Literature DB >> 23890153

Purple Acid Phosphatase5 is required for maintaining basal resistance against Pseudomonas syringae in Arabidopsis.

Sridhar Ravichandran, Sophia L Stone, Bernhard Benkel, Balakrishnan Prithiviraj.   

Abstract

BACKGROUND: Plants have evolved an array of constitutive and inducible defense strategies to restrict pathogen ingress. However, some pathogens still manage to invade plants and impair growth and productivity. Previous studies have revealed several key regulators of defense responses, and efforts have been made to use this information to develop disease resistant crop plants. These efforts are often hampered by the complexity of defense signaling pathways. To further elucidate the complexity of defense responses, we screened a population of T-DNA mutants in Colombia-0 background that displayed altered defense responses to virulent Pseudomonas syringae pv. tomato DC3000 (Pst DC3000).
RESULTS: In this study, we demonstrated that the Arabidopsis Purple Acid Phosphatse5 (PAP5) gene, induced under prolonged phosphate (Pi) starvation, is required for maintaining basal resistance to certain pathogens. The expression of PAP5 was distinctly induced only under prolonged Pi starvation and during the early stage of Pst DC3000 infection (6 h.p.i). T-DNA tagged mutant pap5 displayed enhanced susceptibility to the virulent bacterial pathogen Pst DC3000. The pap5 mutation greatly reduced the expression of pathogen inducible gene PR1 compared to wild-type plants. Similarly, other defense related genes including ICS1 and PDF1.2 were impaired in pap5 plants. Moreover, application of BTH (an analog of SA) restored PR1 expression in pap5 plants.
CONCLUSION: Taken together, our results demonstrate the requirement of PAP5 for maintaining basal resistance against Pst DC3000. Furthermore, our results provide evidence that PAP5 acts upstream of SA accumulation to regulate the expression of other defense responsive genes. We also provide the first experimental evidence indicating the role PAP5 in plant defense responses.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23890153      PMCID: PMC3751912          DOI: 10.1186/1471-2229-13-107

Source DB:  PubMed          Journal:  BMC Plant Biol        ISSN: 1471-2229            Impact factor:   4.215


Background

Plants are continuously exposed to a diverse array of microorganisms including beneficial mutualists, commensals, and pathogens. To defend against pathogens, plants have evolved an innate immune system to recognize and limit infection (reviewed in [1,2]). Activation of defense responses involves the initial recognition of pathogens by chemical cues (elicitors) or Pathogen Associated Molecular Patterns (PAMPs) that include bacterial lipopolysaccharides, flagellin, fungal chitin and ergosterol [3,4]. Recognition of PAMP by specific Pattern Recognition Receptors (PRRs) in the plasma membrane leads to activation of defense responses in both non-host and basal disease resistance [5]. Activation of PRRs subsequently induces the calcium-dependent protein kinase (CDPK) and mitogen-activated protein kinase (MAPK) signaling pathways leading to rapid ion fluxes, followed by transcriptional activation of defense responsive genes and synthesis of antimicrobial compounds to restrict infection [6,7]. Primarily, regulation of plant defense responses is mediated through the phytohormones salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) [8,9]. However, in recent years other phytohormones including abscisic acid (ABA), auxins, gibberellins (GA), cytokines (CK) and brassinosteriods (BR) have been shown to mediate specific plant defense responses (reviewed in [2,10]). As plants are exposed to an array of pathogens with diverse infection strategies, activation of appropriate, pathogen-specific defense responses is vital for plant growth and productivity [11]. Plant pathogens are classified as biotrophs, necrotrophs or hemi-biotrophs based on their life style and infection strategy. Biotrophic pathogens live as obligate parasites that derive nutrients from living host tissues, while necrotrophs feed on dead tissues. Hemi-biotrophs behave as both biotroph and necrotroph depending on the stage of their life cycle [11]. Defense against biotrophs involves SA-dependent responses whereas necrotroph resistance is SA-independent relaying primarily on JA/ET-dependent pathways [9]. The SA signaling pathway is associated with transcriptional activation of pathogenesis related (PR) genes and the establishment of systemic acquired resistance (SAR) to provide enhanced, long lasting resistance to secondary infections [12,13]. By contrast, JA/ET signaling pathways are associated with resistance against necrotrophic pathogens and rhizobacteria-mediated induced systemic resistance (ISR), and are not typically associated with PR gene expression [12,14]. However, there are complex signaling and cross talk between the SA-dependent and SA-independent pathways [13]. Genetic screening of mutant plant populations has proved very useful for the functional analysis of defense responses [15-17]. In Arabidopsis, genetic screening has revealed a large number of mutants that exhibit altered responses to SA, JA and/or ET and are more susceptible to virulent pathogens [18]. Identification and characterization of enhanced disease susceptibility (eds) mutants, including a series of phytoalexin deficient (pad) mutants, have helped to elucidate a number of defense signaling pathways involved in both basal and induced defense responses [19-21]. Purple Acid Phosphatases (PAPs) belong to a family of binuclear metalloenzymes that exhibit diverse biological functions in plants, animals and bacterial species [22,23]. While the predominant role of PAPs in plants is regulation of Pi uptake, PAPs also contribute to other biological functions including peroxidation [24], ascorbate recycling [25], mediation of salt tolerance [26] and regulation of cell wall carbohydrate biosynthesis [27]. Plant PAPs share significant sequence similarity with mammalian tartarate-resistant acid phosphatases (TRAPs), which are involved in bone resorption [28], iron transport [29] and also in the generation of reactive oxygen species for microbial killing [30]. In humans, TRAP expression is restricted to activated macrophages where it aids in the generation of free radicals to enhance microbial killing [31]. Although numerous reports have emphasized the importance of PAPs in Pi acquisition, it has been difficult to assign a general physiological role to PAPs due to their diversity [32]. The Arabidopsis genome contains 29 PAP encoding genes [33]. Changes in PAP gene expression differs in response to Pi concentration where PAP11 and PAP12 are transcriptionally induced while PAP7-PAP10 and PAP13 remain unchanged in response to Pi deprivation [33]. Kaffarnik and colleagues first reported the accumulation of PAP10 and a decrease in the abundance of PAP14 in the secretome of Arabidopsis cell culture following P. syringae infection, suggesting a role for PAPs in the host defense response [34]. Recently, Li et al., (2012) also provided the evidence that some soybean PAPs (GmPAPs) are involved in symbiosis under Pi starved conditions. PAPs carry predicted signal peptides and presumably are secreted, however the biological function of these proteins in the extracellular space is unknown [34]. Here we provide evidence that the Arabidopsis PAP5 is involved in basal resistance against certain plant pathogens. PAP5 mutant plants exhibited enhanced susceptibility to virulent isolate of Pseudomonas syringae pv. tomato DC3000. In addition, expression of defense related genes following Pst DC3000 infection were impaired in pap5 plants.

Results

Identification of mutants exhibiting altered defense responses

One thousand two hundred unique Arabidopsis thaliana (ecotype Col-0) T-DNA insertion lines were spray inoculated with the virulent isolate of Pseudomonas syringae pv. tomato DC3000 (Pst DC3000) and monitored for altered responses to the pathogen. Mutants exhibiting extensive chlorosis in comparison to wild-type plants, scored by visual examination, were designated as susceptible. Mutants exhibiting reduced chlorosis compared to wild type (Col-0) were designated resistant to Pst DC3000. T-DNA insertion lines were also tested for altered root colonization with the plant growth promoting rhizobacterial isolate Pseudomonas putida WCS358. Selected T-DNA lines were retested for response to Pst DC3000. A total of 24 T-DNA insertion lines exhibited either altered disease susceptibility, root colonization or both compared to wild-type plants (data not shown). The mutant line salk_126152C (pap5-1), which exhibited enhanced susceptibility to Pst DC3000 with extensive chlorosis on leaf tissues, was selected for further analysis (Figure  1A). Salk_126152C carried a T-DNA insertion in the gene coding for Purple Acid Phosphatase5 (PAP5; At1G52940) (Genome-Wide Insertional Mutagenesis of Arabidopsis thaliana, 2003). The enhanced susceptibility phenotype of pap5-1 plants was confirmed by assessing bacterial growth in leaf tissues post inoculation. As shown in Figure  1B, pap5-1 plants had greater titers of bacteria at 48 and 72 hours post inoculation (h.p.i) compared to the wild-type plant. To ensure that the altered responses to the pathogen were caused by disruption of the PAP5 gene and not by an unlinked mutation, a second knockout mutant line salk_081481C (pap5-2), carrying a T-DNA insertion on PAP5 (At1g52940), was tested. pap5-2 plants also exhibited the extensive chlorosis and higher titer of bacteria similar to that of in pap5-1 plants (Additional file 1: Figure S1).
Figure 1

plants exhibit enhanced susceptibility to DC3000. A, Phenotype of pap5-1 plants exhibiting extensive chlorosis and enhanced susceptibility to Pst DC3000. Plants were spray inoculated with 108 c.f.u ml–l and photographed after 5 days of inoculation. B, Growth of virulent Pst DC3000 in wild type (Col-0) and pap5-1 leaves. Plants were spray inoculated with Pst DC3000 (108 c.f.u ml–l) and bacterial growth in plant apoplast was determined as described in the materials and methods. The bars represent the mean and standard deviation from values of six to eight replicate samples. The experiment was repeated three times with similar results. An asterisk indicates significance (Student’s t-test; P < 0.05).

plants exhibit enhanced susceptibility to DC3000. A, Phenotype of pap5-1 plants exhibiting extensive chlorosis and enhanced susceptibility to Pst DC3000. Plants were spray inoculated with 108 c.f.u ml–l and photographed after 5 days of inoculation. B, Growth of virulent Pst DC3000 in wild type (Col-0) and pap5-1 leaves. Plants were spray inoculated with Pst DC3000 (108 c.f.u ml–l) and bacterial growth in plant apoplast was determined as described in the materials and methods. The bars represent the mean and standard deviation from values of six to eight replicate samples. The experiment was repeated three times with similar results. An asterisk indicates significance (Student’s t-test; P < 0.05).

Further characterization of pap5-1 mutant plants

Genotyping via polymerase chain reaction (PCR) confirmed that pap5-1 (salk_126152C) carries a T-DNA insertion within the first intron (Figure  2A and 2B). To determine the impact of T-DNA insertion on transcript levels of PAP5, Reverse Transcription-quantitative PCR (RT-qPCR) was performed using gene specific primers (Figure  2A). Most PAPs are reported to be highly inducible under phosphate starvation (Pi). In our experiments, we did not observe an induction of PAP5 in wild-type seedlings grown in the presence of phosphate (1.25 mM) or under phosphate starved conditions for 5 days (-Pi, 0 mM) (data not shown). We also observed that the expression of PAP5 under optimal growing conditions was very low and this was confirmed with PAP5 expression profile in the comprehensive microarray site https://www.genevestigator.com/gv/ (Additional file 2: Figure S2). Interestingly, we observed a marked increase in the expression PAP5 when wild type seedlings were grown under prolonged phosphate starvation (Figure  2C). For prolonged Pi starvation wild-type seedlings were germinated in media containing reduced Pi (0.25 mM) for seven days and then transferred to media with no Pi (0 mM). After 9 days the seedlings were harvested for gene expression analysis. RT-qPCR analysis revealed a ~30 fold increase in transcript levels of PAP5 in wild-type seedlings grown under prolonged phosphate starvation (-Pi) compared to seedlings grown in the presence of phosphate (+Pi) (Figure  2C). The expression of PAP5 was not induced in both pap5-1 (Figure  2C) and pap5-2 (Additional file 3: Figure S3B) seedlings grown under prolonged phosphate starvation (-Pi). We did not observe any major alteration in germination, growth and development of pap5 mutant plants compared to wild-type under optimal growth conditions (data not shown).
Figure 2

Validation of T-DNA insertion in plants. A, Schematic representation of AtPAP5 (At1G52940); white boxes and solid lines represent exons and introns. T-DNA insertion is represented with a grey arrow and the solid arrows represent the primers used for genotyping and quantitative RT-qPCR. B, Location of the T-DNA insertion and homozygosity of pap5-1 was confirmed by PCR using the gDNA from wild-type and pap5-1 plants (M, 100 bp marker). A 30 cycle PCR reactions was performed with the primer pairs indicated. C, Relative expression of PAP5 transcripts in response to prolonged Pi starvation; For prolonged Pi starvation wild type and pap5-1 seedlings were germinated and grown in 0.5X MS media containing reduced Pi (0.25 mM). After seven days the seedlings were washed with sterile water and transferred to 0.5X MS with no Pi (0 mM). After 9 days the seedlings were harvested for gene expression analysis. Total RNA was extracted from wild-type and pap5-1 plants as described in Methods. Transcript levels of PAP5 was normalized to the expression of GAPDH in the same samples and expressed relative to the normalized transcript levels of Pi starved wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Asterisks represents data sets significantly different from the wild-type data sets (P < 0.05 using one-tailed Student’s t-test).

Validation of T-DNA insertion in plants. A, Schematic representation of AtPAP5 (At1G52940); white boxes and solid lines represent exons and introns. T-DNA insertion is represented with a grey arrow and the solid arrows represent the primers used for genotyping and quantitative RT-qPCR. B, Location of the T-DNA insertion and homozygosity of pap5-1 was confirmed by PCR using the gDNA from wild-type and pap5-1 plants (M, 100 bp marker). A 30 cycle PCR reactions was performed with the primer pairs indicated. C, Relative expression of PAP5 transcripts in response to prolonged Pi starvation; For prolonged Pi starvation wild type and pap5-1 seedlings were germinated and grown in 0.5X MS media containing reduced Pi (0.25 mM). After seven days the seedlings were washed with sterile water and transferred to 0.5X MS with no Pi (0 mM). After 9 days the seedlings were harvested for gene expression analysis. Total RNA was extracted from wild-type and pap5-1 plants as described in Methods. Transcript levels of PAP5 was normalized to the expression of GAPDH in the same samples and expressed relative to the normalized transcript levels of Pi starved wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Asterisks represents data sets significantly different from the wild-type data sets (P < 0.05 using one-tailed Student’s t-test).

Mutation in PAP5 alters expression of host defense responsive genes and ROS production

To explore the enhanced susceptibility of pap5-1 plants and to determine the role of PAP5 in host defense responses, plants were spray inoculated with virulent isolate of Pst DC3000 (108 c.f.u ml–l) and the transcript abundances of selected defense responsive genes, including the pathogenesis-related gene1 (PR1), were determined. Infection of wild-type plants with the virulent isolate Pst DC3000 resulted in ~10-fold induction of the PR1 transcript 24 h.p.i, while an increase of only ~2-fold was observed in pap5-1 plants (Figure  3). The level of PR1 transcripts in pap5-1 plants following Pst DC3000 infection was variable at 48 h.p.i. However, the expression of PR1 was a still less induced in pap5-1 plants compared to wild-type (Figure  3). Expression of isochorismate synthase1 (ICS1) was induced in wild-type plants (~2-fold) while no increase in transcript levels was observed in pap5-1 plants. Although, expression of plant defensin1.2 (PDF1.2) was induced (~2-fold higher) in wild-type plants, expression of PDF1.2 was suppressed in pap5-1 plants (Figure  4A). The expression pattern of these pathogenesis related genes were also confirmed using Actin as the internal control (Additional file 4: Figure S4).
Figure 3

Expression of in wild-type and plants after DC3000 infection. Transcript levels of PR1 in wild-type and pap5-1 plants were quantified after spray inoculation with virulent Pst DC3000 (108 c.f.u ml–l). Total RNA was extracted from leaf tissues sampled 24 and 48 h.p.i. Transcript levels were normalized to the expression of GAPDH in the same samples. The transcript levels were expressed relative to the normalized transcript levels of mock infected wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Significant differences (P < 0.05) are indicated by different letters.

Figure 4

Expression of and in wild-type and plants after DC3000 infection. Transcript levels of ICS1, PDF1.2 and PAP5 in wild-type and pap5-1 plants were quantified after spray inoculation with virulent Pst DC3000 (108 c.f.u ml –l). A, Expression ICS1 and PDF1.2 following Pst DC3000 infection. Total RNA was extracted from leaf tissues sampled at 24 h.p.i. Transcript levels were normalized to the expression of GAPDH in the same samples. The transcript levels were expressed relative to mock infected wild-type plants. B, Expression of PAP5 following Pst DC3000 infection. Total RNA was extracted from leaf tissues 6 h.p.i. Transcript levels were normalized to the expression of GAPDH in the same samples and expressed relative to transcript levels of infected wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Significant differences (P<0.05) are indicated by different letters. Asterisks indicate significant difference in transcript levels compared to wild-type (Students t-test; P<0.05).

Expression of in wild-type and plants after DC3000 infection. Transcript levels of PR1 in wild-type and pap5-1 plants were quantified after spray inoculation with virulent Pst DC3000 (108 c.f.u ml–l). Total RNA was extracted from leaf tissues sampled 24 and 48 h.p.i. Transcript levels were normalized to the expression of GAPDH in the same samples. The transcript levels were expressed relative to the normalized transcript levels of mock infected wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Significant differences (P < 0.05) are indicated by different letters. Expression of and in wild-type and plants after DC3000 infection. Transcript levels of ICS1, PDF1.2 and PAP5 in wild-type and pap5-1 plants were quantified after spray inoculation with virulent Pst DC3000 (108 c.f.u ml –l). A, Expression ICS1 and PDF1.2 following Pst DC3000 infection. Total RNA was extracted from leaf tissues sampled at 24 h.p.i. Transcript levels were normalized to the expression of GAPDH in the same samples. The transcript levels were expressed relative to mock infected wild-type plants. B, Expression of PAP5 following Pst DC3000 infection. Total RNA was extracted from leaf tissues 6 h.p.i. Transcript levels were normalized to the expression of GAPDH in the same samples and expressed relative to transcript levels of infected wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Significant differences (P<0.05) are indicated by different letters. Asterisks indicate significant difference in transcript levels compared to wild-type (Students t-test; P<0.05). A marked increase in the expression of PAP5 at 6 h.p.i was observed in wild-type plants (Figure  4B). However, this difference did not prolong to 24 and 48 h.p.i. We did not observe induction of PAP5 in mock infected or Pst DC3000 inoculated pap5-1 plants (Figure  4B). The expression profile of PAP5 was further verified from the comprehensive microarray site http://bar.utoronto.ca/ using Arabidopsis eFP Browser (Additional file 5: Figure S5) [35]. Although, PAP5 was strongly induced only at 6 h.p.i, our results suggest that this level of PAP5 is required for maintaining resistance against virulent Pst DC3000. To further explore the mechanism of enhanced susceptibility, we studied hydrogen peroxide (H2O2) accumulation using 3-3’-Diaminobenzidine (DAB) staining. As shown in Figure  5A, accumulation of H2O2 in response to Pst DC3000 was reduced in pap5-1 leaves at 24 and 48 h.p.i. In contrast, there was an accumulation of H2O2 in the wild-type plants. The H2O2 concentration was quantified in leaf tissues following Pst DC3000 infection. The wild-type plants accumulated a higher concentration of H2O2 in response to Pst DC3000 inoculation as compared to pap5-1 plants (Figure  5B).
Figure 5

plants accumulate reduced HOin response to DC3000 infection. A, Histochemical detection of H2O2 accumulation using DAB staining. Wild-type and pap5-1 leaves were excised following Pst DC3000 infection and stained with DAB for hydrogen peroxide. B, Quantification of H2O2 following Pst DC3000 infection. The bars represent mean and SD of H2O2 accumulation. Asterisks represent significant difference in H2O2 production compared to wild type (Student’s t-test; P < 0.05).

plants accumulate reduced HOin response to DC3000 infection. A, Histochemical detection of H2O2 accumulation using DAB staining. Wild-type and pap5-1 leaves were excised following Pst DC3000 infection and stained with DAB for hydrogen peroxide. B, Quantification of H2O2 following Pst DC3000 infection. The bars represent mean and SD of H2O2 accumulation. Asterisks represent significant difference in H2O2 production compared to wild type (Student’s t-test; P < 0.05).

Resistance to Botrytis cinerea is affected in pap5 plants

Having demonstrated the enhanced susceptibility of pap5-1 plants to the hemi-biotrophic pathogen Pst DC3000, we next tested the level of resistance of pap5-1 plants to the necrotrophic pathogen Botrytis cinerea. Four week old plants were inoculated with spore suspension of B. cinerea and lesion size was measured three days later. As shown in Figure  6A, pap5-1 plants developed a significantly larger lesion (5.4 ± 0.3 mm) than the wild-type (3.9 ± 0.2 mm). The greater lesion size on pap5-1 plants in response to B. cinerea infection, suggests the role of PAP5 are important in limiting fungal growth.
Figure 6

Lesion development and induction of following infection. A, Size of lesion in wild type and pap5-1 plants inoculated after B. cinerea infection. Leaves were inoculated by placing 5 μl of the B. cinerea spore suspension (1 × 105/ml) on either side of the mid vein and the lesion size was measured after 3 days. The bars represent mean and SD of 20 individual lesions. Asterisks represent significant difference in lesion size compared to wild-type (Student’s t-test; P < 0.05). B, PAP5 expression in response to B. cinerea infection. Leaf tissues were harvested 48 h.p.i for RNA extraction. Transcript levels of PAP5 were normalized to the expression of GAPDH in the same samples. The transcript levels were expressed relative to the normalized transcript levels of infected wild-type plants.

Lesion development and induction of following infection. A, Size of lesion in wild type and pap5-1 plants inoculated after B. cinerea infection. Leaves were inoculated by placing 5 μl of the B. cinerea spore suspension (1 × 105/ml) on either side of the mid vein and the lesion size was measured after 3 days. The bars represent mean and SD of 20 individual lesions. Asterisks represent significant difference in lesion size compared to wild-type (Student’s t-test; P < 0.05). B, PAP5 expression in response to B. cinerea infection. Leaf tissues were harvested 48 h.p.i for RNA extraction. Transcript levels of PAP5 were normalized to the expression of GAPDH in the same samples. The transcript levels were expressed relative to the normalized transcript levels of infected wild-type plants. To identify the role of PAP5 in the resistance against B. cinerea, we assessed the transcript abundance of PR1 and PDF1.2. As shown in Figure  7A, B. cinerea strongly induced the expression of PR1 in both wild-type and pap5. In contrast, the level of the PDF1.2 transcript at 24 h.p.i was only half of that observed in wild-type plants (Figure  7B). By 48 h.p.i., however, the transcript levels of PDF1.2 were similar in both wild-type and pap5-1 plants. Similarly, we did not observe any significant differences in PAP5 transcripts with B. cinerea infection (Figure  6B).
Figure 7

Induction of and in response to . A, Expression PR1 in response to B. cinerea infection. B, expression of PDF1.2 in response to B. cinerea infection. Plants were spray inoculated with spore suspension of B. cinerea (1 × 105) and leaf tissues were harvested for total RNA extraction. Transcript levels of PR1 and PDF1.2 was normalized to the expression of GAPDH in the same samples and expressed relative to the normalized transcript levels of mock infected wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Asterisks indicate significant difference in transcript levels compared to wild-type (Students t-test; P < 0.05). Induction of PR1 and PDF1.2 in response to Botrytis cinerea infection.

Induction of and in response to . A, Expression PR1 in response to B. cinerea infection. B, expression of PDF1.2 in response to B. cinerea infection. Plants were spray inoculated with spore suspension of B. cinerea (1 × 105) and leaf tissues were harvested for total RNA extraction. Transcript levels of PR1 and PDF1.2 was normalized to the expression of GAPDH in the same samples and expressed relative to the normalized transcript levels of mock infected wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Asterisks indicate significant difference in transcript levels compared to wild-type (Students t-test; P < 0.05). Induction of PR1 and PDF1.2 in response to Botrytis cinerea infection.

Responses to exogenous application of BTH, a salicylic acid analog and methyl jasmonate (MJ) is unaffected in pap5 plants

Since pap5-1 plants exhibited enhanced susceptibility to Pst DC3000 and B. cinerea, we investigated the role of PAP5 in responses to BTH and MJ. Exogenous application of BTH induced higher levels of PR1 in wild-type and pap5-1 (Figure  8A). We also observed a slightly higher increase in the expression PR1 in pap5-1 plants 24 h after BTH treatment. Similarly, application of MJ strongly induced the expression of PDF1.2 in both wild-type and pap5-1 plants. We did not observe significant differences in expression of PDF1.2 between wild-type and pap5-1 plants following application of MJ (Figure  8B). Application of BTH and JA induced expression of PR1 and PDF1.2, respectively, indicative of an intact JA signaling pathway in pap5 plants. Based on these experiments it was clear that pap5-1 plant was not defective in responding to exogenously applied BTH or MJ.
Figure 8

Induction of and following exogenous application of benzothiozidole and methyl jasmonate. A, Expression PR1 in response to benzothiozidole (BTH) treatment. B, expression of PDF1.2 in response to methyl jasmonate treatment. Plants were spray treated with either or 0.06% of Actigard® (Active ingradient: 50% w/w benzothiozidole) or 50 μM methyl jasmonate. Leaf tissues were harvested after 24 of spraying for total RNA extraction. Transcript levels of PDF1.2 and PR1 were normalized to the expression of GAPDH in the same samples and expressed relative to the normalized transcript levels of mock treated wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Asterisks indicate significant difference in transcript levels compared to wild-type (Students t-test; P < 0.05).

Induction of and following exogenous application of benzothiozidole and methyl jasmonate. A, Expression PR1 in response to benzothiozidole (BTH) treatment. B, expression of PDF1.2 in response to methyl jasmonate treatment. Plants were spray treated with either or 0.06% of Actigard® (Active ingradient: 50% w/w benzothiozidole) or 50 μM methyl jasmonate. Leaf tissues were harvested after 24 of spraying for total RNA extraction. Transcript levels of PDF1.2 and PR1 were normalized to the expression of GAPDH in the same samples and expressed relative to the normalized transcript levels of mock treated wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Asterisks indicate significant difference in transcript levels compared to wild-type (Students t-test; P < 0.05).

Discussion

In this study, we demonstrated the role of PAP5, a phosphate responsive gene, and its requirement in maintaining basal disease resistance against virulent Pst DC3000. In previous studies PAP5 transcripts were not detectable under phosphate starvation [36]. Unlike PAP12 and PAP26, PAP5 is not abundantly expressed under normal phosphate starvation conditions. Our results revealed that PAP5 is expressed only under prolonged Pi starvation (Figure  2C). Mutation in PAP26 has been shown to impair growth and increase anthocyanin accumulation in response to Pi starvation [37]. Despite the loss of PAP5 expression, mutant plants did not show discrete phenotypic differences from that of wild-type plants. Both wild-type and pap5-1 plants exhibited an increased root/shoot ratio under Pi starvation (data not shown). This finding also indicates that PAP5 does not play a major role in Pi acquisition and is more likely to regulate other functions. The Arabidopsis genome contains 29 PAP encoding genes [33] and this may lead to functional redundancy. This study suggests that the loss of PAP5 resulted in impairment of defense responsive genes in response to Pst DC3000 infection. Further, it appears that other PAP genes does not compensate for the loss of PAP5 function in response to pathogen attack. Genetic analyses of Arabidopsis mutants have revealed many key regulatory genes in plant defense responses. Enhanced disease susceptibility mutants including eds5, pad4, npr1 and sid2 have previously been reported to exhibit enhanced susceptibility and compromised defense responses to both virulent and avirulent isolates of Pst DC3000 [19,20,38]. It is also evident that most bacterial pathogens including Pst DC3000 are inoculated by pressure-infiltration to study plant-bacterial interactions. Although pressure-infiltration is the most commonly used inoculation method, these inoculation procedures may prevent early innate immune responses such as flagellin perception (FLS2 mediated resistance) [39] and stomatal closure [40]. Also FLS2 mediated resistance was effective only when Pst DC3000 was sprayed on the leaf surface and not when bacteria was infiltrated in to leaves [39]. Hence, to mimic natural infection and to focus on the early defense responses we sprayed plants with suspension of Pst DC3000 containing 108 c.f.u ml–l. We also observed that plants sprayed with 103 and 105 cells/ml-l developed reduced symptoms compared to plants sprayed with 108 cells (data not shown). Similar bacterial titers have been previously used for plant-bacterial interaction studies [39,40]. We observed that the expression of PR1 was slightly induced in pap5-1 plants following Pst DC3000 infection, however the relative transcript level of PR1 was several fold lower compared to wild-type (Figure  3). The PR1 transcripts at 48 h.p.i were slightly lower compared to wild-type (Figure  3). Similar variability has been observed in MPK6 silenced plants that were susceptible to Pst DC3000 [41]. We observed that PAP5 was strongly induced in the early stages of infection (6 h.p.i). This induction was transient as no difference was observed at 24 and 48 h.p.i. One possible explanation of this observation is that the level of PAP5 induced during the early stages (6 h.p.i) of infection could be sufficient to dephosphorylate signaling proteins required for activation of defense responses downstream of PAP5. Thus, it is also possible that PAP5 might be involved in early responses to pathogens similar to glutotione s-transferse (GST6) and glucosyltransferase [42]. Moreover, members of the PAP family have been known to exhibit peroxidase activity in addition to Pi acquisition and recycling [24,43]. Although, the role of PAP5 with regard to peroxidase activity has not been established, we hypothesize that the PAP5 might mediate generation of reactive oxygen species (ROS) during Pst DC3000 infection. ROS was initially proposed to be mediate plant defense response especially, during an incompatible interaction [44]. Virulent pathogens, capable of evading pathogen recognition are also known to induce ROS production at latter stages of infection to lower levels [1]. We also identified the importance in PAP5 in limiting the growth of the necrotrophic fungus, B. cinerea at the site of infection. The expression of PDF1.2 was strongly suppressed in pap5-1 plants at 24 h.p.i resulting in an increase in lesion size. There were no differences in PDF1.2 transcripts between pap5 and wild-type plants at 48 h.p.i. Similarly, eds4-1 plants have been reported to exhibit enhanced susceptibility to B. cinerea despite comparable expression of PR1 and PDF1.2 transcripts [45]. These results also suggest that defense responsive genes other than PR1 and PDF1.2 are required to mount wild-type levels of resistance against B. cinerea. SA synthesized in response to B. cinerea infection has reported to be derived via phenylalanine ammonia lyase (PAL) and not via isochorismate synthase (ICS) [46]. Since pap5-1 plants induced comparable levels of PR1 to wild-type plants following B. cinerea infection, it is possible that the effect of PAP5 is restricted to SA derived via ICS and not via PAL. Application of BTH and MJ in wild-type and pap5 plants induced expression of PR1 and PDF1.2, respectively (Figure  8A and 8B). These results also suggest that PAP5 is not required for expression of SA dependent PR1 expression. PR1 expression in pap5-1 plants appeared to be slightly higher than wild-type plants after of BTH treatment (Figure  8A). This slight increase in PR1 expression and its significance is unclear. Similarly, application of SA on pad4 plants showed a slight increase in PR1 expression [47]. Application of MJ induced the expression of PDF1.2, indicating the regulatory function of PAP5 to be upstream of SA and JA. Although, most plant PAPs are primarily associated with Pi absorption and recycling, PAPs induced under Pi starvation are also known to exhibit peroxidase activity similar to mammalian PAPs [24,48]. All mammalian PAPs characterized exist as monomers of ~35 kDa (Low Molecular Weight, LMW), while plants encode a relatively large family of High Molecular Weight (HMW) homodimeric and oligomeric PAPs (~45-74 kDa). However, a recent study has identified mammalian-like low molecular weight PAP (~34 kDa) from roots of Pi starved bean plants [32]. Moreover, the LMW, 35 kDa plant PAPs are reported to be closely related to the 35 kDa mammalian PAPs than to the large plant PAPs [49]. Thus, from our results we hypothesize that PAP5 could play a role in both Pi acquisition and in microbial killing during pathogenesis (Figure  9).
Figure 9

Model for role of PAP5 during DC3000 infection. When plants are infected with virulent Pst DC3000, PAP5 is required for activation of defense responsive genes including PR1 and ICS1. Recognition of Pst DC3000, induce expression of PAP5 only during the early stages of infection (6 h) and triggers ROS synthesis which subsequently activates other defense related signals down stream for complete resistance.

Model for role of PAP5 during DC3000 infection. When plants are infected with virulent Pst DC3000, PAP5 is required for activation of defense responsive genes including PR1 and ICS1. Recognition of Pst DC3000, induce expression of PAP5 only during the early stages of infection (6 h) and triggers ROS synthesis which subsequently activates other defense related signals down stream for complete resistance.

Conclusion

We identified the requirement of PAP5 for maintaining basal defense responses against virulent Pst DC3000, suggesting a role for PAP5 in pathogen triggered immunity (PTI). We further demonstrated that PAP5 acts upstream of SA to affect the expression of PR1, and levels of PAP5 do not affect BTH and JA perception. Further analysis on pap5 plants is likely to reveal novel components of signal transduction pathways that regulate defense responsive genes.

Methods

Biological materials and growth conditions

Arabidopsis thaliana (L.) Heynh, ecotype Columbia (Col-0) seed was purchased from Lehle seeds (Round Rock, TX, USA) and T-DNA insertion mutant lines were obtained from Arabidopsis Biological Resource Center (Columbus, OH, USA). Seeds were surface sterilized with NaOCl 2% (v/v), rinsed five times with sterile water and stratified at 4°C for 3 days. Seeds were planted either in Jiffy peat pellets (Halifax seeds, Canada) or on plates with 0.5X MS media [50]. Plants were grown at 22 ± 2°C with a photoperiod of 16 h light at 125 μmol m-2 s-1 and 8 h dark cycle. Virulent Pseudomonas syringae pv. tomato DC3000 (Pst DC3000) was kindly gifted by Dr. Diane Cuppels, Agriculture and Agri Food Canada (AAFC), ON, Canada. Pseudomonas syringae strain was maintained on King’s medium B supplemented with rifampicin (50 μg ml-l). Botrytis cinerea was cultured on modified King’s medium B (10 g peptone, 1.5 g potassium phosphate monobasic, 15 g dextrose, pH 5.5, 5 ml of 1 M MgSO4/l). For plant treatment, Benzothiozidole (Actigard®; active ingradient 50% w/v BTH) was a gift from Syngenta Corp., USA. Methyl jasmonate and other microbiological media were purchased from Sigma Aldrich, Oakville, Canada.

Mutant screening and pathogen inoculation

Genetic screen was performed on 4 to 5 week old plants by spray inoculation with bacterial suspension of virulent Pst DC3000. Plant inoculation and bacterial growth in plant apoplast was determined as described by [39]. In brief, strains of virulent Pseudomonas syringae pv. tomato DC3000 (Pst DC3000) was cultured in King’s medium B supplemented with rifampicin (50 μg ml-l) at 28°C until OD600 of 0.8. Bacterial cells were collected by centrifugation and resuspended in water containing 0.02% Silwet L-77 (Lehle seeds, USA) to a final concentration of 108 c.f.u ml -l. Plants (4-5 weeks old) were spray inoculated and kept under high humidity for disease development. Leaves were excised (8-10 replicates) from different infected plants and were surface sterilized with ethanol (75% v/v). Four to five samples were made by pooling 2 leaf discs (0.5 cm2) and the samples were ground in sterile water with microfuge tube pestle. The ground tissues were serially diluted and plated on King’s B medium containing rifampicin (50 μg/ml). The plates were incubated at 28°C and colonies were counter after 48 hours. For Pst DC3000 induced gene expression, plants were spray inoculated with bacterial suspension (108 c.f.u ml –l) and leaf tissues were frozen in liquid nitrogen at the time points indicated. For Botrytis cinerea (Bcr) inoculation, spore suspension (1 × 105 conidia mL-1) was prepared in potato dextrose broth (PDB) as described by [45]. Four to five week old plants were inoculated by placing 5 μl of the spore suspension on either side of the mid vein of fully expanded leaves. Inoculated plants were covered with a transparent plastic dome to maintain high humidity for disease development. For all gene expression analysis, leaf tissues were harvested from four individual plants for each biological replicate and were snap frozen in liquid nitrogen for RNA extraction. Benzothiozidole (BTH) and methyl jasmonate (MJ) treatments were performed by spraying 4-5 weeks old plants with solutions containing 0.06% w/v Actigard® (Active ingradient: 50% w/v BTH) or 50 μM methyl jasmonate (MJ) with 0.02% Silwet L-77.

Confirmation of T-DNA insertion

T-DNA insertion and homozygosity of mutant line salk_126152 was confirmed by PCR as described by [51] using AtPAP5 gene specific primers generated from SALK T-DNA verification primer design tool LP 5’-TTCACGGTTTTGTTGTTAGACG-3’, RP 5’-TCGTTGAAAACTACACTCGATTTAAC-3’ and left border primer LBb1.3 5’-ATTTTGCCGATTTCGGAAC-3’.

Phosphate starvation

Sterile, stratified seeds (20-25 per jar) were dispensed in 50 ml of liquid 0.5X MS medium containing Pi (1.25 mM) or with reduced Pi (0.25 mM). The seedlings were grown under constant shaking (85 rpm) at 22 ± 2°C under continuous illumination at 100 μmol m-2 s-1. After 9 days the seedlings were rinsed thrice with sterile distilled water and transferred to 0.5X MS medium containing + Pi (1.25 mM) or –Pi (0 mM) [52]. Plants were harvested after 11 days for RNA extraction. Whenever Pi was reduced from growth medium, equivalent amounts of sulphate salts were added to maintain the concentration of conjugate cations.

RNA extraction and quantitative Real-time PCR

Total RNA was extracted from frozen tissues using monophasic extraction method [53]. Reverse Transcription was performed with 2 μg of total RNA using Quantiscript RTase (Qiagen, ON, Canada). Relative transcript levels were assayed by Real-Time PCR using gene specific primers (Table  1) on StepOnePlus Real-Time PCR system (Applied Biosystems, ON, Canada) using SYBR Green reagent (Applied Biosystems, ON, Canada). To determine the relative expression levels, the amount of target gene was normalized over the abundance of constitutive Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or Actin as endogenous control. Primers were generated using the Roche Universal Probe Library assay design center.
Table 1

Primer sequences used in RT-qPCR experiments

GeneLocusPrimer sequences (5’-3’)
GAPDH
At1g13440
TTGGTGACAACAGGTCAAGCA
 
 
AAACTTGTCGCTCAATGCAATC
ICS1
At1g74710
GCGTCGTTCGGTTACAGG
 
 
ACAGCGAGGCTGAATATCAT
PAP5
At1g52940
AACAGGTCGCTCCACTAGACA
 
 
TGGTTAGAGGCATATGTTTGTCC
PDF1.2
At5g44420
GTTCTCTTTGCTGCTTTCGAC
 
 
GCAAACCCCTGACCATGT
PR1
At2g14610
TGATCCTCGTGGGAATTATGT
  TGCATGATCACATCATTACTTCAT
Primer sequences used in RT-qPCR experiments

DAB staining

To visualize H2O2 production in situ, plants were inoculated with suspension of Pst DC3000 as described in earlier section. Leaves were excised at 24 and 48 h.p.i and stained with 3-3 Diaminobenzidine (DAB) as described by [54]. Excised leaved were placed in DAB (1 mg/ml) solution for 8-12 hours and the tissues were soaked in ethanol (95%, v/v) to remove chlorophyll. For H2O2 quantification, the excised leaf tissues were frozen and ground with liquid nitrogen. To 50 mg of ground frozen tissue 500 μl of phosphate buffer (50 mM, sodium phosphate, pH-7.4) was added. The samples were centrifuged and 50 μl of the aliquot was used for H2O2 quantification using an Amplex red hydrogen peroxide/peroxidase assay kit (Molecular Probes, Life Technologies, Canada).

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

BP conceived the concept of genetic screening and designed all experiments. SR carried out all the experiments and prepared the manuscript. SLS critically evaluated all the experiments and significantly contributed to the manuscript preparation. BB helped with sequencing and contributed to evaluate the manuscript. All authors read and approved the final manuscript.

Additional file 1: Figure S1

Enhanced susceptibility of pap5-2 to Pst DC3000. A, Phenotype of pap5-2 plants exhibiting extensive chlorosis. Plants were spray inoculated with 108 c.f.u ml–l and photographed after 5 days of infection. B, Growth of virulent Pst DC3000 in wild type (Col-0) and pap5-2 mutant leaves. Plants were spray inoculated with Pst DC3000 (108 c.f.u ml–l) and bacterial growth in plant apoplast was determined. The bars represent the mean and standard deviation from values of six to eight replicate samples and the experiment was repeated two times with similar results. An asterisk indicates significant increase in Pst DC3000 growth compared to wild-type (Student’s t-test; P < 0.05). Click here for file

Additional file 2: Figure S2

Expression profile of PAP5 (array element 261341_s_at) in comparison to PR1 (array element 266385_at) from Genevestigator Expression Data. Click here for file

Additional file 3: Figure S3

Validation of T-DNA insertion in pap5-2 mutant plants. A, Schematic representation of AtPAP5 (At1G52940); white boxes and solid lines represent exons and introns. T-DNA insertion is represented with a grey arrow and the solid arrows represent the primers used for genotyping and quantitative RT-qPCR. B, Location of the T-DNA insertion and homozygosity of pap5-2 was confirmed by PCR using the gDNA from wild-type and pap5-2 plants (M, 100 bp marker). A 30 cycle PCR reactions was performed with the primer pairs indicated. C, Relative expression of PAP5 transcripts in response to Pi starvation; Total RNA was extracted from wild-type and pap5 plants as described in materials and methods. Transcript levels of PAP5 was normalized to the expression of GAPDH in the same samples and expressed relative to the normalized transcript levels of Pi supplemented wild-type plants. The bars represent the mean and standard deviation from two independent experiments. Asterisks represents data sets significantly different from the wild-type data sets (P < 0.05 using one-tailed Student’s t-test). Click here for file

Additional file 4: Figure S4

Expression of defense related genes in wild-type and pap5-1 mutant plants after Pst DC3000 infection. Transcript levels of PR1, ICS1, PDF1.2 and PAP5 in wild-type and pap5-1 plants were quantified after spray inoculation with virulent Pst DC3000 (108 c.f.u ml–l) was determined. Total RNA was extracted from leaf tissues harvested 24 h.p.i. Transcript levels were normalized to the expression of Actin in the same samples. The transcript levels were expressed relative to the normalized transcript levels of mock infected wild-type plants. The bars represent the mean and standard deviation. Significant differences (P < 0.05) are indicated by different letters. Click here for file

Additional file 5: Figure S5.

Expression profile of PAP5 (At1g52940) from the Arabidopsis eFP Browser. Click here for file
  52 in total

1.  Identification of mammalian-like purple acid phosphatases in a wide range of plants.

Authors:  G Schenk; L W Guddat; Y Ge; L E Carrington; D A Hume; S Hamilton; J de Jersey
Journal:  Gene       Date:  2000-05-30       Impact factor: 3.688

2.  Arabidopsis gp91phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response.

Authors:  Miguel Angel Torres; Jeffery L Dangl; Jonathan D G Jones
Journal:  Proc Natl Acad Sci U S A       Date:  2001-12-26       Impact factor: 11.205

3.  Purification and characterization of two secreted purple acid phosphatase isozymes from phosphate-starved tomato (Lycopersicon esculentum) cell cultures.

Authors:  Gale G Bozzo; Kashchandra G Raghothama; William C Plaxton
Journal:  Eur J Biochem       Date:  2002-12

4.  Biochemical and molecular characterization of AtPAP12 and AtPAP26: the predominant purple acid phosphatase isozymes secreted by phosphate-starved Arabidopsis thaliana.

Authors:  Hue T Tran; Weiqiang Qian; Brenden A Hurley; Yi-Min She; Daowen Wang; William C Plaxton
Journal:  Plant Cell Environ       Date:  2010-11       Impact factor: 7.228

5.  Differential effectiveness of salicylate-dependent and jasmonate/ethylene-dependent induced resistance in Arabidopsis.

Authors:  Jurriaan Ton; Johan A Van Pelt; L C Van Loon; Corné M J Pieterse
Journal:  Mol Plant Microbe Interact       Date:  2002-01       Impact factor: 4.171

6.  Purple acid phosphatases of Arabidopsis thaliana. Comparative analysis and differential regulation by phosphate deprivation.

Authors:  Dongping Li; Huifen Zhu; Kunfan Liu; Xin Liu; Georg Leggewie; Michael Udvardi; Daowen Wang
Journal:  J Biol Chem       Date:  2002-05-20       Impact factor: 5.157

7.  Phosphatase and oxygen radical-generating activities of mammalian purple acid phosphatase are functionally independent.

Authors:  Helena Kaija; Sari L Alatalo; Jussi M Halleen; Ylva Lindqvist; Gunter Schneider; H Kalervo Väänänen; Pirkko Vihko
Journal:  Biochem Biophys Res Commun       Date:  2002-03-22       Impact factor: 3.575

8.  Arabidopsis local resistance to Botrytis cinerea involves salicylic acid and camalexin and requires EDS4 and PAD2, but not SID2, EDS5 or PAD4.

Authors:  Simone Ferrari; Julia M Plotnikova; Giulia De Lorenzo; Frederick M Ausubel
Journal:  Plant J       Date:  2003-07       Impact factor: 6.417

9.  Genome-wide insertional mutagenesis of Arabidopsis thaliana.

Authors:  José M Alonso; Anna N Stepanova; Thomas J Leisse; Christopher J Kim; Huaming Chen; Paul Shinn; Denise K Stevenson; Justin Zimmerman; Pascual Barajas; Rosa Cheuk; Carmelita Gadrinab; Collen Heller; Albert Jeske; Eric Koesema; Cristina C Meyers; Holly Parker; Lance Prednis; Yasser Ansari; Nathan Choy; Hashim Deen; Michael Geralt; Nisha Hazari; Emily Hom; Meagan Karnes; Celene Mulholland; Ral Ndubaku; Ian Schmidt; Plinio Guzman; Laura Aguilar-Henonin; Markus Schmid; Detlef Weigel; David E Carter; Trudy Marchand; Eddy Risseeuw; Debra Brogden; Albana Zeko; William L Crosby; Charles C Berry; Joseph R Ecker
Journal:  Science       Date:  2003-08-01       Impact factor: 47.728

10.  GmPAP3, a novel purple acid phosphatase-like gene in soybean induced by NaCl stress but not phosphorus deficiency.

Authors:  Hong Liao; Fuk-Ling Wong; Tsui-Hung Phang; Ming-Yan Cheung; Wing-Yen Francisca Li; Guihua Shao; Xiaolong Yan; Hon-Ming Lam
Journal:  Gene       Date:  2003-10-30       Impact factor: 3.688

View more
  18 in total

1.  Proteomic analysis of the defense response of wheat to the powdery mildew fungus, Blumeria graminis f. sp. tritici.

Authors:  Md Siddikun Nabi Mandal; Ying Fu; Sheng Zhang; Wanquan Ji
Journal:  Protein J       Date:  2014-12       Impact factor: 2.371

2.  The Arabidopsis RNA-binding protein AtRGGA regulates tolerance to salt and drought stress.

Authors:  Alfredo Ambrosone; Giorgia Batelli; Roberta Nurcato; Vincenzo Aurilia; Paola Punzo; Dhinoth Kumar Bangarusamy; Ida Ruberti; Massimiliano Sassi; Antonietta Leone; Antonello Costa; Stefania Grillo
Journal:  Plant Physiol       Date:  2015-03-17       Impact factor: 8.340

3.  Molecular characterization of a tomato purple acid phosphatase during seed germination and seedling growth under phosphate stress.

Authors:  Pui Kit Suen; Siyi Zhang; Samuel Sai-Ming Sun
Journal:  Plant Cell Rep       Date:  2015-02-06       Impact factor: 4.570

4.  A Localized Pseudomonas syringae Infection Triggers Systemic Clock Responses in Arabidopsis.

Authors:  Zheng Li; Katia Bonaldi; Francisco Uribe; Jose L Pruneda-Paz
Journal:  Curr Biol       Date:  2018-02-01       Impact factor: 10.834

5.  Proteomic analysis of apoplastic fluid of Coffea arabica leaves highlights novel biomarkers for resistance against Hemileia vastatrix.

Authors:  Leonor Guerra-Guimarães; Rita Tenente; Carla Pinheiro; Inês Chaves; Maria do Céu Silva; Fernando M H Cardoso; Sébastien Planchon; Danielle R Barros; Jenny Renaut; Cândido P Ricardo
Journal:  Front Plant Sci       Date:  2015-06-30       Impact factor: 5.753

6.  Shared and tailored common bean transcriptomic responses to combined fusarium wilt and water deficit.

Authors:  Susana T Leitão; Carmen Santos; Susana de Sousa Araújo; Diego Rubiales; Maria Carlota Vaz Patto
Journal:  Hortic Res       Date:  2021-07-01       Impact factor: 6.793

7.  Temperature Differentially Influences the Capacity of Trichoderma Species to Induce Plant Defense Responses in Tomato Against Insect Pests.

Authors:  Ilaria Di Lelio; Mariangela Coppola; Ernesto Comite; Donata Molisso; Matteo Lorito; Sheridan Lois Woo; Francesco Pennacchio; Rosa Rao; Maria Cristina Digilio
Journal:  Front Plant Sci       Date:  2021-06-09       Impact factor: 5.753

8.  Optimal level of purple acid phosphatase5 is required for maintaining complete resistance to Pseudomonas syringae.

Authors:  Sridhar Ravichandran; Sophia L Stone; Bernhard Benkel; Junzeng Zhang; Fabrice Berrue; Balakrishnan Prithiviraj
Journal:  Front Plant Sci       Date:  2015-08-04       Impact factor: 5.753

9.  Comparative transcriptome profiling of a resistant vs. susceptible tomato (Solanum lycopersicum) cultivar in response to infection by tomato yellow leaf curl virus.

Authors:  Tianzi Chen; Yuanda Lv; Tongming Zhao; Nan Li; Yuwen Yang; Wengui Yu; Xin He; Tingli Liu; Baolong Zhang
Journal:  PLoS One       Date:  2013-11-18       Impact factor: 3.240

10.  Multiple Patterns of Regulation and Overexpression of a Ribonuclease-Like Pathogenesis-Related Protein Gene, OsPR10a, Conferring Disease Resistance in Rice and Arabidopsis.

Authors:  Li-Fen Huang; Kuan-Hung Lin; Siou-Luan He; Jyh-Lang Chen; Jian-Zhi Jiang; Bo-Hong Chen; Yi-Syuan Hou; Ruey-Shyang Chen; Chwan-Yang Hong; Shin-Lon Ho
Journal:  PLoS One       Date:  2016-06-03       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.