| Literature DB >> 25688239 |
Vengadesh Letchumanan1, Wai-Fong Yin2, Learn-Han Lee3, Kok-Gan Chan2.
Abstract
Vibrio parahaemolyticus is a marine and estuarine bacterium that has been the leading cause of foodborne outbreaks which leads to a significant threat to human health worldwide. Consumption of seafood contaminated with V. parahaemolyticus causes acute gastroenteritis in individuals. The bacterium poses two main virulence factor including the thermostable direct hemolysin (tdh) which is a pore-forming protein that contributes to the invasiveness of the bacterium in humans and TDH-related hemolysin (trh), which plays a similar role as tdh in the disease pathogenesis. This study aimed to investigate the antimicrobial resistance V. parahaemolyticus strains in shrimps purchased from wetmarkets and supermarkets. The toxR-based PCR assay indicated that a total of 57.8% (185/320) isolates were positive for V. parahaemolyticus. Only 10% (19/185) toxR-positive isolate exhibit the trh gene and none of the isolates were tested positive for tdh. The MAR index was measured for 14 common antimicrobial agents. The results indicated 98% of the isolates were highly susceptible to imipenem, ampicillin sulbactam (96%), chloramphenicol (95%), trimethoprim-sulfamethoxazole (93%), gentamicin (85%), levofloxacin (83%), and tetracycline (82%). The chloramphenicol (catA2) and kanamycin (aphA-3) resistance genes were detected in the resistant V. parahaemolyticus isolates. Our results demonstrate that shrimps are contaminated with V. parahaemolyticus, some of which carry the trh-gene thus being potential to cause food borne illness. The occurrence of multidrug resistance strains in the environment could be an indication of excessive usage of antibiotics in agriculture and aquaculture fields.Entities:
Keywords: MAR index; Vibrio parahaemolyticus; antimicrobial; food borne; virulence factors
Year: 2015 PMID: 25688239 PMCID: PMC4311705 DOI: 10.3389/fmicb.2015.00033
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Polymerase chain reaction (PCR) primers targeting antibiotic resistant gene.
| Antibiotics | Targetgene | Sequence 5′-3′ | Amplicon size (bp) |
|---|---|---|---|
| Ampicillin | FW- TTATCTCCCTGTTAGCCACC | 796 | |
| FW- ACCAGATTCAACTTTCAA | 589 | ||
| FW- ATAAAATTCTTGAAGAC | 1073 | ||
| Chloram phenicol | FW- CGCCTGATGAATGCTCATCCG | 456 | |
| FW- ATGAATTTTACCAGAATTGATCTGAA | 639 | ||
| FW- AAATTGGGTTCGCCGTGA | 1863 | ||
| FW- TCAAAGGCAAGCTGCTTTCTGAGC | 566 | ||
| Kanamycin | FW- GGGACCACCTATGATGTGGAACG | 600 | |
| Tetracycline | FW- GTAATTCTGAGCACTGTCGC | 956 | |
| FW- ACGTTACTCGATGCCAT | 1169 | ||
| FW- AACAATGCGCTCATCGT | 1138 | ||
| FW- CCGGTCTTATGGGTGCTCTA | 603 |
Total Vibrio densities (log cfu/mL) in shrimp.
| Type of sample | Total | |||||
|---|---|---|---|---|---|---|
| Wetmarket A | Wetmarket B | Wetmarket C | Supermarket A | Supermarket B | Supermarket C | |
| Banana Prawn | 6.24 | 5.04 | 5.16 | 4.36 | 4.40 | 4.21 |
| Red Prawn | 6.34 | 5.04 | 5.19 | 4.43 | 4.35 | 4.36 |
List of trh-positive Vibrio parahaemolyticus isolates.
| Strains | Shrimp species | Location | ||
|---|---|---|---|---|
| VP89 | Red Prawn | Supermarket C | + | + |
| VP90 | Red prawn | Supermarket C | + | + |
| VP91 | Red prawn | Supermarket C | + | + |
| VP92 | Red prawn | Supermarket C | + | + |
| VP93 | Banana prawn | Wetmarket A | + | + |
| VP94 | Banana prawn | Wetmarket A | + | + |
| VP95 | Banana prawn | Wetmarket A | + | + |
| VP96 | Banana prawn | Wetmarket A | + | + |
| VP97 | Banana prawn | Wetmarket A | + | + |
| VP98 | Banana prawn | Wetmarket A | + | + |
| VP99 | Banana prawn | Wetmarket A | + | + |
| VP100 | Banana prawn | Wetmarket A | + | + |
| VP101 | Banana prawn | Wetmarket A | + | + |
| VP102 | Banana prawn | Wetmarket A | + | + |
| VP103 | Banana prawn | Wetmarket A | + | + |
| VP175 | Banana prawn | Supermarket C | + | + |
| VP176 | Banana prawn | Supermarket C | + | + |
| VP177 | Banana prawn | Supermarket C | + | + |
| VP178 | Banana prawn | Supermarket C | + | + |
The percentage of antibiotic resistant of V. parahaemolyticus isolated from shrimp.
| Antimicrobial agent | No of Isolates (* %) | |||||
|---|---|---|---|---|---|---|
| Red prawn | Banana prawn | Total isolates for each antimicrobial (** %) | ||||
| Wetmarket ( | Supermarket ( | Wetmarket ( | Supermarket ( | |||
| Ampicillin | 45 (69) | 32 (100) | 35 (95) | 39 (76) | 151 (82) | |
| Ampicillin/sulbactam | 0 (0) | 0 (0) | 0 (0) | 3 (6) | 3 (2) | |
| Amikacin | 20 (31) | 17 (53) | 22 (6) | 36 (71) | 95 (51) | |
| Cefotaxime | 13 (20) | 12 (38) | 9 (24) | 35 (68) | 69 (37) | |
| Ceftazidime | 0 (0) | 1 (3) | 2 (5) | 25 (49) | 28 (15) | |
| Chloramphenicol | 0 (0) | 5 (16) | 1 (3) | 2 (4) | 8 (4) | |
| Gentamicin | 0 (0) | 1 (3) | 0 (0) | 20 (39) | 21 (11) | |
| Imipenem | 0 (0) | 1 (3) | 1 (3) | 2 (4) | 4 (2) | |
| Kanamycin | 3 (5) | 5 (16) | 12 (32) | 32 (63) | 52 (28) | |
| Levofloxacin | 0 (0) | 0 (0) | 0 (0) | 17 (33) | 17 (9) | |
| Nalidixic acid | 0 (0) | 0 (0) | 0 (0) | 35 (68) | 35 (19) | |
| Oxytetracycline | 3 (5) | 7 (22) | 3 (8) | 22 (43) | 35 (19) | |
| Sulfamethoxazole /trimethoprim | 0 (0) | 0 (0) | 1 (3) | 6 (12) | 7 (4) | |
| Tetracycline | 3 (5) | 3 (9) | 5 (14) | 20 (39) | 31 (17) | |
Antibiograms and multiple antimicrobial resistance (MAR) indices of V. parahaemolyticus strains.
| Antibiograms | Strains | Total antibiotic resistance | MAR index |
|---|---|---|---|
| AK/AMP/CAZ/CN/CTX/K/NA/OT/SAM/SXT/TE | VP152 | 11 | 0.79 |
| AK/AMP/CAZ/CN/CTX/K/LEV/ NA/OT/TE | VP134, VP135, VP139 | 10 | 0.71 |
| AK/AMP/CAZ/CN/CTX/K/NA/OT/SXT/TE | VP158 | 10 | 0.71 |
| AK/CAZ/CN/CTX/K/LEV/NA/OT/TE | VP136 | 9 | 0.64 |
| AK/C/CAZ/CN/CTX/K/NA/OT/TE | VP160 | 9 | 0.64 |
| AK/AMP/CAZ/CN/CTX/K/NA/ SAM | VP142 | 8 | 0.57 |
| AK/AMP/CAZ/CTX/CN/K/OT/TE | VP153 | 8 | 0.57 |
| AK/AMP/CAZ/CN/CTX/K/LEV/ NA | VP165 | 8 | 0.57 |
| AK/CAZ/CN/CTX/K/LEV/NA/SXT | VP174 | 8 | 0.57 |
| AK/CAZ/CN/CTX/K/NA/OT/TE | VP162 | 8 | 0.57 |
| AK/AMP/C/CAZ/CN/K/NA/ SXT | VP158 | 8 | 0.57 |
| AK/AMP/K/LEV/NA/OT/TE | VP130 | 7 | 0.5 |
| AK/AMP/CAZ/CN/CTX/K/NA | VP163 | 7 | 0.5 |
| AK/AMP/CTX/LEV/NA/OT/TE | VP137, VP167 | 7 | 0.5 |
| AK/AMP/CAZ/CN/K/NA/OT | VP138 | 7 | 0.5 |
| AK/AMP/CTX/K/IMP/OT | VP71 | 6 | 0.43 |
| AK/CAZ/CN/CTX/K/NA | VP132, VP133, VP140, VP141, VP143 | 6 | 0.43 |
| AMP/IPM/LEV/NA/OT/TE | VP145,VP146 | 6 | 0.43 |
| AK/AMP/CAZ/CTX/K/NA | VP151 | 6 | 0.43 |
| AK/AMP/CAZ/CTX/K/SAM | VP157 | 6 | 0.43 |
| AK/CAZ/CTX/K/NA/SXT | VP161 | 6 | 0.43 |
| AK/AMP/CTX/K/LEV/NA | VP166, VP169 | 6 | 0.43 |
| AMP/CTX/NA/OT/SXT/TE | VP170 | 6 | 0.43 |
| AK/AMP/CAZ/CTX/K | VP102, VP103, VP148 | 5 | 0.36 |
| AMP/LEV/NA/OT/TE | VP131 | 5 | 0.36 |
| CAZ/CTX/K/NA/OT | VP168 | 5 | 0.36 |
| AMP/CTX/NA/OT/TE | VP173 | 5 | 0.36 |
| AK/AMP/C/OT/TE | VP183 | 5 | 0.36 |
| AMP/CTX/OT/TE | VP159 | 4 | 0.29 |
| AK/AMP/CAZ/CTX | VP90 | 4 | 0.29 |
| AK/AMP/K/SXT | VP119 | 4 | 0.29 |
| AK/AMP/OT/TE | VP125 | 4 | 0.29 |
| AMP/NA/OT/TE | VP129 | 4 | 0.29 |
| LEV/NA/OT/TE | VP144 | 4 | 0.29 |
| AK/AMP/LEV/NA | VP171 | 4 | 0.29 |
| AK/AMP/CTX/K | VP73, VP77, VP82, VP95, VP104, VP117, VP149, VP154, VP156 | 4 | 0.29 |
| AK/AMP/K/CN | VP84 | 4 | 0.29 |
| AK/AMP/CTX | VP21, VP30, VP52, VP54, VP64, VP70, VP78, VP87, VP88, VP89, VP91, VP111, VP126 | 3 | 0.21 |
| AK/AMP/K | VP55, VP93, VP101, VP110, VP118, VP123, VP128, VP150 | 3 | 0.21 |
| AMP/OT/TE | VP59, VP72, VP74, VP108, VP120 | 3 | 0.21 |
| AMP/CTX/K | VP43 | 3 | 0.21 |
| AK/AMP/IMP | VP114 | 3 | 0.21 |
| AMP/C/CTX | VP182 | 3 | 0.21 |
| AMP/C/OT | VP179, VP180, VP181 | 3 | 0.21 |
| AMP/LEV/NA | VP172 | 3 | 0.21 |
| C/OT/TE | VP184 | 3 | 0.21 |
| AMP/TE | VP2, VP105 | 2 | 0.14 |
| OT/TE | VP5 | 2 | 0.14 |
| AMP/K | VP12 | 2 | 0.14 |
| AMP/CTX | VP28, VP29, VP46, VP50, VP99, VP127, VP147, VP175, | 2 | 0.14 |
| AK/AMP | VP31, VP34, VP41, VP45, VP46, VP57, VP60, VP61, VP63, VP66, VP79, VP83, VP85, VP107, VP109, VP112, VP113, VP121, VP124, VP178 | 2 | 0.14 |
| AK/CTX | VP42, VP44 | 2 | 0.14 |
| AMP | VP6, VP7, VP8, VP9, VP10, VP11, VP16, VP18, VP19, VP20, VP22, VP25, VP27, VP32, VP33, VP35, VP37, VP38, VP48, VP51, VP53, VP58, VP62, VP67, VP68, VP69, VP75, VP76, VP80, VP81, VP86, VP92, VP94, VP96, VP97, VP100, VP106, VP115, VP116, VP122, VP155, VP164, VP176, VP177 | 1 | 0.07 |
| AK | VP47, VP49 | 1 | 0.07 |
| CTX | VP23, VP26, VP40 | 1 | 0.07 |