Development of genomic and EST-SSR markers in radish (Raphanus sativus L.).

Radish (Raphanus sativus L.) belongs to Brassicaceae family and is a close relative of Brassica. This species shows a wide morphological diversity, and is an important vegetable especially in Asia. However, molecular research of radish is behind compared to that of Brassica. For example, reports on SSR (simple sequence repeat) markers are limited. Here, we designed 417 radish SSR markers from SSR-enriched genomic libraries and the cDNA data. Of the 256 SSR markers succeeded in PCR, 130 showed clear polymorphisms between two radish lines; a rat-tail radish and a Japanese cultivar, 'Harufuku'. As a test case for evaluation of the present SSRs, we conducted two studies. First, we selected 16 SSRs to calculate polymorphism information contents (PICs) using 16 radish cultivars and four other Brassicaceae species. These markers detected 3-15 alleles (average = 9.6). PIC values ranged from 0.54 to 0.92 (average = 0.78). Second, part of the present SSRs were tested for mapping using our previously-examined mapping population. The map spanned 672.7 cM with nine linkage groups (LGs). The 21 radish SSR markers were distributed throughout the LGs. The SSR markers developed here would be informative and useful for genetic analysis in radish and its related species.

Introduction

Radish (Raphanus sativus L., 2n = 18) is a member of Brassicaceae family, and has a relatively small genome size. The size is similar to those of other Brassicaceae species such as Brassica rapa (Johnston ). Radish is thought to have originated in Mediterranean areas, and is now widely cultivated in East Asian countries as an important vegetable root crop (Kaneko ). The edible part of this crop is called root, but in histology, it consists of the true root and the hypocotyl. A wide morphological diversity of this part is known in this species, and many cultivars having various shapes of thickened root have been developed in East Asia (Kitamura 1958). In contrast, a rat-tail radish produces no thickened root, and is cultivated in tropical Asia for edible puffed pods (Banga 1976).

Though radish has an extreme importance from the economic and agricultural views, molecular research of radish such as genome mapping and genetic diversity is behind compared to that of Brassica species. Molecular markers have been extensively used to study genetic diversity, genetic relationships and mapping studies in various crop species. Of these, simple sequence repeats (SSRs) or microsatellites are frequently utilized as DNA markers. The SSR is a DNA repeat consisting of 1–6 nucleotide repeat units, abundantly distributed in most eukaryotic genomes. The SSR marker has the advantages of high variability, ease of detection, codominant inheritance nature, and good transferability between populations and in different research groups (see Jones for a review). For these reasons, SSRs have become an important marker system in cultivar fingerprinting, diversity studies, molecular mapping and marker-assisted selection. On the other hand, because isolation of SSRs and establishment of the specific primers generally require high cost and a long development time, the number of available SSR markers differs in species. Actually, despite a number of SSR markers in Brassica species, there have been only a few reports on development of SSR markers in radish (Kamei , Ohsako , Wang , Yamane ). In the previous studies, we have made linkage maps of radish to detect loci for morphological characters and clubroot resistance (Kamei , Tsuro , 2008). Even including our efforts, reports on the linkage map are still limited in radish compared to other Brassicaceae species (Bett and Lydiate 2003, Budahn , Kamei , Tsuro , 2008). Since limited numbers of SSR markers were used in these studies, correspondence of the published linkage groups (LGs) is mostly unclear. Under such circumstances, increasing the number of available SSR markers would be of importance to conduct further genetic studies in radish.

Here, we designed a total of 417 SSR primer pairs in radish from SSR-enriched genomic libraries and cDNA data in the database. Utilities of the radish SSR markers were tested in the two following ways. To assess the usefulness of these markers among radish and other related species in Brassicaceae, the polymorphism information contents (PICs) were calculated. Of the 73 SSR markers tested for mapping, 21 markers were located on a radish linkage map. These results showed effectiveness of the SSRs for mapping study in addition to potential utility for the genetic diversity analysis.

Materials and Methods

Plant materials and DNA extraction

Three following radish lines were used for preparing genomic DNA libraries; a rat-tail radish, a Japanese cultivar, ‘Harufuku’, and an F1 plant derived from a cross between them. The homozygosity of the two parental lines was increased by five or six successive selfings. DNA was extracted from plant leaves using DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). For allele analysis, 16 radish cultivars and four lines of other Brassicaceae species were used (Table 1).

Table 1

Cultivars, lines and an ecotype used in this study

Species name	Cultivars, lines and an ecotype	Origin
Raphanus sativus	Akasuji	Takii & Co., Ltd
	Everest	Takii & Co., Ltd
	Harufuku	National Institute of Vegetable and Tea Science
	Horyo	Takii & Co., Ltd
	Koga-benimaru	Sakata Seed Co.
	Kunitomi	Matsunaga Seed Co., Ltd
	Kurobakei-Minowase	Takii & Co., Ltd
	Miyashige ohnaga	Takii & Co., Ltd
	Moriguchi hosonaga	Matsunaga Seed Co., Ltd
	Rat-tail radish	National Institute of Vegetable and Tea Science
	Red Globe	Tohoku & Co., Ltd
	Sakurajima ohmaru	Takii & Co., Ltd
	Shogoin daikon	Sakata Seed Co.
	Tokinashi	Marutane Co., Ltd
	Wakayama	Takii & Co., Ltd
	Yakumidaikon	Noguchi Seed Co.
Arabidopsis thaliana	Columbia
Brassica juncea	Akaohba takana	Takii & Co., Ltd
Brassica oleracea	Grand Duke	Takii & Co., Ltd
Brassica rapa	Shogoin ohmarukabu	Takii & Co., Ltd

Development of SSR markers

The SSR-enriched genomic DNA libraries were constructed according to Nunome . The SSR-enriched fragments were ligated into a pCR-TOPO vector (Invitrogen, Carlsbad, CA, USA). Resultant plasmids were used to transform TOP10 competent cells (Invitrogen). Clones with a 0.5–1.5 kb insert were sequenced using a CEQ8800XL sequencer (Beckman Coulter, Fullerton, CA, USA). Nucleotide sequences of 47 redundant clones were removed manually. Nucleotide sequence data of the genomic SSRs developed here are deposited in the DDBJ/EMBL/GenBank databases under accession nos. AB425071, AB425072, AB425076-AB425078 and AB608338-AB608637 (Supplemental Table 1). EST-SSR markers were designed from cDNA contig data in the RadishDB (http://radish.plantbiology.msu.edu). Sequences containing SSR with >10 mononucleotide, >6 dinucleotide and >5 trinucleotide repeats were used for primer design as described previously (Hirai , Kubo ). Primers were designed using the Primer3 software (Rozen and Skaletsky 2000). Amplification of primer pairs was tested in the two radish lines above. PCR amplification was carried out as described previously (Saito ). The annealing temperature was initially fixed at 50°C and then slight modifications were made to achieve optimal amplification (Supplemental Table 1). The amplified products were electrophoresed in a 3% agarose gel or with the CEQ8800XL sequencer (Beckman Coulter). Primer pairs showing clear polymorphic bands in these lines were then used for further analysis.

Fragment analysis and allele detection

Out of the developed SSRs, 16 primer pairs were used for the analysis of cultivars listed in Table 1. The 5′-end of forward primer was labeled with a fluorescent dye (Sigma-Aldrich, St. Louis, MO, USA), and PCR amplification was carried out as described above. The fragment sizes of SSR loci were analyzed with the CEQ8800XL sequencer (Beckman Coulter). The value of the polymorphic information content (PIC) at each locus was calculated for the 16 radish cultivars as described (Anderson ).

Linkage mapping

An improved linkage map of radish has been developed in this study based on our previous data (Tsuro ) plus the SSR marker data as described below. For the mapping, 73 radish SSR markers developed here, seven already-reported radish SSRs (Kamei , Ohsako , Wang ) and six B. rapa SSRs (Suwabe , 2006) were newly tested in this study. The polymorphic markers were then used for scoring the segregation in the F2 population (n = 106) (Tsuro ). Linkage analysis was performed using the JoinMap ver. 3.0 software (Van Ooijen and Voorrips 2001), but markers deviating significantly (P < 0.001) from the expected segregation ratio were excluded from the analysis. The Kosambi map function (Kosambi 1944) was used to calculate the genetic distance between markers.

Results

Development of SSR markers in radish

Three SSR-enriched libraries were developed from the two radish lines (rat-tail radish and ‘Harufuku’) and their F1 plant. From the rat-tailed radish library, 326 clones were sequenced. Similarly, 92 and 299 clones were sequenced from ‘Harufuku’ and the F1 plant libraries, respectively (Table 2). Of these, 245 (75.2%), 63 (68.5%) and 191 (63.9%) contained SSR motifs in the sequenced clones, respectively. Out of the 293 primer pairs initially designed from the non-redundant SSR-containing sequences, 156 primer pairs amplified clear bands. Of the 156 pairs succeeded in PCR, 90 primer pairs (57.7%) showed polymorphisms between the two radish lines (Table 2). We also designed 124 primer pairs of EST-SSRs from cDNA contig data in the RadishDB. Of these EST-based primer pairs, 100 produced clear bands within the predicted size range. Of the 100 successful EST-SSRs, 40 primer pairs (40.0%) showed polymorphisms between the two radish lines (Table 2). Finally, 256 SSR markers (156 genomic and 100 EST-SSRs) resulted in clear bands, of which 130 markers were polymorphic between the two radish lines (Table 2 and bold types in Supplemental Table 1).

Table 2

Development of radish SSR markers

	Genomic SSRs				EST-SSRs	Total
Origina	Rat-tail radish	Harufuku	F1	Subtotal	RadishDB
No. of clones sequenced	326	92	299	717	–	–
No. of clones containing SSR	245	63	191	499	–	–
SSR enrichment (%)	75.2	68.5	63.9	69.6	–	–
No. of primer pairs desinged	183	31	79	293	124	417
No. of primer pairs amplified clear bandsb	81	26	49	156	100	256
No. of polymorphic primer pairsb	48	17	25	90	40	130
Polymorphism (%)b	59.3	65.4	51.0	57.7	40.0	50.8

F1: an F1 hybrid of rat-tail radish and Harufuku. RadishDB: cDNA contig data from the RadishDB.

Data based on the experiments in rat-tail radish and Harufuku. See footnotes in Supplemental Table 1 for details.

Assessment of SSR polymorphisms by a fragment analysis

Out of the primers that amplified clear polymorphic bands, 16 SSR loci were tested for the ability to detect alleles using radish cultivars (Table 3). Of the markers tested, 13 primer pairs amplified clear polymorphic bands for all the 16 radish cultivars (Table 4). These markers detected 3–15 alleles with an average of 9.6. PIC values ranged from 0.54 to 0.92 with an average of 0.78. We also tested nine primer pairs for amplification in other Brassicaceae species. PCR gave detectable amplicons in more than half of the SSR markers tested in the Brassica species though their sizes were often different from those in radish (Table 4).

Table 3

Radish SSR loci used for allele detection

Marker namea	Primer sequence (5′-3′)	Repeat motif	Product size (bp)b	No. of alleles detected	Allele size range (nt)c	PIC	Accession No.
RsSA012	F: GGATCGTTCCTTTTTAGGGTAAT	(GA)23	187	15	152–237	0.90	AB608423
	R: GCTAAAAATCCGTGAGAAAGAG
RsSA014	F: AATAAGCATGTGGTGGGAAGTTA	(GA)11	183	3	171–183	0.54	AB608424
	R: GGGTTTATGAAAGGGATTTTGTC
RsSA020	F: TCAGGGGTAAAACCGTCAATTA	(CT)17	227	8	193–227	0.76	AB608427
	R: AGGATCGGAGATACGATTCAAA
RsSA027	F: CTAGCCGTTTCCAAATTTGTTC	(GA)42	190	15	154–198	0.89	AB608430
	R: AGTACTTTAACCACTGCCCAACA
RsSA033	F: ACAATTTCACGACAGTAAACATGAA	(TC)26	228	14	181–285	0.87	AB608432
	R: CCGAGTTGATTAAAACACACATACA
RsSA120	F: TCTTACCATTGGTGTAAGTCAATCC	(GA)27	253	15	209–256	0.92	AB608477
	R: GAAAGGTGGAGAAAATGAAGTAACA
RsSH001	F: AACTCAGGTCCCTTGTGCTAGA	(TC)6(CA)7	237	4	201–243	0.65	AB608483
	R: GGAACTATGTTGTTGTCGGAAA
RsSH016	F: GTTTGTTGTTGTTTGTGTCACCT	(CT)4(GT)3(CT)10	136	6	132–140	0.76	AB608488
	R: CAGAAGCAAGCACTATTTGAGAA
RsSH048	F: TCGTCCGTTATGTATGTTACTCTCA	(GT)11	200	7	188–206	0.60	AB608489
	R: TATGCGTACTCCGTAAGACAATGTA
RsSH093	F: CAATTCTTTGTATGCTTTTGTCTGAT	(GA)17	233	7	231–239	0.76	AB608516
	R: TGGCAAGATATATATAACCCTCGTTT
RsSR025	F: ACACTTTCAGTCACCGACACATA	(GA)20	239	14	213–252	0.89	AB608556
	R: ACTTTCTTTAGGTAACCCCACCA
RsSR040	F: CGTCTCTTTCTTTTTCAGACCAA	(TC)14	221	10	202–228	0.73	AB608564
	R: GCTTGAGATGAGATGAGGAGAAA
RsSR042	F: ATAAAGCAGCAGAAGATGGTGAG	(AC)14	171	9	156–206	0.80	AB608565
	R: GAATGAAACTCCTTTAAGAAGAAGC
RsHH016	F: CTGATCGAACTGGAACCACAATT	(AG)24	189	10	179–209	0.82	AB608620
	R: GAGGGTTTTAGGGCACCTGA
RsHH023	F: CTGGTCTCACAATCAAACATCT	(TA)10(TG)13	169	11	162–206	0.83	AB608624
	R: CTTATCTGTCACTTATTAATAGGCT
RsHR026	F: AAGCGTGTCATCAGATCCCAGA	(GA)13	131	6	119–135	0.68	AB608635
	R: CATTCTCTCAATGCATAAGATTGAGC
Average				9.6		0.78

A complete list of radish SSRs developed in this study is shown as Supplemental Table 1.

Estimated from the nucleotide sequences used for primer design.

Sizes determined by fragment analyses.

Table 4

Alleles in 16 radish cultivars and 4 other Brassicaceae species

Marker name	RsSA012	RsSA014	RsSA020	RsSA027	RsSA033	RsSA120	RsSH001	RsSH016	RsSH048	RsSH093	RsSR025	RsSR040	RsSR042	RsHH016	RsHH023	RsHR026
Sample name
Radish cultivars
Akasuji	192/192	174/174	213/225	162/197	278/278	210/253	243/243	132/139	200/200	233/234	222/241	221/221	161/171	181/189	198/198	131/133
Everest	152/152	171/171	203/203	186/186	226/242	233/253	239/239	134/134	198/200	231/231	213/251	221/221	159/171	189/189	169/186	135/135
Harufuku	224/237	171/171	203/203	186/186	236/236	250/250	237/237	163/163	200/200	233/233	241/241	223/223	161/161	189/189	169/169	131/131
Horyo	187/235	171/171	225/225	161/198	208/234	244/244	239/243	132/132	198/198	234/234	235/235	228/228	206/206	181/189	186/186	131/135
Koga-benimaru	187/187	171/171	217/217	154/158	181/190	215/228	243/243	134/139	188/190	234/234	240/252	223/223	171/171	179/179	164/164	133/135
Kunitomi	188/188	174/174	225/225	162/162	228/234	242/252	201/239	134/134	198/206	234/234	234/236	221/221	159/161	–	–	135/135
Kurobakei-Minowase	190/228	174/174	213/225	165/165	279/279	257/257	239/239	132/132	198/200	234/234	222/222	221/221	169/171	181/181	211/211	119/135
Miyashige ohnaga	182/182	174/174	209/209	159/163	228/234	210/212	239/239	132/134	200/200	233/233	235/241	223/223	156/161	181/189	186/186	135/135
Moriguchi hosonaga	188/188	171/174	225/225	161/161	234/234	244/248	239/239	139/139	200/200	232/232	235/235	211/221	156/171	193/193	197/205	134/135
Rat-tail radish	187/187	183/183	227/227	190/190	228/228	253/253	237/237	136/136	200/200	233/233	239/239	221/221	171/171	181/181	186/186	133/133
Red Globe	232/232	174/174	193/193	165/165	285/285	215/228	243/243	136/140	198/200	237/237	217/217	204/221	156/157	179/179	162/162	135/135
Sakurajima ohmaru	187/231	174/174	216/217	161/161	234/234	210/212	237/239	132/132	198/198	233/234	250/250	213/221	165/167	181/189	186/186	131/131
Shogoin daikon	216/232	171/171	217/225	177/177	228/228	242/255	239/239	139/139	198/200	233/237	235/235	223/223	171/171	181/189	186/186	131/131
Tokinashi	228/228	171/174	225/227	177/192	222/234	212/256	237/237	132/132	197/198	232/239	213/236	220/220	161/161	185/185	174/174	131/135
Wakayama	222/222	174/174	225/225	161/161	232/232	210/250	237/243	139/139	199/200	234/235	242/241	221/221	159/161	191/195	169/169	130/131
Yakumidaikon	187/220	174/174	225/225	179/188	224/224	209/209	239/239	134/134	200/200	237/237	238/238	202/210	159/159	201/209	204/206	–
Expected size (bp)a	187	183	227	190	228	253	237	136	200	233	239	221	171	189	169	131
Size range (nt)a	152–237	171–183	193–227	154–198	181–285	209–256	201–243	132–140	188–206	231–239	213–252	202–228	156–206	179–209	162–206	119–135
PIC	0.90	0.54	0.76	0.89	0.87	0.92	0.65	0.76	0.60	0.76	0.89	0.73	0.80	0.82	0.83	0.68
Other Brassicaceae species
Arabidopsis thaliana (Columbia)	–	–	142/142	161/161	N.E.	N.E.	193/193	204/204	N.E.	N.E.	–	210/210	–	N.E.	N.E.	N.E.
Brassica juncea (Akaohba takana)	195/195	116/197	169/199	203/297	N.E.	N.E.	231/242	113/113	N.E.	N.E.	191/217	230/230	154/154	N.E.	N.E.	N.E.
B. oleacea (Grand Duke)	170/170	191/191	176/206	225/278	N.E.	N.E.	246/246	113/119	N.E.	N.E.	219/220	236/290	140/140	N.E.	N.E.	N.E.
B. rapa (Shogoin ohmarukabu)	–	167/167	199/199	152/152	N.E.	N.E.	179/179	113/113	N.E.	N.E.	189/189	290/290	163/163	N.E.	N.E.	N.E.

See footnotes in Table 3.

–: no specific amplification detectable.

N.E.: not examined.

Linkage mapping of the radish SSRs

The present SSRs were tested for a mapping study. Of the 80 radish SSRs tested, 23 markers were successfully localized on the linkage map (Fig. 1, arrows), of which 21 were ones developed here (Fig. 1, bold types). Finally, the present map was constructed with the 336 loci (278 AFLPs, 23 radish SSRs, 34 B. rapa SSRs and 1 radish CAPS, see legend of Fig. 1 for marker nomenclatures), whereas only seven loci (4 AFLPs, 1 radish SSR and 2 B. rapa SSRs) were unmapped. This map spanned 672.7 cM with nine LGs, which are expected from the chromosome number of radish. The length of the LGs ranged from 35.6 to 122.4 cM, which contained from 22 to 56 markers, respectively, with an average map interval of 2.0 cM. The mapped SSR markers were distributed throughout the LGs.

Fig. 1

Positions of radish SSRs on a radish linkage map. Arrows indicate the radish SSRs, of which bold types are ones developed in this study. Asterisks indicate nine of the 16 SSR markers used in allele detection among 16 radish cultivars and four other Brassicaceae species. The loci denoted with BRMS- and SLG_CAPS are B. rapa SSRs (Suwabe , 2006) and a CAPS marker for S-locus specific glycoprotein gene (Niikura and Matsuura 1998), respectively. Others are AFLP markers.

Discussion

The present study seems to be successful in the SSR-enrichment from the radish genomes, judging from the efficiencies of SSR-enrichment as compared with those in the previous studies using cucumber (Fukino ), Vaccinium (Hirai ) and water lotus (Kubo ). We have used three DNA materials (two radish lines and their F1 hybrid) for the SSR development. There was no obvious difference among the three with regard to the SSR-enrichment efficiency and the polymorphisms of markers (Table 2). Out of the 293 primer pairs initially designed for genomic SSR markers, 156 primer pairs succeeded in PCR amplifying clear bands (53.2%), whereas 81 pairs produced faint, smear or multiple bands (27.6%) (Supplemental Table 1). The rest of 56 pairs resulted in no amplification (19.1%). One of the reasons for failure in the PCR amplification could be due to the presence of repetitive DNA sequences or similar sequences in other genomic regions, as observed in marker development from species with large genomes (Song ). The unsuccessful markers might be converted into useful markers by re-designing the primer pairs based on the nucleotide sequences flanked by the SSR repeats (Supplemental Table 1, accession nos.). The success rate of the PCR amplification in the EST-SSRs (80.6%) was higher than that in the genomic SSRs (53.2%). Similar observation has been reported in different crops such as coffee and common bean (e.g. Aggarwal , Blair ). This could be because exon-derived sequences are more conservative than the intergenic regions. In spite of such the conservative nature of ESTs, some of the EST-derived SSRs were failed in stable amplification. This could be because some primer sites may have been designed across splicing sites or because of chimerical origins of the cDNA clones in the database, as discussed by Tsukazaki . Although polymorphism of EST-SSRs is generally lower than that of genomic SSRs (Blair ) because of the conservative nature of exon sequences, no obvious difference was found in polymorphism rate between the genomic and EST-SSRs as long as comparison of the present two radish lines.

We previously applied B. rapa SSRs (Suwabe , 2006) to the radish mapping studies (Tsuro , 2008). In the present study, we showed that the inverse case was also effective in part. More than half of the tested radish SSRs clearly detected alleles in four lines of the Brassicaceae genera in addition to the radish cultivars (Table 4), suggesting the effectiveness of the radish SSRs across the Brassicaceae genera. The PIC values obtained in this study (average = 0.78) were comparable to those of Brassica species (Suwabe ). Although limited numbers of SSRs were tested in this allele analysis as a test case, we confirmed that the radish SSRs developed in the previous and the present studies were applicable to the genetic diversity study in a wild radish (Ohsako ) and Japanese radish landraces (data not shown). Therefore, the SSRs developed here would be informative at the level of within-species variation, and may be useful even in other Brassicaceae species.

Another aspect of usage of SSRs is for mapping study. We were able to map approximately one third of the applied SSRs on the radish map (Fig. 1, arrows). This ratio was similar to those of the mapping studies in Brassica species (Cheng , Kim , Li ). Because the present map was integrated to the radish chromosome number (n = 9), the map location of radish-specific SSRs would be useful for comparison of the radish linkage maps in the previous and future studies. Further mapping of the radish SSRs will enable us to construct a denser, SSR-based radish map and to detect agronomically important loci. However, this is beyond scope of the present study that focused on the development of hundreds of radish SSRs and their evaluation. In conclusion, the radish SSRs developed here would provide the useful tools for genetic analysis in radish and its related species.