October University for Modern Sciences and Arts, Giza, Egypt were obtained prior to conducting the study. All methods were performed in accordance with the required guidelines and regulations. For experiments involving human samples, informed consent was obtained from all subjects. Strains were isolated from sputum, urine, blood, wound, and cerebrospinal fluid (CSF) specimens. Specimens were collected in the period from August 2015 through December 2015. Isolates were identified by conventional and biochemical tests as described previously56 and then were stored at −20 °C in brain heart infusion broth with 15% v/v glycerol.

Antimicrobial susceptibility

Antibiotic susceptibility testing of Klebsiella sp., was performed according to the Kirby-Bauer disk diffusion method57. The antimicrobial sensitivity assays to nineteen antibacterial drugs were done using commercially available antibiotic discs (OXOID, UK) including Ampicillin (AMP, 10 μg), Amoxicillin/Clavulanic acid (AMC, 20/10 μg), Piperacillin/Tazobactam (TZP, 110/10 μg), Cefoxitin (FOX, 30 μg), Ceftazidime (CAZ, 30 μg), Cefuroxime (CXM, 30 μg), Aztreonam (ATM, 30 μg), Ertapenem (ETP, 10 μg), Impinem (IMP, 10 μg), Gentamicin (CN, 10 μg), Tobramycin (TOB, 10 μg), Amikacin (AK, 30 μg), Tetracycline (TE, 30 μg), Doxycycline (DO, 30 μg), Ciprofloxacin (CIP, 5 μg), Nalidixic acid (NA, 30 g), Co-trimoxazole (SXT, 30 μg), Colistin (CT, 10 μg) and Chloramphenicol (C, 30 μg). For all tested antimicrobials except colistin (10 μg), the plates were then incubated at 37 °C for 24 hours, the diameters of the inhibition zones were measured in millimeter and interpretation of results was done according to CLSI standards57. For Colistin, breakpoints were used for interpretation58. Multidrug resistant (MDR) isolates were selected according to their non-susceptibility to at least one agent in three or more antimicrobial categories59.

Detection of multidrug resistance and virulence determinants using PCR

DNA extraction

Genomic DNA was extracted from overnight culture using ZYMO Quick-gDNA™ MiniPrep (ZYMO Research, CA, USA). Concentration of the DNA extract and purity was determined by measuring absorbance at wavelengths 260 and 280 nm. The integrity of genomic DNA was tested by resolving DNA extracts on a 0.8% w/v agarose gel by electrophoresis. These crude DNA extracts were frozen at −20 °C. Primers used for amplification are listed in Table 1 and were prepared by Invitrogen® (Thermo Fisher scientific Inc., MA, USA). Primers were designed using the complete genome sequence of K. pneumoniae MGH 78578 (accession no. CP000647) and the internet based software Basic Local Alignment Tool (BLAST) in NCBI and Multiple sequence alignment using the CLUSTAL Omega in EMBL-EBI.

PCR detection of multidrug resistance genes

Isolates that showed multidrug resistance phenotypes were tested for genes coding for the multidrug efflux pump system AcrAB-TolC and MdtK, in addition to porin coding genes (OmpK35 and OmpK36). The amplifications of these genes were performed in cycles with initial denaturing at 94 °C for 5 min followed by 35 cycles, each cycle consisting of 30 seconds at 94 °C for denaturation, 30 seconds for primer annealing (Table 1), and 1.5 min at 72 °C for elongation. After these cycles, the final elongation step was carried out at 72 °C for 10 min45.

PCR detection of virulence-associated genes

PCR was used to amplify the virulence-associated genes. These genes include those encoding for regulators of mucoid phenotype A (rmpA), type 1 and type 3 adhesins (fimH-1, mrkD), aerobactin (iron siderophore) synthase (IucC), bacteriocin biosynthesis [enterobactin (entB), and yersiniabactin (irP-1)], and serum resistance-associated outer membrane lipoprotein (traT). Measurements of the prevalence of capsule serotypes K1 and K2 were also included. The PCR conditions were similar to those used for detection of multidrug resistance genes with annealing temperatures included in Table 1.

Molecular typing of Klebsiella pneumoniae isolates using Random Amplified Polymorphic DNA (RAPD) and Enterobacterial Repetitive Intergenic Consensus (ERIC) methods

Typing by randomly amplified polymorphic DNA (RAPD) analysis was performed according to the protocol published by Deschaght et al.60 using the primer RAPD4 (5′-AAGACGCCGT-3′). Briefly, two microliters of the DNA template were added to 12.5 μL multiplex mastermix (MyTaq™HM Mix, Bioline®, MA, USA), 1 μL primer (10 pmol), and 9.5 μL H2O. PCR cycles of initial incubation at 94 °C for 15 min followed by cycling for 40 times at 94 °C for 1 min, 37 °C for 1 min, and a final elongation at 72 °C for 2 min was performed. ERIC typing was carried out using the primer ERIC2 (5′-AAGTAAGTGACTGGGGTGAGCG-3′) using a similar PCR program to that of the RAPD method except for an extension time of 8 min59. RAPD and ERIC fragments were visualized by 1.5% w/v agarose gel electrophoresis and results were analyzed using GelCompar II software (Version 6.6.11, Applied Maths, Kortrijk, Belgium). The patterns were normalized with bands of the marker and bands that were consistently present in all patterns. Computer-assisted analyses implemented in this study were performed according to the manufacturer’s instructions.

Comparing different typing methods and calculation of discriminatory index

Simpsons index of diversity [discriminatory index (D)], based on the probability that two unrelated isolate samples from the test population are located in different typing groups, was calculated according to the following equation: where N is the total number of isolates in the sample population, s is the total number of types described, and nj is the number of strains belonging to the jth type. Simpsons index of diversity ranges from 0.0 to 1.0, where 1.0 indicates that a typing method is able to distinguish each member of a population from all other members of that population and, conversely, 0.0 indicates that all members of a strain population are of an identical type61.

Statistical analysis

All statistical analyses were performed using SPSS, version 18.0 (SPSS Inc., NY, USA). Chi-square tests were used to compare categorical measures between groups (Fisher’s exact test where appropriate). Statistical correlation tests, including Kendall’s tau-b nonparametric correlation coefficients, were determined at the two-tailed significance level for correlation of genotyping methods with virulence determinants, antimicrobial resistance, and capsule types. Data output of correlation analyses with p values less than 0.05 were considered statistically significant.

Additional Information

How to cite this article: Wasfi, R. et al. Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae clinical isolates recovered from Egyptian hospitals. Sci. Rep. 6, 38929; doi: 10.1038/srep38929 (2016). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  57 in total

Review 1.  Molecular basis of bacterial outer membrane permeability revisited.

Authors:  Hiroshi Nikaido
Journal:  Microbiol Mol Biol Rev       Date:  2003-12       Impact factor: 11.056

2.  Colistin for Klebsiella pneumoniae-associated sepsis.

Authors:  A Karabinis; E Paramythiotou; D Mylona-Petropoulou; A Kalogeromitros; N Katsarelis; F Kontopidou; I Poularas; H Malamou-Lada
Journal:  Clin Infect Dis       Date:  2003-12-04       Impact factor: 9.079

3.  Type 3 fimbrial shaft (MrkA) of Klebsiella pneumoniae, but not the fimbrial adhesin (MrkD), facilitates biofilm formation.

Authors:  J Langstraat; M Bohse; S Clegg
Journal:  Infect Immun       Date:  2001-09       Impact factor: 3.441

Review 4.  Hospital-acquired infections due to gram-negative bacteria.

Authors:  Anton Y Peleg; David C Hooper
Journal:  N Engl J Med       Date:  2010-05-13       Impact factor: 91.245

5.  Molecular typing and virulence analysis of serotype K1 Klebsiella pneumoniae strains isolated from liver abscess patients and stool samples from noninfectious subjects in Hong Kong, Singapore, and Taiwan.

Authors:  L Kristopher Siu; Chang-Phone Fung; Feng-Yee Chang; Nelson Lee; Kuo-Ming Yeh; Tse Hsien Koh; Margaret Ip
Journal:  J Clin Microbiol       Date:  2011-09-07       Impact factor: 5.948

6.  Molecular mechanisms disrupting porin expression in ertapenem-resistant Klebsiella and Enterobacter spp. clinical isolates from the UK.

Authors:  Michel Doumith; Matthew J Ellington; David M Livermore; Neil Woodford
Journal:  J Antimicrob Chemother       Date:  2009-02-20       Impact factor: 5.790

7.  Spread of plasmids containing the bla(VIM-1) and bla(CTX-M) genes and the qnr determinant in Enterobacter cloacae, Klebsiella pneumoniae and Klebsiella oxytoca isolates.

Authors:  Elisenda Miró; Concha Segura; Ferran Navarro; Lluisa Sorlí; Pere Coll; Juan P Horcajada; Francisco Alvarez-Lerma; Margarita Salvadó
Journal:  J Antimicrob Chemother       Date:  2010-01-20       Impact factor: 5.790

8.  Virulence profiles and antibiotic susceptibility patterns of Klebsiella pneumoniae strains isolated from different clinical specimens.

Authors:  R El Fertas-Aissani; Y Messai; S Alouache; R Bakour
Journal:  Pathol Biol (Paris)       Date:  2012-12-05

9.  Species distribution and antimicrobial susceptibility of gram-negative aerobic bacteria in hospitalized cancer patients.

Authors:  Hossam M Ashour; Amany El-Sharif
Journal:  J Transl Med       Date:  2009-02-19       Impact factor: 5.531

10.  Vital signs: carbapenem-resistant Enterobacteriaceae.

Authors: 
Journal:  MMWR Morb Mortal Wkly Rep       Date:  2013-03-08       Impact factor: 17.586

View more
  26 in total

1.  Molecular prevalence of resistance determinants, virulence factors and capsular serotypes among colistin resistance carbapenemase producing Klebsiella pneumoniae: a multi-centric retrospective study.

Authors:  Aradhana Das; Rajesh Kumar Sahoo; Mahendra Gaur; Suchanda Dey; Saubhagini Sahoo; Anshuman Sahu; Dibyajyoti Uttameswar Behera; Sangita Dixit; Pooja Singhvi Jain; Bhawana Jain; Kundan Kumar Sahu; K Swapna Kumari; Enketeswara Subudhi
Journal:  3 Biotech       Date:  2021-12-28       Impact factor: 2.406

2.  Whole Genome Characterization of the High-Risk Clone ST383 Klebsiella pneumoniae with a Simultaneous Carriage of blaCTX-M-14 on IncL/M Plasmid and blaCTX-M-15 on Convergent IncHI1B/IncFIB Plasmid from Egypt.

Authors:  Eva A Edward; Nelly M Mohamed; Azza S Zakaria
Journal:  Microorganisms       Date:  2022-05-26

3.  Emergence of co-existence of blaNDM with rmtC and qnrB genes in clinical carbapenem-resistant Klebsiella pneumoniae isolates in burning center from southeast of Iran.

Authors:  Somayeh Kiaei; Mohammad Moradi; Hossein Hosseini Nave; Zahra Hashemizadeh; Majid Taati-Moghadam; Davood Kalantar-Neyestanaki
Journal:  Folia Microbiol (Praha)       Date:  2018-07-12       Impact factor: 2.099

4.  Genotypic validation of extended-spectrum β-lactamase and virulence factors in multidrug resistance Klebsiella pneumoniae in an Indian hospital.

Authors:  Rajesh Kumar Sahoo; Aradhana Das; Mahendra Gaur; Ankita Pattanayak; Saubhagini Sahoo; Nagen Kumar Debata; Pattanathu K S M Rahman; Enketeswara Subudhi
Journal:  Pathog Glob Health       Date:  2019-12-22       Impact factor: 2.894

5.  Landscape of Multidrug-Resistant Gram-Negative Infections in Egypt: Survey and Literature Review.

Authors:  Amani El-Kholy; Hadir A El-Mahallawy; Noha Elsharnouby; Mohamed Abdel Aziz; Ahmed Mohamed Helmy; Ramy Kotb
Journal:  Infect Drug Resist       Date:  2021-05-24       Impact factor: 4.003

6.  Klebsiella spp. cause severe and fatal disease in Mozambican children: antimicrobial resistance profile and molecular characterization.

Authors:  Arsénia J Massinga; Marcelino Garrine; Augusto Messa; Nélio A Nobela; Nadia Boisen; Sergio Massora; Anélsio Cossa; Rosauro Varo; António Sitoe; Juan Carlos Hurtado; Jaume Ordi; Hélio Mucavele; Tacilta Nhampossa; Robert F Breiman; Cynthia G Whitney; Dianna M Blau; Quique Bassat; Inácio Mandomando
Journal:  BMC Infect Dis       Date:  2021-06-05       Impact factor: 3.090

7.  An Outbreak of Carbapenem-Resistant Klebsiella pneumoniae in an Intensive Care Unit of a Major Teaching Hospital in Chongqing, China.

Authors:  Lingyi Zeng; Chengru Yang; Jisheng Zhang; Kewang Hu; Jingbo Zou; Jie Li; Jianmin Wang; Wan Huang; Lining Yin; Xiaoli Zhang
Journal:  Front Cell Infect Microbiol       Date:  2021-06-02       Impact factor: 5.293

8.  Virulence Characteristics of Carbapenem-Resistant Klebsiella pneumoniae Strains from Patients with Necrotizing Skin and Soft Tissue Infections.

Authors:  Fiorella Krapp; Andrew R Morris; Egon A Ozer; Alan R Hauser
Journal:  Sci Rep       Date:  2017-10-19       Impact factor: 4.379

9.  Prevalence, Virulence Genes, Antimicrobial Susceptibility, and Genetic Diversity of Bacillus cereus Isolated From Pasteurized Milk in China.

Authors:  Tiantian Gao; Yu Ding; Qingping Wu; Juan Wang; Jumei Zhang; Shubo Yu; Pengfei Yu; Chengcheng Liu; Li Kong; Zhao Feng; Moutong Chen; Shi Wu; Haiyan Zeng; Haoming Wu
Journal:  Front Microbiol       Date:  2018-03-26       Impact factor: 5.640

10.  The Molecular Epidemiology of Resistance to Antibiotics among Klebsiella pneumoniae Isolates in Azerbaijan, Iran.

Authors:  Mehdi Kashefieh; Hassan Hosainzadegan; Shabnam Baghbanijavid; Reza Ghotaslou
Journal:  J Trop Med       Date:  2021-07-12
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.