Literature DB >> 23990916

Antibiotic resistance of bacteria isolated from the internal organs of edible snow crabs.

Misoon Kim1, Tae-Hyung Kwon, Su-Mi Jung, Seung-Hak Cho, Seon Yeong Jin, Nyun-Ho Park, Choong-Gon Kim, Jong-Shik Kim.   

Abstract

Antibiotic resistance and microbiota within edible snow crabs are important for the Chionoecetes (snow crab) fishing industry. We investigated these parameters using culture methods and antibiotic susceptibility tests with six internal organs from three species of Chionoecetes. Each sample revealed many unexpected microbial species within Chionoecetes internal organs. On the basis of 16S rRNA sequence analysis of 381 isolates, the most abundant genera identified in Chionoecetes opilio were Acinetobacter spp. (24%), Bacillus spp. (4%), Pseudomonas spp. (34%), Stenotrophomonas spp. (28%), and Agreia spp. (11%). In Chionoecetes sp. crabs, Acinetobacter spp. (23%), Bacillus spp. (12%), and Psychrobacter spp. (20%) were most prevalent, while Agreia spp. (11%), Bacillus spp. (31%), Microbacterium spp. (10%), Rhodococcus spp. (12%), and Agrococcus spp. (6%) were most abundant in C. japonicus. Our antibiotic resistance test found resistance to all nine antibiotics tested in 19, 14, and two of the isolates from C. opilio, Chionoecetes sp., and, C. japonicus respectively. Our results are the first to show that microbes with antibiotic resistance are widely distributed throughout the internal organs of natural snow crabs.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23990916      PMCID: PMC3749200          DOI: 10.1371/journal.pone.0070887

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Snow crabs belong to the subphylum Crustacea, Order Decapoda, Family Majidae, and Genus Chionoecetes. These Chionoecetes are found in colder water at depths less than 2000 m where it is muddy or sandy [1]. Three kinds of Chionoecetes are prominent on the east coast of Korea, including snow crab (Chionoecetes opilio), red-tanner crab (Chionoecetes japonicus), and the hybrid Neodo-Daege (Chionoecetes sp.) [2]. Chionoecetes fishing is a major industry and source of income in the area [3]–[6]. However, contamination of the East Sea of Korea from human activities has raised serious sanitation concerns that could potentially threaten this industry [7]. Research on antibiotic resistance has primarily focused on human disease; there is limited understanding of antibiotic resistance genes in natural environments. The relationship between environmental microorganisms and human pathogens is not clear; a recent report showed that soil bacteria and human pathogens shared an antibiotic resistome [8]. In this study, we analyzed the microbiota within parts of Chionoecetes using culturing methods, and the culturable microbial isolates were tested for antibiotic resistance. Here, we report the microbial populations and antibiotic resistance of isolates from the internal organs of Chionoecetes. These results may be used to monitor snow crab populations and to identify potentially dangerous changes in microbiota that could threaten the snow crab industry.

Materials and Methods

Collection of snow crabs

No specific permissions were required for these locations or activities because many snow crabs were sold daily at the market near the Harbor. Wild-caught, uncooked snow crabs (Chionoecetes spp.) were collected from a retail seafood shop at Jukbyeon Harbor and were placed into clean, resealable plastic bags. Samples were stored in a cooler during transfer from Jukbyeon Harbor to the laboratory where they were then stored at 4°C until processed. The morphological characteristics of snow crabs can be distinguished by their carapace color, the arrangement of granules on the lateral carapace, and the presence or absence of spines on the lateral carapace [4]. The crabs were originally caught in the East Sea of Korea [5], [6]. There are no-take periods from June through November for snow crab (Chionoecetes opilio) and July through August for red-tanner crab (Chionoecetes japonicus), and no prohibition for Neodo-Daege (Chionoecetes sp.) for management of the snow crab industry.

Sample preparation

Samples were divided into the following six parts: guts (D), gills (G), heart (H), leg meat (LS), carapace meat (S), and carapace juices (J). Each sample was homogenized with 10 mL of 10 mM potassium phosphate buffer, and 100 µL of each sample was spread onto agar plates.

Enumeration of microbial populations

The serial dilutions were spread plated on various media to determine microbial counts of the Chionoecetes spp. in sterile water, and the dilutions were dispensed onto agar plates. For all experiments reported herein, we cultured aerobic microbes on the following media: YPD (yeast extract, peptone, dextrose, BD Bioscience, USA) with chloramphenicol (100 mg/L) and streptomycin (100 mg/L) for yeast; PDA (potato dextrose agar, BD Bioscience) with chloramphenicol (100 mg/L) and streptomycin (100 mg/L) for fungi; R2A (BD Bioscience); NA (nutrient agar, BD Bioscience); TSA (tryptic soy agar, BD Bioscience) for general bacteria; or MA (marine agar, BD Bioscience). The plates were incubated aerobically at 28°C for 1 wk, and average CFU (colony-forming units) values were obtained from triplicate plate counts.

Isolation of bacteria

All colonies from individual plates of one plate or two plates from the plates of colony counts were picked up and cultured separately. In total, 381 individual isolates were transferred to fresh plates three times and then processed for sequencing of 16S rRNA and ITS genes.

Sequencing

The primers used to amplify the 16S rRNA and ITS genes for bacteria and other microbes were 27F and 1492R [9] and ITS1 and ITS4 [10], respectively. The PCR reaction was performed with 20 ng of genomic DNA as the template in a 30-µL reaction mixture by using EF-Taq DNA polymerase (Solgent, Korea). The thermocycler conditions were 95°C for 5 min, followed by 35 cycles of 95°C for 2 min, 55°C for 60 s, and 72°C for 60 s, then a final extension step for 10 min at 72°C. Thereafter, the amplification products were purified using a multiscreen filter plate (Millipore Corp., Bedford, MA, USA). Sequencing reactions were performed using a PRISM BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Bio- systems, Foster City, Calif., USA). The DNA samples containing the extension products were added to Hi-Di formamide (Applied Biosystems, Foster City, CA). The mixture was incubated at 95°C for 5 min followed by 5 min on ice, and then analyzed using an ABI Prism 3730XL DNA analyzer (Applied Biosystems, Foster City, CA). DNA sequencing of isolates was performed by Macrogen Inc. (Seoul, Korea).

Phylogenetic trees

The 16S rRNA and ITS sequences were aligned using the Nearest Alignment Space Termination (NAST) aligner [11]. Aligned sequences were then compared to the Lane mask using the Greengenes website [12]. Sequence matching to the Ribosomal Database Project [13] was used to find GenBank sequences representing the most closely related type of strain for each isolate. These type strains were included as references in the phylogeny using the Greengenes Automatic Taxonomic Classification algorithm [12]. Phylogenetic trees were constructed using neighbor-joining [14] with MEGA5 for Windows [15]. Evolutionary distances were calculated with the Kimura 2-parameter method. Bootstrap analyses of the neighbor-joining data were conducted based on 1000 samples to assess the support for inferred phylogenetic relationships.

Antibiotics

The antibiotics (content per disc) used in the study were ampicillin (10 µg), chloramphenicol (30 µg), erythromycin (15 µg), kanamycin (30 µg), penicillin (10 unit), rifampicin (5 µg), tetracyclin (30 µg), ticarcilin (75 µg), and vancomycin (30 µg). The antibiotic discs were purchased from BD Bioscience (San Jose, CA).

Antibiotic susceptibility test

Bacteria were considered susceptible to a particular antibiotic if the bacteria formed a clear zone around a disc on the media (disc diffusion susceptibility testing). After autoclaving the nutrient agar and cooling the agar to 50–55°C, bacterial colonies were mixed into the autoclave medium flask and poured onto petri dishes. Each antibiotic susceptibility testing disc (BD Bioscience) was placed onto a plate and incubated at 28°C for 24 or 48 h. The results indicated whether the isolates were resistant or susceptible to each antibiotic.

PCR assays for detection of resistance genes and sequencing of the PCR products

Bacteria were tested through PCR method with the primers of antibiotic resistance genes as shown in Table 1. For the PCR, the reaction mixtures contained 10 µl 2× DNA polymerase enzyme (PowerAmp™ 2× premix), 4 µl primer mixtures, 5 µl template DNA and sterile distilled water to bring the final volume to 20 µl. The PCR was performed with TaKaRa PCR Thermal Cycler Dice TP600 (TaKaRa, Japan). The reaction was started with a 15-min denaturation step at 95°C. In the PCRs, the temperature cycles consisted of 30 sec at 95°C, followed by 1 min at 58°C and 1 min at 72°C and each cycle was repeated 35 times. The final cycle was followed by incubation of the reaction mixture for 10 min at 72°C. Amplified PCR products were analyzed by gel electrophoresis in 2% agarose gels stained with ethidium bromide, visualized with ultraviolet illumination, and imaged with the Gel Doc 2000 documentation system (Bio-Rad, Hercules, CA, USA). DNA sequencing of antibiotic resistance genes was performed by Macrogen Inc. (Seoul, Korea).
Table 1

PCR primers targeting antibiotic resistance genes.

AntibioticsTarget geneSequence 5′-3′Amplicon size (bp)References
ampicillin blaSHV FW* TTA TCT CCC TGT TAG CCA CC 796 [19]
RV GAT TTG CTG ATT TCG CTC GG
blaOXA FW ACC AGA TTC AAC TTT CAA 589
RV TCT TGG CTT TTA TGC TTG
blaTEM FW ATA AAA TTC TTG AAG AC 1,073
RV TTA CCA ATG CTT AAT CA
chloramphenicol catA1 FW CGC CTG ATG AAT GCT CAT CCG 456 [17]
RV CCT GCC ACT CAT CGC AGT AC
catA2 FW ATG AAT TTT ACC AGA ATT GAT CTG AA 639
RV ATT TCA GTA TGT TAT CAC ACA TCA TCT
catA3 FW AAA TTG GGT TCG CCG TGA 1,863
RV ATT TAC TGT TAC ACA ACT CTT GTA GCC
catB3 FW TCA AAG GCA AGC TGC TTT CTG AGC 566
RV TAT TAG ACG AGC ACA GCA TGG GCA
erythromycin ermA FW TAT CTT ATC GTT GAG AAG GGA TT 138 [18]
RV CTA CAC TTG GCT TAG GAT GAA A
ermB FW CTA TCT GAT TGT TGA AGA AGG ATT 141
RV GTT TAC TCT TGG TTT AGG ATG AAA
mefA FW AGT ATC ATT AAT CAC TAG TGC 348 [19]
RV TTC TTC TGG TAC TAA AAG TGG
penicillin pbp2a FW CCG CTG ATC TTG ATT GAA TAG 355 [20]
RV ATG CGT TTT CAT CCC CTC TG
kanamycin aphA-3 FW GGGACCACCTATGATGTGGAACG 600 [21]
RV CAGGCTTGATCCCCAGTAAGTC
tetracycline tetA FW GTA ATT CTG AGC ACT GTC GC 956 [16]
RV CTG CCT GGA CAA CAT TGC TT
tetB FW ACG TTA CTC GAT GCC AT 1,169
RV AGC ACT TGT CTC CTG TT
tetC FW AAC AAT GCG CTC ATC GT 1,138
RV GGA GGC AGA CAA GGT AT
tetG FW CCG GTC TTA TGG GTG CTC TA 603
RV CCA GAA GAA CGA AGC CAG TC
vancomycin vanA FW GCT ATT CAG CTG TAC TC 783 [22]
RV CAG CGG CCA TCA TAC GG
vanB FW CAT CGC CGT CCC CGA ATT TCA AA 297
RV GAT GCG GAA GAT ACC GTG GCT

FW, forward; RV, reverse.

FW, forward; RV, reverse.

Results

Culturable microbiota

A total of 381 isolates, including 221 from C. opilio, 76 from C. japonicus, and 84 from Chionoecetes sp. were isolated using six different media (Figure 1A). Figure 1 summarizes the phylogenetic distribution of the 16S rRNA gene sequences. The genera Pseudomonas, Stenotrophomonas, and Acinetobacter predominated the bacterial communities found in Chionoecetes, commonly representing more than 60% of the sequences isolated from the three crab species. The microbial isolates from C. japonicus and C. opilio included 19 and 20 genera, respectively, whereas the isolates of Chionoecetes sp. included 21 genera (Figure 1A). The greatest diversity of microbiota among the six different internal organs investigated was found in the gills; we identified 14, 15, and 17 genera in gills of C. japonicus, C. opilio, and Chionoecetes sp. respectively. Nine or fewer genera were identified in the other organs (Figures 1B and S1).
Figure 1

Stacked bar graphs of each phylum of three species of snow crabs (A), and isolates from each internal organ (B) in the three crab species.

Isolates from snow crab were predominantly Acinetobacter spp. (Figure S1b), Pseudomonas spp. (Figure S1a), Bacillus spp. (Figure S1d), and Stenotrophomonas spp. (Figure S1e), which collectively accounted for approximately 84% of the isolates (n = 186). Forty-six isolates from C. japonicus included either Acinetobacter spp. (Figure S1b), Agreia spp. (Figure S1f), Bacillus spp. (Figure S1d), or Psychrobacter spp. (Figure S1f), whereas 60% of isolates (n = 57) from Chionoecetes sp. were affiliated with Agreia spp., Agrococcus spp. (Figure S1g), Bacillus spp., Microbacterium spp. (Figure S1g), and Rhodococcus spp. (Figure S1g). Bacillus spp. were common in all three species of snow crabs. Pseudomonas spp. (n = 68 isolates) were predominantly found in C. opilio, while only three and two bacterial species were isolated from the other two Chionoecetes spp. (Figures 1 and S1a). Acinetobacter spp. were predominant in C. opilio and C. japonicus (53 and 18 isolates, respectively), and only one bacterial isolate was found in Chionoecetes sp. (Figures 1 and S1b). Stenotrophomonas spp. dominated in C. opilio (62 isolates), while only one bacterial species from this genus was isolated from each of C. japonicus and Chionoecetes sp. (Figures 1 and S1c). Numbers of Bacillus spp. isolated included nine from C. opilio, nine from C. japonicus, and 26 from Chionoecetes sp. (Figures 1 and S1d). In C. opilio, 67% (nine isolates) of Bacillus spp. were localized in the heart, while 33% (nine isolates) were found in the gill and carapace in C. japonicus. Bacillus spp. from Chionoecetes sp. were found in the carapace juices and heart (26% and 30% of 26 isolates respectively). Some bacterial isolates were confined to particular parts of Chionoecetes. Some isolates were not amplified using 16S rRNA gene sequencing; therefore, Rhodotorula (one strain) and Pichia (three strains) were identified from the gills of Chionoecetes sp. using ITS gene sequencing.

Enumeration of total cultivable bacteria

As shown in Figure 2, aerobic bacteria counts numbered from 103 to 105 cells/g in gills and from 102 to 103 cells/g in carapace meat in the three snow crab species on TSA, R2A, MA, and NA media, whereas no aerobic bacteria or other prokaryotes appeared on YPD or PDA media (Figures 2A and 2B). In comparison with the other organs, gills of the three crab species contained relatively high aerobic bacterial populations (up to 105) on TSA, R2A, MA and NA (Figures 2A and 2C).
Figure 2

Enumeration of total cultivable snow crab-dwelling bacteria at each site, in each crab species.

Snow crab gill-dwelling bacteria on four different solid media (A), carapace meat-dwelling bacteria (B), total colony counts of bacteria at each site in each snow crab on Marine Agar media (C). D: guts; J: carapace juices; G: gills; H: heart; LS: leg meat; S: carapace meat.

Enumeration of total cultivable snow crab-dwelling bacteria at each site, in each crab species.

Snow crab gill-dwelling bacteria on four different solid media (A), carapace meat-dwelling bacteria (B), total colony counts of bacteria at each site in each snow crab on Marine Agar media (C). D: guts; J: carapace juices; G: gills; H: heart; LS: leg meat; S: carapace meat.

Enumeration of antibiotic-resistant bacteria

More than 50% of the 221 C. opilio isolates were resistant to ampicillin, erythromycin, penicillin, ticarcillin, and vancomycin. Isolates from C. japonicus and Chionoecetes sp. were resistant to the nine antibiotics tested, representing a 15% and 30% resistance ratio respectively (Figure 3 and Table 2). In C. opilio, Pseudomonas, Acinetobacter, Enterobacter, Psychrobacter, Stenotrophomonas, and Lactobacillus spp. were resistant to the nine antibiotics tested (19 isolates); Pseudomonas, Acinetobacter, and Stenotrophomonas spp. were resistant to seven or eight of the nine antibiotics (12 isolates; Figures S1a, S1b, S1c and Table 2). The MDR bacteria identified in our study were affiliated with Agreia and Psychrobacter; two isolates from C. japonicus (red-tanner crab; Figure S1f and Table 2) and nine genera (14 isolates) from Chionoecetes sp. were affiliated with Shewanella, Rhodococcus, Agrococcus, Leifsonia, Deinococcus, Staphylococcus, and Agreia bacteria, and with Rhodotorula and Pichia yeasts (Figure S1g and Table 2).
Figure 3

Antibiotic resistance rates to nine different antibiotics in three species of snow crab.

Am: ampicillin; C: chloramphenicol; E: erythromycin; P: penicillin; RA: rifampicin; K: kanamycin; Te: tetracycline; Tic: ticarcillin; Va: vancomycin.

Table 2

The media used to isolate bacterial strains displayed the relationship of multidrug resistance (MDR) in bacteria from snow crab.

Medium
Snow CrabTaxaPhylaNA1) YPD2) PDA3) R2A4) TSA5) MA6)
Pseudomonas 1 (1)# 1 (0)5 (2)
Acinetobacter 6 (6)4 (3)
Stenotrophomonas 1 (1)1 (0)7 (1)
C. opilio Psychrobacter γ7) (GN)11) 1 (1)
(19/31)* Enterobacter 1 (1)
Leclercia 1 (1)
Lactobacillus B8)(GP)12) 1 (1)1 (1)
C. japonicus Salinibacter A9) (GP)1 (1)
(2/2) Psychrobacter γ (GN)1 (1)
Agrococcus 2 (2)
Salinibacter A (GP)1 (1)1 (1)1 (1)
Chionoecetes sp. Rhodococcus 2 (2)1 (1)
(14/14) Deinococcus D10) (GP)1 (1)
Staphylococcus B (GP)1 (1)
Shewanella γ (GN)1 (1)
Pichia Yeast1 (1)1 (1)
Rhodotorula Yeast1 (1)

(Numbers of nine antibiotic-resistant bacteria among more than seven antibiotic-resistant bacteria).

Parentheses indicated all resistant bacteria to tested nine antibiotics.

NA : Nutrient Agar,

YPD : Yeast Extract Peptone Dextrose,

PDA : Potato Dextrose Agar.

R2A Agar : Reasoner's 2A agar,

TSA ; Tryptic Soy Agar,

MA : Marine Agar.

γ : gamma Proteobacteria,

B : Bacilli,

A : Actinobacteria,

D : Deinococcus,

GN : gram-negative bacteria,

GP : gram-positive bacteria.

Antibiotic resistance rates to nine different antibiotics in three species of snow crab.

Am: ampicillin; C: chloramphenicol; E: erythromycin; P: penicillin; RA: rifampicin; K: kanamycin; Te: tetracycline; Tic: ticarcillin; Va: vancomycin. (Numbers of nine antibiotic-resistant bacteria among more than seven antibiotic-resistant bacteria). Parentheses indicated all resistant bacteria to tested nine antibiotics. NA : Nutrient Agar, YPD : Yeast Extract Peptone Dextrose, PDA : Potato Dextrose Agar. R2A Agar : Reasoner's 2A agar, TSA ; Tryptic Soy Agar, MA : Marine Agar. γ : gamma Proteobacteria, B : Bacilli, A : Actinobacteria, D : Deinococcus, GN : gram-negative bacteria, GP : gram-positive bacteria.

Phylogenetic distribution

Phylogenetic analysis revealed that isolates within Pseudomonas and Stenotrophomonas were grouped separately, representing 66 and 62 isolates from C. opilio (snow crab, C), while two and three isolates from C. japonicus (red-tanner crab, CJ) and Chionoecetes sp. (Neodo-Daege, B) were represented (Figures S1a and S1c). For Acinetobacter spp., 49, 14, and one isolate were found in C. opilio, C. japonicus, and Chionoecetes sp., respectively (Figure S1b). In C. japonicus three clusters formed with high similarly to A. johnsonii DSM 6963, A. haemolyticus DSM 6962, and A. guillouiae ATCC 11171 (Figure S1b). Up to 26 Bacillus spp. were isolated from Chionoecetes sp. and nine Bacillus spp. isolates were found in each of C. opilio and C. japonicus (Figure S1d). These isolates showed similarity with several comparative groups, suggesting that the relationship between the species of Chionoecetes and the isolated Bacillus spp. was not strong (Figure S1d). Other actinobacteria were found in Chionoecetes sp. and C. japonicus (34 and 21 isolates, respectively). Interestingly, 10 isolates of Salinibacterium from C. japonicus were clustered together (Figures S1f and S1g). Isolates from Chionoecetes sp. were affiliated with Microbacterium (eight isolates), Rhodococcus (nine isolates), and Deinococcus (two isolates; Figure S1g). Proteobacterial taxa were affiliated with 16 isolates of γ-proteobacteria from a total of 17 isolates from C. japonicus (Figure S1f). Isolates from C. opilio were affiliated with α- (seven isolates), β- (five isolates), and γ-proteobacteria (nine isolates; Figure S1e). Bacteroidetes taxa from C. japonicus were affiliated with Flavobacterium (two isolates) and Chryseobacterium (one isolate) in Chionoecetes sp. Bacilli, excluding the Bacillus, were isolated from C. opilio (five isolates), C. japonicas (five isolates), and Chionoecetes sp. (six isolates). Specifically, Exiguobacterium was isolated from C. japonicus (Figure S1f).

PCR detection of antibiotic resistance genes

We tested the antibiotic multiresistant bacteria, i.e., Acinetobacter spp., Leclercia sp., Pseudomonas spp., Stenotrophomonas spp., Lactobacillus spp., and Bacillus sp. for the detection of antibiotic resistance genes, i.e., bla, bla, and bla as ampicillin resistance genes; catA1, catA2, catA3, and catB3 as chloramphenicol resistance genes; ermA, ermB, and mefA genes as erythromycin resistance genes; pbp2a as penicillin resistance gene; aphA-3 as kanamycin resistance genes; tetA, tetB, tetC, and tetG as tetracycline resistance genes; and vanA and vanB as vancomycin resistance genes. The catA1 gene was detected in all the tested bacteria. However, resistance genes against ampicillin, erythromycin, penicillin, and kanamycin were not found in the tested bacterial isolates. Interestingly, Leclercia sp. possessed catB and Pseudomonas sp. possessed tetB. Vancomycin resistance gene, vanB was detected in Pseudomonas spp. and Stenotrophomonas spp (Table 3). Sequencing analysis of the PCR products showed that the sequences of catA1 gene were identical, with 100% nucleotide homology in the tested isolates except for the gene of Leclercia spp. The catA1 sequence of Acinetobacter sp. C-G-MA6 (AB826491) and Pseudomonas sp. C-D-MA7 (AB826493) showed that the gene represented 99% and 100% nucleotide identity to an antibiotic resistance gene of Klebsiella pneumonia subsp. pneumonia KPX plasmid pKPX-1 DNA. Moreover, amino acid sequences translated from the nucleotide sequences of the PCR products showed 100% identity with the amino acid sequence of chloramphenicol acetyltransferase. This result indicates that catA1 gene is derived from the chloramphenicol resistance gene detected in several pathogenic bacteria.
Table 3

The specific resistance of the multidrug resistance (MDR) bacterial strains.

IsolatesGeneraGroupResistance phenotypePCR detection
C-D-PYD4 Acinetobacter GN1) Am, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-G-MA6 Acinetobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van catA1
C-G-MA4 Acinetobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-G-PYD9 Acinetobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-J-PYD3 Acinetobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-LS-MA1 Acinetobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-LS-PYD3 Acinetobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-S-PYD1 Acinetobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van catA1
C-S-PYD3 Acinetobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-S-MA2 Acinetobacter GNAm, Chl, Em, Pen, Tet, Tc, Van
C-G-MA1 Leclercia GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van catA1, catB
C-D-MA4 Pseudomonas GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van catA1, tetB
C-LS-PYD4 Pseudomonas GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van catA1
C-LS-MA4 Pseudomonas GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C. opilio C-S-MA1 Pseudomonas GNAm, Chl, Em, Pen, Rif, Tet, Tc, Van
C-S-MA7 Pseudomonas GNAm, Chl, Em, Pen, Rif, Tet, Tc, Van
C-D-MA7 Pseudomonas GNAm, Chl, Em, Pen, Rif, Tet, Tc, Van catA1, vanB
C-D-TSA1 Pseudomonas GNAm, Chl, Em, Pen, Rif, Te, Van
C-G-MA5 Stenotrophomonas GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van catA1, vanB
C-S-PYD2 Stenotrophomonas GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van catA1
C-LS-MA2 Stenotrophomonas GNAm, Em, Pen, Km, Tet, Tc, Van
C-LS-MA5 Stenotrophomonas GNAm, Em, Pen, Km, Tet, Tc, Van
C-LS-MA7 Stenotrophomonas GNAm, Em, Pen, Km, Tet, Tc, Van
C-J-MA2 Stenotrophomonas GNAm, Em, Pen, Km, Tet, Tc, Van
C-J-MA5 Stenotrophomonas GNAm, Em, Pen, Km, Tet, Tc, Van
C-G-MA2 Stenotrophomonas GNAm, Em, Pen, Km, Tet, Tc, Van catA1
C-S-PDA4 Stenotrophomonas GNAm, Em, Pen, Km, Tet, Tc, Van
C-J-MA7 Enterobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-G-MA3 Psychrobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-G-TSA3 Lactobacillus GP2) Am, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
C-LS-PDA4 Lactobacillus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van catA1
C. japonicus CJ-G-NA9 Salinibacterium GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
CJ-S-NA3 Psychrobacter GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-NA3 Rhodococcus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-NA8 Rhodococcus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-R2A1 Rhodococcus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-R2A7 Rhodococcus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-NA4 Agrococcus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-NA10 Agrococcus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
Chionoecetes sp. B-G-NA5 Leifsonia GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-R2A5 Leifsonia GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-NA11 Deinococcus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-R2A2 Staphylococcus GPAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-TSA8 Shewanella GNAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-NA7 Pichia YeastAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-PYD12 Pichia YeastAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van
B-G-TSA1 Rhodotorula YeastAm, Chl, Em, Pen, Rif, Km, Tet, Tc, Van

GN : Gram negative bacteria,

GP : Gram positive bacteria,

Abbreviations used: Am, ampicilline; Chl, chloramphenicol; Em, erythromycin; Pen, penicillin; Rif, rifampicin; Km, kanamycin;

Tet, tetracycline; Tc, ticarcillin; Van, vancomycin.

The underline indicates tested isolates for detection of MDR genes by PCR.

GN : gram-negative bacteria, GP : gram-positive bacteria.

GN : Gram negative bacteria, GP : Gram positive bacteria, Abbreviations used: Am, ampicilline; Chl, chloramphenicol; Em, erythromycin; Pen, penicillin; Rif, rifampicin; Km, kanamycin; Tet, tetracycline; Tc, ticarcillin; Van, vancomycin. The underline indicates tested isolates for detection of MDR genes by PCR. GN : gram-negative bacteria, GP : gram-positive bacteria.

Nucleotide sequence accession numbers

All sequences were deposited in GenBank under the following accession numbers: HM755454–HM755674 (C. opilio), HM584223–HM584298 (C. japonicus), HM629343–HM629422, and HM588762–HM588765 (Chionoecetes sp.).

Discussion

Until recently, the study of Chionoecetes was conducted mainly by artificial cultivation for the examination of disease [23], [24]. In contrast, the present study was performed to characterize the types of microbiota within Chionoecetes, as little is known about microbial dynamics within Chionoecetes [23], [24]. In this study, we provided ratios of antibiotic resistance and microbial community distribution in three Chionoecetes species. Our results indicate that future microbial studies of Chionoecetes in their natural ecosystems are necessary to assess and monitor potential human risk. This study revealed four genera prevalent in Chionoecetes: Pseudomonas, Acinetobacter, Stenotrophomonas, and Bacillus (Figure S1). Microbial diversity was high in the gills of C. opilio (Figure 2C). Schuwerack et al. [25] reported that bacterial colonies enmeshed in polysaccharide-like films produced indentations in the gill cuticular surfaces and dissociation of microvillus membranes at the basal zone of epithelial cells of gill lamellae of the fresh crab Potamonautes warren. The yeasts Rhodotorula and Pichia, which were identified from Chionoecetes sp. Rhodotorula, Cryptococcus, Torulopsis, Candida, Trichosporon, and Aureobasidium, have previously been isolated from the meat of Dungeness (Cancer magister) and King crabs (Paralithodes camtschatica) [26]. The discovery of yeast in C. opilio in the present study, as well as in Dungeness and King crabs [26], suggests that future ecological studies of yeast populations will be necessary as well. While several studies show conclusively that antibiotic resistance is a natural phenomenon that predates the modern selective pressures of clinical antibiotics and agricultural use of antibiotics [27]–[33], human activity has probably increased the prevalence of MDR bacteria in air, soil, and marine and freshwater ecosystems. Most antibiotic resistance genes are acquired through horizontal gene transfer [8]. In this study, MDR bacteria from Chionoecetes demonstrated antibiotic resistance in nonclinical environments, suggesting an ecological role for antibiotics that warrants additional investigation. Some Bacillus spp. (e.g., Bacillus cereus) are ubiquitous in nature and constitute a major portion of the microbial populations in contaminated food, causing food spoilage and poisoning to the detriment of the consumers [34]. Two Bacillus species are considered medically significant: B. anthracis, which causes anthrax, and B. cereus, which causes a food-borne illness [34]. Because we found Bacillus spp. in all Chionoecetes, the incidence and survival of Bacillus spp. is thought to be controlled by cooking Chionoecetes at high temperatures prior to consumption. In terms of antibiotic-resistant Acinetobacter spp., the bacteria were found in C. opilio and C. japonicus; infections generally occur in hospitalized patients with weakened immune systems. Therefore, understanding antibiotic resistance in C. opilio isolates is clinically important for cases involving multidrug resistance (MDR) [35]. In this study, 54 isolates of Acinetobacter spp. were isolated from C. opilio, more than 60% of which were resistant to at least one of the antibiotics tested. Antibiotic resistance was high not only for the dominant Pseudomonas, Acinetobacter, and Stenotrophomonas (γ-proteobacteria), but was also high regardless of whether bacterial strains were gram negative or gram positive. γ-Proteobacteria demonstrated high antibiotic resistance to isolates from C. opilio, while the actinobacteria of Chionoecetes sp. were resistant to all of the nine antibiotics tested (Table 2). Here, we revealed that actinobacteria were commonly isolated from Chionoecetes sp., including many multidrug-resistant strains (Table 2). Moreover, clinical reports of secondary urinary or respiratory infections by Pseudomonas and Enterobacter spp. have been presented [36], [37]. While isolates of snow crabs rarely infect respiratory organs or the skin, proper heating of food prepared from Chionoecetes must be ensured in order to protect against infection. Similar results for MDR bacteria have been observed in shrimp [38]–[40], chicken [41]–[43], fruit [42], vegetables [42], pork [42], [43], salad [44], drinking water [45], fish [46]–[48], and fish farms [49], [50]. These commonalities also suggest that MDR bacteria should be investigated from many samples following standard methods described by the National Committee for Clinical Laboratory Standardization [51]. It is also necessary to replicate studies of microbiota and the inhibition zone diameter. The results of the present genetic study showed that the catA1 gene is widespread in many bacteria (Table 3). These data indicated that this gene moved between species via horizontal gene transfer. However, whether the multiresistance of the bacteria could be derived from intrinsic characteristics of bacteria or from unknown mechanisms (e.g., uncharacterized specific genes and dissemination through unknown transposable elements) is an open question. Therefore, we suggest that further studies are necessary to elucidate whether the resistance gene of snow crabs is intrinsic or arises from horizontal gene transfer between the environmental and pathogenic resistomes. Additional research is required to determine how resistance genes become incorporated into a range of bacteria species. In the future, it is essential that the implications of MDR for human consumption of snow crabs be entirely understood and that the penetration of antibiotic resistance into natural environments be prevented. In summary, we revealed for the first time a high level of microbial infiltration or inclusion in the internal organs of three Chionoecetes species. In addition, we isolated 381 microbial strains from three species of Chionoecetes spp.; unexpectedly, microbes with antibiotic resistance are widely distributed throughout the internal organs of wild, commercial snow crabs. In the future, additional research on antibiotic resistance and its mechanism and on microbial dynamics in the fishery industry will enhance further understanding of the clinical and ecological implications of these results. Phylogenetic tree of dominant bacteria in three species of snow crab. (a): Pseudomonas spp., (b): Acinetobacter spp., (c): Stenotrophomonas spp., (d): Bacillus spp., (e): the other of C. opilio, (f): the other of C. japonicus crab, (g): Chionoecetes sp. Bootstrap values represent the percentage of 1,000 replicates. Box indicates resistance to more than seven antibiotics. Dark star symbol (★) in boxes indicates resistance against tested nine antibiotics, light star symbol (☆) against eight antibiotics, and box without symbol against seven antibiotics. C: Chionoecetes opilio, CJ: C. japonicus, B: Chionoecetes sp. (TIF) Click here for additional data file.
  38 in total

1.  Pathological and physiological changes in the South African freshwater crab Potamonautes warreni calman induced by microbial gill infestations.

Authors:  P M Schuwerack; J W Lewis; P W Jones
Journal:  J Invertebr Pathol       Date:  2001-05       Impact factor: 2.841

2.  Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.

Authors:  T Z DeSantis; P Hugenholtz; N Larsen; M Rojas; E L Brodie; K Keller; T Huber; D Dalevi; P Hu; G L Andersen
Journal:  Appl Environ Microbiol       Date:  2006-07       Impact factor: 4.792

3.  Mobilization of a Tn402-like class 1 integron with a novel cassette array via flanking miniature inverted-repeat transposable element-like structures.

Authors:  Michael R Gillings; Maurizio Labbate; Ammara Sajjad; Nellie J Giguère; Marita P Holley; H W Stokes
Journal:  Appl Environ Microbiol       Date:  2009-07-31       Impact factor: 4.792

4.  Prevalence of antibiotic resistance genes in the bacterial flora of integrated fish farming environments of Pakistan and Tanzania.

Authors:  Syed Q A Shah; Duncan J Colquhoun; Hamisi L Nikuli; Henning Sørum
Journal:  Environ Sci Technol       Date:  2012-08-09       Impact factor: 9.028

5.  The neighbor-joining method: a new method for reconstructing phylogenetic trees.

Authors:  N Saitou; M Nei
Journal:  Mol Biol Evol       Date:  1987-07       Impact factor: 16.240

6.  Occurrence and Multiple Antibiotic Resistance Profiles of Non-fermentative Gram-Negative Microflora in Five Brands of Non-carbonated French Bottled Spring Water.

Authors: 
Journal:  Microb Ecol       Date:  2000-05       Impact factor: 4.552

7.  Major trends in the microbial etiology of nosocomial infection.

Authors:  D R Schaberg; D H Culver; R P Gaynes
Journal:  Am J Med       Date:  1991-09-16       Impact factor: 4.965

8.  Complete sequences of six penicillin-binding protein genes from 40 Streptococcus pneumoniae clinical isolates collected in Japan.

Authors:  Yumiko Sanbongi; Takashi Ida; Midori Ishikawa; Yumi Osaki; Hiroshi Kataoka; Takahisa Suzuki; Kumiko Kondo; Fukuichi Ohsawa; Minoru Yonezawa
Journal:  Antimicrob Agents Chemother       Date:  2004-06       Impact factor: 5.191

9.  NAST: a multiple sequence alignment server for comparative analysis of 16S rRNA genes.

Authors:  T Z DeSantis; P Hugenholtz; K Keller; E L Brodie; N Larsen; Y M Piceno; R Phan; G L Andersen
Journal:  Nucleic Acids Res       Date:  2006-07-01       Impact factor: 16.971

10.  Genotyping of erythromycin resistant group C & G streptococci isolated in Chennai, south India.

Authors:  D Prabu; Thangam Menon
Journal:  Indian J Med Res       Date:  2013-01       Impact factor: 2.375

View more
  11 in total

1.  Antibiotic multiresistance analysis of mesophilic and psychrotrophic Pseudomonas spp. isolated from goat and lamb slaughterhouse surfaces throughout the meat production process.

Authors:  Leyre Lavilla Lerma; Nabil Benomar; María del Carmen Casado Muñoz; Antonio Gálvez; Hikmate Abriouel
Journal:  Appl Environ Microbiol       Date:  2014-08-29       Impact factor: 4.792

2.  Horizontal transfer of vanA between probiotic Enterococcus faecium and Enterococcus faecalis in fermented soybean meal and in digestive tract of growing pigs.

Authors:  Ning Li; Haitao Yu; Hongbin Liu; Yuming Wang; Junyan Zhou; Xi Ma; Zheng Wang; Chengtao Sun; Shiyan Qiao
Journal:  J Anim Sci Biotechnol       Date:  2019-04-12

3.  Molecular detection and analysis of virulence genes in multi-drug resistant Escherichia coli from infected broilers.

Authors:  Kazi Faizul Azim; Saneya Risa Somana; Md Kamrul Hasan; Md Javed Foysal; Md Hazrat Ali; Tanjia Afrin Chowdhury; Md Nazmul Hossain
Journal:  Vet Res Forum       Date:  2021-12-15       Impact factor: 0.950

4.  Prevalence and antimicrobial susceptibility of Vibrio parahaemolyticus isolated from retail shrimps in Malaysia.

Authors:  Vengadesh Letchumanan; Wai-Fong Yin; Learn-Han Lee; Kok-Gan Chan
Journal:  Front Microbiol       Date:  2015-01-30       Impact factor: 5.640

Review 5.  Insights into Bacteriophage Application in Controlling Vibrio Species.

Authors:  Vengadesh Letchumanan; Kok-Gan Chan; Priyia Pusparajah; Surasak Saokaew; Acharaporn Duangjai; Bey-Hing Goh; Nurul-Syakima Ab Mutalib; Learn-Han Lee
Journal:  Front Microbiol       Date:  2016-07-19       Impact factor: 5.640

6.  Discovery on Antibiotic Resistance Patterns of Vibrio parahaemolyticus in Selangor Reveals Carbapenemase Producing Vibrio parahaemolyticus in Marine and Freshwater Fish.

Authors:  Learn-Han Lee; Nurul-Syakima Ab Mutalib; Jodi Woan-Fei Law; Sunny Hei Wong; Vengadesh Letchumanan
Journal:  Front Microbiol       Date:  2018-10-25       Impact factor: 5.640

Review 7.  An insight of traditional plasmid curing in Vibrio species.

Authors:  Vengadesh Letchumanan; Kok-Gan Chan; Learn-Han Lee
Journal:  Front Microbiol       Date:  2015-07-17       Impact factor: 5.640

8.  Draft Genome Sequence of Agreia bicolorata Strain AC-1804, a Producer of Large Amounts of Carotenoid Pigments, Isolated from Narrow Reed Grass Infected by the Phytoparasitic Nematode.

Authors:  Ilya Vasilyev; Maria Siniagina; Sergey Malanin; Eugenia Boulygina; Tatiana Grygoryeva; Dina Yarullina; Olga Ilinskaya
Journal:  Genome Announc       Date:  2015-12-03

Review 9.  Vibrio Pathogens: A Public Health Concern in Rural Water Resources in Sub-Saharan Africa.

Authors:  Charles A Osunla; Anthony I Okoh
Journal:  Int J Environ Res Public Health       Date:  2017-10-07       Impact factor: 3.390

10.  Phylogenetic affiliation and determination of bioactive compounds of bacterial population associated with organs of mud crab, Scylla olivacea.

Authors:  Joanne Zote; Ajit Kumar Passari; Chandra Nayaka Siddaiah; Nachimuthu Senthil Kumar; Elsayed Fathi Abd Allah; Abeer Hashem; Abdulaziz A Alqarawi; Jahangir Ahmad Malik; Bhim Pratap Singh
Journal:  Saudi J Biol Sci       Date:  2018-08-27       Impact factor: 4.219

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.