| Literature DB >> 23853517 |
Tomoko Hashida1, Ryoichi Nakatsuji, Holger Budahn, Otto Schrader, Herbert Peterka, Tatsuhito Fujimura, Nakao Kubo, Masashi Hirai.
Abstract
The radish displays great morphological variation but the genetic factors underlying this variability are mostly unknown. To identify quantitative trait loci (QTLs) controlling radish morphological traits, we cultivated 94 F4 and F5 recombinant inbred lines derived from a cross between the rat-tail radish and the Japanese radish cultivar 'Harufuku' inbred lines. Eight morphological traits (ovule and seed numbers per silique, plant shape, pubescence and root formation) were measured for investigation. We constructed a map composed of 322 markers with a total length of 673.6 cM. The linkage groups were assigned to the radish chromosomes using disomic rape-radish chromosome-addition lines. On the map, eight and 10 QTLs were identified in 2008 and 2009, respectively. The chromosome-linkage group correspondence, the sequence-specific markers and the QTLs detected here will provide useful information for further genetic studies and for selection during radish breeding programs.Entities:
Keywords: QTL; STS; chromosome assignment; linkage map; radish
Year: 2013 PMID: 23853517 PMCID: PMC3688384 DOI: 10.1270/jsbbs.63.218
Source DB: PubMed Journal: Breed Sci ISSN: 1344-7610 Impact factor: 2.086
List of traits analyzed and the phenotypic values of the F4 or F5 population and the parental lines
| Trait | Abbreviation | Year | Mean (±SD) in RIL | Range in RIL | Mean (±SD) in rat-tail radish | Mean (±SD) in Haru-S |
|---|---|---|---|---|---|---|
| Ovule number per silique | 2008 | 9.93 ± 2.07 | 5.00–16.25 | 9.40 ± 0.80 | 6.60 ± 0.49 | |
| Seed number per silique | 2008 | 3.09 ± 1.00 | 1.14–5.55 | N.D. | 3.04 ± 1.51 | |
| Plant shape | 2008 | 3.1 ± 0.8 | 1–5 | 5 | 1 | |
| 2009 | 3.2 ± 0.7 | 1–5 | 5 | 1 | ||
| Pubescence | 2008 | 2.9 ± 1.3 | 1–5 | 1 | 5 | |
| 2009 | 2.9 ± 1.3 | 1–5 | 1 | 5 | ||
| Whole plant weight (g) | 2008 | 598 ± 236 | 142.6–1516 | 982 ± 311 | 429 ± 173 | |
| 2009 | 1267 ± 458 | 426.7–2890 | 2486 ± 1140 | 1038 ± 252 | ||
| Upper part weight (g) | 2008 | 416 ± 173 | 119.8–1142 | 879 ± 268 | 232 ± 86.9 | |
| 2009 | 1005 ± 385 | 341.7–2518 | 2346 ± 1096 | 716 ± 174 | ||
| Whole root weight (g) | 2008 | 180 ± 119 | 16.8–648 | 103 ± 46.5 | 197 ± 88.4 | |
| 2009 | 249 ± 174 | 26.0–801 | 135 ± 63.9 | 320 ± 83.4 | ||
| Main root weight (g) | 2008 | 148 ± 96.3 | 15.7–534 | 87.5 ± 43.3 | 175 ± 76.3 | |
| 2009 | 239 ± 165 | 26.0–744 | 123 ± 63.3 | 314 ± 84.8 |
1 = prostrate; 2 = semi-prostrate; 3 = intermediate; 4 = open; 5 = erect, see Supplemental Fig. 2.
1 = no hair; 2 = sparse; 3 = intermediate; 4 = abundant; 5 = very abundant hair like Haru-S.
N.D., not determined.
Fig. 1A linkage map of radish and the locations of QTLs for eight agronomic traits. Linkage groups were referred to chromosome numbers (Chrs A–I) (Budahn ) and LG numbers (R1–R9) (Li ). Marker names and genetic distances (cM) are shown on the right and left of each LG, respectively. SSR and STS markers are indicated with bold-face type. Markers used for the assignment to radish chromosomes and LG numbers are indicated with gray boxes and asterisks, respectively. Locations of QTLs are indicated with differentially-colored, vertical thick bars, the lengths of which correspond to the map positions in Table 3. The QTLs detected in 2008 and 2009 are represented with suffix numbers such as “−08” and “−09”, respectively.
List of SSR and STS markers developed and modified in this study
| Marker name | Marker type | Repeat motif | Primer sequence (5′-3′) | Product size (bp) | GenBank accession no. | |
|---|---|---|---|---|---|---|
| REL-4 | SSR | (CTT)6 | Forward | GATACGGAGACAAGAAGAAG | 237 | AB630374 |
| REL-12 | SSR | (GAA)25 | Forward | CTTTAACACCAGGAATCC | 330 | AB630375 |
| REL-13 | SSR | (CA)13 | Forward | CTAGCAATGCATACCAAACAG | 166 | AB630376 |
| REL-16 | SSR | (TG)13 | Forward | ACAGCAACGTTTTCAAGTGCTC | 197 | AB630377 |
| REL-20 | SSR | (TC)8 | Forward | CCTTCATTCTTTGCTTCTTCC | 162 | AB630378 |
| REL-37 | SSR | (GA)16 | Forward | GAAAACGGGAATCAGATACAAC | 94 | AB630379 |
| REL-40 | SSR | (AC)12 | Forward | TGATAGCAAAGGCAGAGGTGGC | 176 | AB630380 |
| REL-41 | SSR | (CA)6 | Forward | CGTTCATATCAACTTTTTGAGCGAG | 154 | AB630381 |
| RES-8 | SSR | (T)15GT | Forward | GGATAACAATTACCTCGATCA | 206 | AF248491 |
| RES-10/ | STS (CAPS) | – | Forward | CTTCCTAGTAGCTAACTC | 195 | AF263920 |
| STS (CAPS) | – | Forward | CTATCTCCAGGCACTGGAATCG | 431 | EX761507 | |
| RsEST-011 | STS (indel) | – | Forward | ATCATGTCTACGTGCGGAAACT | 353 | AF051121 |
| RsEST-012 | STS (indel) | – | Forward | GTACCAAGTTCCCCAGTTATGC | 294 | AF051120 |
| RsEST-030/ | STS (CAPS) | – | Forward | CTATTCCTTTCACCCGTTTCT | 303 | T25178 |
| RsEST-038 | STS (indel) | – | Forward | GATGTATCAGGTGGTGAAAT | 192 | EL738632 |
| RsEST-043/ | STS (CAPS) | – | Forward | ATCATGGTCCGATACACAAATC | 350 | EL738626 |
| RsEST-045/ | STS (CAPS) | – | Forward | GCAGAATTTTCCGCTGTAGTTC | 275 | EL738624 |
| STS (indel) | – | Forward | TAGGTTTTCTGTTATATCACTGCT | 103 | AB611697 | |
| STS (indel) | – | Forward | GTCAGGATCCTTGATCGATATGG | 81 | FD958357 | |
| RsSTS1004A/ | STS (CAPS) | – | Forward | ATTTCAATCCACTCAAGCTGAATCT | 522 | AB611698 |
| RsSTS1004B | STS (indel) | – | Forward | TCTAAGCCCATGGTTATGAGAC | 154 | AB611699 |
| RsSTS1006B | STS (indel) | – | Forward | CCCTAACGCACAAGTAATTA | 191 | AB611700 |
| Rs1SSR7063 | SSR | (CT)7 | Forward | GGACAAGTTTATACTTTAAGTG | 223 | RS1CL7063Contig1 |
| Rs2STS1232/ | STS (CAPS) | – | Forward | AGCCTGGTAAGCATCTCCAA | 468 | RS2CL1232Contig1 |
| Rs2STS1263/ | STS (CAPS) | – | Forward | GATCCAAGGTTCCATGCCCATG | 366 | RS2CL1263Contig1 |
| Rs2STS2285/ | STS (CAPS) | – | Forward | TGTTCTTCAGGGGAGTTTGATT | 489 | RS2CL2285Contig1 |
| Rs2STS3325/ | STS (CAPS) | – | Forward | CTAGCTCCAGGGAGTCAATTCA | 517 | RS2CL3325Contig1 |
| Rs2STS3416 | STS (indel) | – | Forward | TACCAAAGAAGAGACCCTTATG | 451 | RS2CL3416Contig1 |
| Rs2STS6006/ | STS (CAPS) | – | Forward | CACAGCCATCACTTGCAGATCC | 539 | RS2CL6006Contig1 |
| STS (CAPS) | – | Forward | GAACAGATAACCAAGTCAAG | 310 | AC232566 | |
| BRMS-036_R/ | STS (CAPS) | – | Forward | GGTCCATTCCTTTTTGCATCTG | 141 | AB630382 |
| BRMS-231_R | STS (indel) | – | Forward | CGGTGTATTTCCATTTATGCGTTT | 180 | CU695294 |
| AtSTS-64 | STS (indel) | – | Forward | CTCTCGGGTAGTTTACCTGACTTC | 640 | At3g05990 |
| AtSTS-1015 | STS (indel) | – | Forward | GTTGGTTAGGCTTAAACAGATG | 850 | At1g74860 |
| AtSTS-1027 | STS (indel) | – | Forward | TAAAACCTATCATCTCCGTACC | 880 | At1g71950 |
In CAPS markers, restriction enzymes used for polymorphism detection are indicated after slashes (/).
Sizes are estimated by agarose gel electrophoresis or predicted from the sequences used for primer design.
For markers designed from radish cDNA contig data, the cDNA contig nos. are shown instead of GenBank accession nos. (their sequences are shown in Supplemental Fig. 3).
For markers designed from Arabidopsis genome data, the locus tags are shown instead of GenBank accession nos.
Map positions and effect of QTLs detected in RILs
| Trait | Year | Chr | Map position in cM (peak) | Marker interval | LOD | Additive effect | |
|---|---|---|---|---|---|---|---|
| 2008 | I | 10.9–14.9 (11.9) | RES-11–E6M5_148 | 3.5 | 11.8 | 0.79 | |
| 2008 | G | 42.0–50.7 (45.0) | RsHH019–E6M4_87 | 3.8 | 10.8 | 0.31 | |
| I | 8.5–8.9 (8.5) | RM_42–RES-11 | 6.4 | 20.9 | 0.40 | ||
| 2009 | I | 2.6–3.0 (2.6) | RM_16–E6M5_99 | 3.5 | 16.9 | 0.32 | |
| I | 67.4–75.9 (68.6) | E2M4_196–RsSR094 | 3.2 | 11.9 | −0.27 | ||
| 2008 | A | 72.2–78.1 (77.1) | RsSR104–RsSA083 | 13.6 | 37.7 | −0.86 | |
| C | 42.6–46.1 (44.1) | E1M7_238–Rs2STS1232/ | 9.7 | 24.2 | −0.68 | ||
| 2009 | A | 72.2–78.1 (77.1) | RsSR104–RsSA083 | 12.8 | 34.4 | −0.82 | |
| C | 36.1–38.3 (38.3) | RM_1–E5M8_427 | 10.1 | 25.3 | −0.69 | ||
| 2009 | B | 1.8–2.8 (2.8) | AtSTS-1015–REL-4 | 3.8 | 18.7 | 213.34 | |
| 2009 | B | 1.8–2.8 (2.8) | AtSTS-1015–REL-4 | 3.6 | 17.8 | 175.33 | |
| 2008 | H | 34.7–35.6 (35.6) | RsHH012–E3M3_77 | 3.7 | 9.3 | −51.95 | |
| 2009 | H | 24.9–25.7 (24.9) | RES-1– | 11.6 | 33.9 | −113.01 | |
| I | 48.5–51.9 (48.9) | REL-13–RES-5/ | 6.6 | 16.8 | −82.24 | ||
| 2008 | H | 32.7–36.6 (35.6) | RsHH012–E3M2_105 | 8.4 | 25.1 | −53.52 | |
| I | 42.2–48.5 (46.2) | E5M4_90–REL-13 | 5.4 | 14.6 | −42.84 | ||
| 2009 | H | 24.9–25.7 (24.9) | RES-1– | 11.7 | 33.9 | −107.27 | |
| I | 48.5–51.9 (48.9) | REL-13–RES-5/ | 6.9 | 17.3 | −79.06 |
Region above the LOD threshold, in which the peak position is in parentheses.
Smallest marker interval flanking a region above the LOD threshold.
Scores at the LOD peaks.
Phenotypic variation explained by each QTL at the LOD peak.