Literature DB >> 23766695

Association between TLR4 and TLR9 gene polymorphisms with development of pulmonary tuberculosis in Zahedan, southeastern Iran.

Danial Jahantigh1, Saeedeh Salimi, Roya Alavi-Naini, Abolfazl Emamdadi, Hamid Owaysee Osquee, Farzaneh Farajian Mashhadi.   

Abstract

Some evidence suggests that a variety of genetic factors contribute to development of the tuberculosis (TB). TLR4 and TLR9 have been proposed as susceptibility genes for TB. This study was performed in 124 newly diagnosed TB cases and 149 healthy controls in a TB-endemic region of Iran. The TLR4 genes Asp299Gly, Thr399Ile, and TLR9 gene T-1486C polymorphisms were amplified by polymerase chain reaction (PCR) and then detected by PCR-restriction fragment length polymorphism (RFLP). The frequencies of the mutant alleles of TLR4 Arg299Gly, Thr399Ile, and TLR9 T-1486C polymorphisms were 0.8 versus 0.1, 5.6 versus 3, and 28.6 versus 25.2 in patients and controls, respectively, that were not significant. The synergic effect of TI,II/CC genotypes for TLR4 Thr399Ile and TLR9 T-1486C polymorphisms showed increased risk of PTB susceptibility. In conclusion, no significant relation was found between TLR4 and TLR9 polymorphisms alone and PTB. However, synergic effects of TLR4 Thr399Ile and TLR9-1486T/C polymorphisms might increase risk of PTB.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23766695      PMCID: PMC3677666          DOI: 10.1155/2013/534053

Source DB:  PubMed          Journal:  ScientificWorldJournal        ISSN: 1537-744X


1. Introduction

Tuberculosis (TB), an ancient and devastating disease, is still a significant public health problem. It is an infectious bacterial disease caused by Mycobacterium tuberculosis (MT) which affects more than 9 million people each year and causes about 1.7 million deaths per year [1]. The incidence of TB in Iran was reported to be 13.7 per 100 000 population in 2011 [2]. However, in Sistan-Baluchestan Province in southeastern Iran, the incidence was much higher due to neighboring with high TB prevalence countries such as Afghanistan and Pakistan. In 2011, TB incidence was 43/100 000 in Zahedan, the center of Sistan-Baluchistan [2]. Most of the population in this region comprises Persian, Baluch, and Afghan ethnic groups. Despite infection of more than one-third of the world's population with M. tuberculosis, only 5% to 10% of infected population has a risk of developing active tuberculosis and clinical symptoms and signs of the disease, suggesting that host defense factors influence development of active disease. Although certain data such as familial clustering, increased concordance rates among monozygotic twins, and familial differences in incidence strongly support genetic predisposition as a key element in susceptibility, the biological mechanisms underlying genetic variations remain mostly unknown. Several studies have been investigated on associations between tuberculosis and gene polymorphisms, and some of these candidate genes have shown significant association with TB susceptibility [1-3]. Toll-like receptors (TLRs) are a class of pattern recognition molecules that play a unique function in the innate immune system [4]. This system is the first line of defense against microorganisms that initiate cellular signal in response to pathogen-associated molecular patterns (PAMPs) and induce expression of genes involved in the inflammatory process, therefore it plays a crucial role initiating and directing the adaptive immune system [5, 6]. Ten functional TLR members (TLR1–TLR13) have been identified in humans. TLR4 is activated by bacterial lipopolysaccharides (LPSs) and has critical role in initiation of innate immune system [4-6]. TLR4 has been shown to activate IL-1 receptor-associated kinase in response to a variety of PAMPs, such as Gram-negative enterobacterial LPS [7]. The TLR4 gene is located on chromosome 9q32-33, spans approximately 13 kb, and contains three exons that encode a 222-amino acid protein. Several studies show that synergic effect of two variants of TLR4 gene, Asp299Gly (rs4986790) and Thr399Ile (rs4986791) which both are encoded within the fourth exon of the TLR4 gene, are associated with an endotoxin-hyporesponsive phenotype. Moreover, the Asp299Gly polymorphism is associated with airway hyporesponsiveness in either human primary airway epithelial cells or alveolar macrophages obtained from individuals with these TLR4 mutations [8-11]. TLR9, an endosomal localized receptor on B cells, plasmacytoid dendritic cells (pDCs), and monocytes/macrophages, recognizes unmethylated nucleic acid motifs, especially Cytosine-phosphate-Guanine (CpG) motifs, in bacterial DNA [12], and it is one of the most important receptors in the initiation of protective immunity against intracellular pathogens by activation signaling cascade of intracellular receptor signaling [13, 14]. TLR9 encoding gene is located on chromosome 3p21.3. It spans approximately 5 kb and contains two exons, the second of which is the major coding region [12-14]. Twenty SNPs have been identified for TLR9, which -1486T/C (rs187084) in the promoter region in intron 1 is one of the most important SNPs [15, 16]. TLR4 and TLR9 gene polymorphisms have been extensively studied for their association with susceptibility or resistance to many infections and diseases [17-22]. Therefore, the association between progress and severity of infectious diseases with TLR4 [23-27] and TLR9 [28, 29] gene polymorphisms has been confirmed. It has been shown that TLR4 and TLR9 have critical roles in the recognition of MT, and they are necessary for development of an adequate immune response against MT [30-33]. TLR-knockout mouse studies indicate that TLR4 and TLR9 contribute to host resistance to M. tuberculosis infection [34]. Moreover, associations between genetic variations of TLR4 and TLR9 and TB have been reported [35-42]. There have been no reports about the association of TLR4 and TLR9 with TB in Iran so far. The aim of the present study was to investigate the potential association between pulmonary TB, a TB infection of the lungs, and three SNPs in TLR4 and TLR9 genes in southeastern Iranian population, Zahedan.

2. Materials and Methods

2.1. Sample Collection

The project was approved by Zahedan University of Medical Sciences Ethics Committee. This case-control study was conducted prospectively at Boo-Ali Hospital, Zahedan, southeastern Iran, from March 2010 to May 2011. The diagnosis of different clinical forms of active pulmonary and extrapulmonary TB was established according to the criteria defined by the American Thoracic Society for diagnosis of disease caused by MT [43]. Patients included were clinically and radiologically diagnosed for pulmonary tuberculosis and confirmed by sputum smear and culture for M. tuberculosis. TB patients with other comorbidities such as myocardial infarction, liver cirrhosis, acute pancreatitis, and septic shock were excluded. The inclusion criteria for control group were absence of clinical symptoms of active PTB and normal CXR. Also the controls had no medical history of TB, other infectious and autoimmune diseases, cancer and other diseases affecting host immunity. Peripheral blood samples were collected in EDTA tubes from 124 pulmonary tuberculosis (PTB) patients and 149 unrelated healthy controls, with no history of TB or other immune diseases. All the participants signed the written informed consent.

2.2. Genotyping

Genomic DNA was extracted from peripheral blood lymphocytes using the commercial available kit (Roche, Germany) in accordance with the manufacturer's instructions, and extracted DNA was stored at −20°C until analyzing. The alleles of TLR4 and TLR9 gene polymorphisms were detected using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) according to previously described methods [29, 44]. PCR reactions were performed in a 25 L reaction volume containing 200 ng genomic DNA, 25 ρM of each primer, 2.5 mM deoxyribonucleoside triphosphates (dNTPs), 1.5 mM MgCl2, and 1 U thermostable Taq DNA polymerase (Fermentas, Lithuania). Reactions were run on MyCycler Thermal cycler, BIO-RAD PCR system (BIO-RAD Co., USA), using the following conditions: initial denaturation at 95°C for 5 minutes followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 61°C for 30 seconds, and extention at 72°C for 1 minute. A final extension step was at 72°C for 10 minutes. The PCR products were held at 4°C until analysis. The primers and PCR conditions used to detect TLR variants were listed in Table 1. PCR products were electrophoresed on agarose gel and visualized by ethidium bromide staining.
Table 1

Primers, PCR conditions, and restriction enzymes used for genotyping TLRs genes.

SNPs productPrimer sequence 5′-3′AT PCR product RE
TLR4
Arg299Gly F: GATTAGCATACTTAGACTACTACCTCCATG60°249 bpNcoI
R: GATCAACTTCTGAAAAAGCATTCCCAC
Thr399Ile F: GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA61°406 bpHinfI
R: CCTGAAGACTGGAGAGTGAGTTAAATGCT

TLR9
T-1486C F: TTCATTCAGCCTTCACTCAG55°558 bpBslI
R: TCAAAGCCACAGTCCACAG

F: forward primer; R: reverse primer; AT: annealing temperature; RE: restriction enzyme.

The PCR products of TLR4 Arg299Gly, TLR4 Thr399Ile, and TLR9 T-1486C polymorphisms were digested overnight at 37°C with 10 U of NcoI, HinfI, and BslI restriction endonucleases (Fermentas, Lithuania), respectively. The wild-type allele of TLR4 Arg299Gly polymorphism (A allele) was 249 bp size and had no NcoI cleavage site, whereas mutant allele (G allele) digested to 223 and 26 bp fragments. The fragment sizes for carriers of the TLR4 Thr399Ile polymorphic allele were decreased from 406 bp (C allele) to 377 and 29 bp fragments (T allele). The 558 bp PCR product of TLR9 T-1486C polymorphism digested to 264, 145, 126, and 23 bp fragments for T allele and to 264, 115, 126, 30, and 23 bp fragments for C allele. Digested samples were separated by electrophoresis on 2% agarose gel and visualized by ethidium bromide staining.

2.3. Statistical Analysis

All data were analyzed using SPSS software version 15. The differences in clinical characteristics between groups were examined by χ 2 test or an independent student t-test whenever appropriate. Allele frequencies were estimated by the gene counting method. Differences in frequency of alleles and genotypes were analyzed using the χ 2 test or Fisher's exact test. The odds ratio (OR) and 95% confidence intervals (CIs) were estimated. The χ 2 test was used to analyze the deviation of genotype distribution from the Hardy-Weinberg equilibrium. P < 0.05 was considered statistically significant.

3. Results

Table 2 shows the demographic and clinical characteristics of the 124 TB patients and 149 healthy controls. Because this was a matched case-control study, the cases and controls did not differ significantly by sex, age, and ethnic characteristics.
Table 2

Demographic characteristics of TB patients and controls.

TBControls χ² P valueOR
n = 124 n = 149(95% CI)
Age (years) 51.1 ± 2048.4 ± 14.70.2
Sex (male/female)48/76 50/990.80.2
Smoking n (%)38 (31)26 (17.5)6.60.0082.1 (1.2–3.7)
Race n (%) 4.9 0.09
 Persian 48 (38.7)39 (26.2)
 Balouch72 (58.1)104 (69.8)
 Afghan4 (3.2)6 (4)
The frequency of smokers was higher in TB patients (31 percent) compared to controls (17.5 percent; P = 0.008).

3.1. Asp299Gly and The399Ile TLR4 Genotyping

There were no significant deviations from Hardy-Weinberg equilibrium for genotype frequencies of these SNPs in cases or controls. As shown in Table 3, distribution of alleles and genotypes of Asp299Gly polymorphism was not significantly different between two groups. The frequency of 299Gly allele was 0.8 percent in the patients compared with 1 percent in control group (χ 2 = 0.06; P = 0.6; OR (95% CI) = 1.3 (0.2–7.6)). The frequency of heterozygote genotype (AG) was not significantly different between patients and controls (1.6% versus 2; P = 0.6). Also, homozygous state of mutant allele (GG genotype) was not observed in both pulmonary TB patients and controls.
Table 3

TLR4 SNPs allele and genotype frequencies in patients and controls.

TLR4 polymorphismPTB patients (n = %)Controls (n = %) χ 2 P value*OR (95% CI)
Asp299Gly (A896G)
 AA122 (98.4)146 (98)
 AG2 (1.6)3 (2)0.060.60.8 (0.13–4.9)
 GG00

 Total124149

 A (WT)246 (99.2)295 (99)
 G (Mut)2 (0.8)3 (1) 0.060.61.3 (0.2–7.6)

Thr399Ile (C1196T)
 CC112 (90.3)141 (94.6)
 TC10 (8.1)7 (4.7)1.40.181.8 (0.7–4.9)
 TT2 (1.6)1 (0.7)0.60.42.5 (0.2–2.8)

 Total124149

 C (WT)234 (94.4)289 (97)
 T (Mut)14 (5.6) 9 (3) 2.3 0.1 1.9 (0.8–4.5)

*Compared with healthy controls. A corrected P value < 0.05 was considered significant.

The distribution of Thr399Ile polymorphism alleles and genotypes in PTB patients and healthy controls is also shown in Table 3. The frequency of the mutant T (399 Ile) allele was 5.6 percent in the patients as compared with 3 percent in controls and were not significantly different (χ 2 = 2.3; P = 0.1; OR (95% CI) = 1.9 (0.8–4.5)). No significant differences were found between PTB patients and healthy controls for the CT (8.1 versus 4.7 percent, P = 0.18) and TT genotypes (1.6 versus 0.7 percent, P = 0.4).

3.2. T-1486C TLR9 Genotyping

The frequencies of T-1486C TLR9 genotypes and alleles were not significantly different between pulmonary TB patients and the controls (Table 4). The mutant allele frequency of TLR9 T-1486C was 25.2 percent in the control compared with 28.6 percent in patients group (χ 2 = 0.8; P = 0.2; OR (95% CI) = 1.2 (0.8–1.8)). The proportion of heterozygous TC genotype in control group was 39.6 percent while in pulmonary TB patients was 41 percent (χ 2 = 0.2; P = 0.4). Moreover, the frequencies of CC genotype were 5.4 and 8 percent in controls and PTB patients, respectively.
Table 4

TLR9-1486T/C genotype and allele frequencies in patients and controls.

SNP PTB patients (n = %)Controls (n = %) χ 2 P value*OR (95% CI)
TLR9 (T-1486C)
 TT63 (51)82 (55)
 TC51 (41)59 (39.6)0.20.41.1 (0.7–1.9)
 CC10 (8)8 (5.4)10.21.6 (0.6–4.4)

 Total124 149

 T177 (71.4)223 (74.8)
 C71 (28.6) 75 (25.2)0.8 0.21.2 (0.8–1.8)

*Compared with healthy controls. A corrected P value < 0.05 was considered significant.

3.3. Combination Effect of TLR4 Thr399Ile and TLR9 T-1486C Polymorphisms on PTB Susceptibility

Regarding the low frequency of TLR4 Asp299Gly polymorphism in the study population, we analyzed only the combination effect of TLR4 Thr399Ile and TLR9 T-1486C polymorphisms on TB susceptibility. Table 5 shows the combined genotype distribution for both polymorphisms. The heterozygous, homozygous/heterozygous, homozygous state for TLR4 Thr399Ile and TLR9 T-1486C polymorphisms showed a 1.7-fold increased risk of pulmonary TB, with a 95 percent confidence limit of 0.6–4.6 and a P value of 0.23 which was not significant. Moreover, the heterozygous, homozygous/homozygous state for both polymorphisms, respectively, showed 7.5-fold increased risk of pulmonary TB, with a 95 percent confidence limit of 0.84–66.7 and a P value of 0.047 which was slightly significant.
Table 5

Combined effect of both TLR4 Thr399Ile and TLR9 T-1486C polymorphisms in cases and controls.

TLR4 TLR9 PatientsControls P value OR (95% CI)
Thr399IleT-1486C n = 124 n = 149
TTTT55 820.23 Ref = 1
TI, IITC, CC9 80.61.7 (0.6–4.6)
TI, IICC5 10.047 7.5 (0.84–66.7)

4. Discussion

In this study, there was not any evidence for a significant association of TLR4 Asp299Gly and Thr399Ile and TLR9 T-1486C polymorphisms with pulmonary TB risk, but the combination effect of TI,II/CC genotypes for TLR4 Thr399Ile and TLR9 T-1486C polymorphisms showed 7.5-fold increased risk of pulmonary TB which was slightly significant (P = 0.047). Pulmonary tuberculosis is endemic in southeastern Iranian territories, particularly in the northern regions of Sistan and Baluchistan Province, Zahedan. TLR4 and TLR9 have shown biological relevance and linkage disequilibrium with the other polymorphisms [8–11, 14]. Therefore, to determine whether TLR4 and TLR9 are associated with susceptibility to pulmonary TB in the current study, two common TLR4 polymorphisms, Asp299Gly and Thr399Ile, and one well-known TLR9 gene polymorphism, T-1486C, were examined. The TLR4 is known to activate the NF-κB via signal transduction involving various intracellular signaling systems and expression of various inflammatory cytokines [6, 7]. TLR-4 polymorphisms that prevent ligands binding would result in lower NF-κB activation and subsequent NF-κB dependent proinflammatory genes expression. Moreover, it is established that two variants of TLR4 gene, Asp299Gly and Thr399Ile, affected a ligand-binding region and a coreceptor-binding region, respectively. Therefore, these two polymorphisms appear to affect the extracellular domain of the TLR4 receptor and have been linked with inability to trigger LPS signaling in some cell types, including primary airway epithelial cells [8, 9]. Furthermore, TLR4 Asp299Gly polymorphism was found to be associated with systemic inflammatory hyporesponsiveness after LPS inhalation [9, 10]. TLR4 SNPs have shown an association with increased risk of many infections and diseases including mortality from systemic inflammatory response syndrome, severe acute infections, Gram-negative septic shock [10, 11], respiratory syncytial virus bronchiolitis [24], and ischemic stroke [25], as well as with the host susceptibility to autoimmune process in human [26]. Genetic variations of TLR9, as a key gene of innate immunity, could affect immunological downstream responses that are critically important for host defense or inflammatory disease pathogenesis. The roles played by TLR9 SNPs are unclear; however, Lazarus et al. in 2003 and Coban et al. in 2005 demonstrated that TLR9 T-1486C promoter SNP modifies the expression and consequently its function [15, 16]. Moreover, several investigators have studied the role of TLR9 genetic polymorphisms in major infection diseases, systemic lupus [22], type 2 diabetes and coronary artery disease [28], and malaria [29]. Several studies have demonstrated critical role of TLR4 and TLR9 in M. tuberculosis recognition and verified necessity of these TLRs for development of a protective response against MTB infection [30-34]. Variants in TLR4, Asp299Gly and Thr399Ile, and the TLR9-1486C/T were investigated for their association with susceptibility or resistance to pulmonary tuberculosis [35-42]. The prevalence of mutant alleles of TLR4 Asp299Gly and Thr399Ile polymorphisms in this study was similar to that reported previously in other Asian populations (almost 0%) [19-21] but significantly lower than in European Caucasians (3%–9%) [21, 22], North and South American (almost 4.5%) [23, 37], and African populations (7.5%–21%) [27, 29, 35]. Contrary to the present study, Najmi et al. in India [39] reported an association between TLR4 Asp299Gly and Thr399Ile polymorphisms and susceptibility to pulmonary tuberculosis especially in severe form of the disease (P = 0.001). The differences between result of the current study and that by Najmi et al. [39] described the differences in the number of enrolled subjects and higher frequencies of both mutant alleles in Indian population. The results of our study are consistent with the reports of Zafra et al. in Colombia [23], Newport et al. in Gambia [35], Rosas-Taraco et al. in Mexico [38], and Velez et al. in USA [40]. In addition, Ferwerda et al. and Pulido et al. revealed a relation between TLR4 Asp299Gly polymorphism and active TB only in HIV-infected patients in Tanzania and Spain, respectively [36, 37]. In this study, the mutant allele frequency of TLR9-1486C/T polymorphism in controls was 25.2 percent, which is similar to that found previously in Chinese [28], Iranian [29], South Indian [41], and Indonesian females [42] populations, but not with the Japanese [22]. Similar to the present study, results of Selvaraj et al. [41] and Kobayashi et al. [42] did not support the association between TLR9-1486T/C polymorphism and the prevalence of pulmonary TB. The present study revealed the synergic effect of TI,II/CC genotypes of TLR4 Thr399Ile and TLR9 T-1486C polymorphisms with the increasing risk of pulmonary TB. This result was the first published report about synergic effect of these genes on pulmonary tuberculosis susceptibility. In conclusion, we demonstrated that TLR4 Asp299Gly and Thr399Ile and TLR9-1486T/C polymorphisms were not associated with susceptibility to pulmonary tuberculosis. Moreover, the frequencies of TLR4 299Gly and 399Ile alleles were nearly rare in southeastern Iran both in the patients and in the healthy controls. Due to the relatively small number of patients and the possibility of racial differences, further investigations using a larger sample size and different ethnicities to confirm the present findings are necessary.
  42 in total

1.  A Toll-like receptor recognizes bacterial DNA.

Authors:  H Hemmi; O Takeuchi; T Kawai; T Kaisho; S Sato; H Sanjo; M Matsumoto; K Hoshino; H Wagner; K Takeda; S Akira
Journal:  Nature       Date:  2000-12-07       Impact factor: 49.962

Review 2.  Diagnostic Standards and Classification of Tuberculosis in Adults and Children. This official statement of the American Thoracic Society and the Centers for Disease Control and Prevention was adopted by the ATS Board of Directors, July 1999. This statement was endorsed by the Council of the Infectious Disease Society of America, September 1999.

Authors: 
Journal:  Am J Respir Crit Care Med       Date:  2000-04       Impact factor: 21.405

Review 3.  Toll-like receptors in the induction of the innate immune response.

Authors:  A Aderem; R J Ulevitch
Journal:  Nature       Date:  2000-08-17       Impact factor: 49.962

4.  TLR4 mutations are associated with endotoxin hyporesponsiveness in humans.

Authors:  N C Arbour; E Lorenz; B C Schutte; J Zabner; J N Kline; M Jones; K Frees; J L Watt; D A Schwartz
Journal:  Nat Genet       Date:  2000-06       Impact factor: 38.330

5.  Toll-like receptor and TIRAP gene polymorphisms in pulmonary tuberculosis patients of South India.

Authors:  P Selvaraj; M Harishankar; Brijendra Singh; M S Jawahar; V V Banurekha
Journal:  Tuberculosis (Edinb)       Date:  2010-08-24       Impact factor: 3.131

6.  Differential effects of a Toll-like receptor antagonist on Mycobacterium tuberculosis-induced macrophage responses.

Authors:  T K Means; B W Jones; A B Schromm; B A Shurtleff; J A Smith; J Keane; D T Golenbock; S N Vogel; M J Fenton
Journal:  J Immunol       Date:  2001-03-15       Impact factor: 5.422

7.  Association of TLR polymorphisms with development of tuberculosis in Indonesian females.

Authors:  K Kobayashi; R Yuliwulandari; H Yanai; I Naka; L T Lien; N T L Hang; M Hijikata; N Keicho; K Tokunaga
Journal:  Tissue Antigens       Date:  2011-12-29

8.  Human Toll-like receptor 4 polymorphisms TLR4 Asp299Gly and Thr399Ile influence susceptibility and severity of pulmonary tuberculosis in the Asian Indian population.

Authors:  N Najmi; G Kaur; S K Sharma; N K Mehra
Journal:  Tissue Antigens       Date:  2010-04-08

9.  Phylogenetic variation and polymorphism at the toll-like receptor 4 locus (TLR4).

Authors:  I Smirnova; A Poltorak; E K Chan; C McBride; B Beutler
Journal:  Genome Biol       Date:  2000-04-27       Impact factor: 13.583

10.  Frequency of TLR 2, 4, and 9 gene polymorphisms in Chinese population and their susceptibility to type 2 diabetes and coronary artery disease.

Authors:  Fengjing Liu; Weixin Lu; Qiaohui Qian; Weigang Qi; Jifan Hu; Bo Feng
Journal:  J Biomed Biotechnol       Date:  2012-10-03
View more
  14 in total

1.  Toll-like receptor polymorphisms and tuberculosis susceptibility: A comprehensive meta-analysis.

Authors:  Qin Sun; Qing Zhang; He-Ping Xiao; Chong Bai
Journal:  J Huazhong Univ Sci Technolog Med Sci       Date:  2015-04-16

2.  Association between vitamin D receptor polymorphisms and haplotypes with pulmonary tuberculosis.

Authors:  Saeedeh Salimi; Farzaneh Farajian-Mashhadi; Roya Alavi-Naini; Golbarg Talebian; Mehrnaz Narooie-Nejad
Journal:  Biomed Rep       Date:  2014-12-15

3.  Association of Toll like receptor 2 and 9 gene variants with pulmonary tuberculosis: exploration in a northern Indian population.

Authors:  Mayank Mittal; Sanjay Kumar Biswas; Vandana Singh; Nidhi Arela; Vishwa Mohan Katoch; Ram Das; Virendra Singh Yadav; Bharat Bajaj; Keshar Kunja Mohanty
Journal:  Mol Biol Rep       Date:  2018-04-19       Impact factor: 2.316

4.  TLR9 gene region polymorphisms and susceptibility to tuberculosis in Vietnam.

Authors:  A D Graustein; D J Horne; M Arentz; N D Bang; T T H Chau; G E Thwaites; M Caws; N T T Thuong; S J Dunstan; T R Hawn
Journal:  Tuberculosis (Edinb)       Date:  2015-01-07       Impact factor: 3.131

5.  Relationship between tool-like receptor 4 gene polymorphism and the susceptibility to pulmonary tuberculosis.

Authors:  Aikeremujiang Muheremu; Junyao Jiang; Maihemuti Yakufu; Abudunaibi Aili; Lei Li; Zhaohui Luo
Journal:  Am J Transl Res       Date:  2022-06-15       Impact factor: 3.940

6.  Pulmonary mucosal immunity mediated through CpG provides adequate protection against pulmonary Mycobacterium tuberculosis infection in the mouse model. A role for type I interferon.

Authors:  Amber Troy; Sandra C Esparza-Gonzalez; Alicia Bartek; Elizabeth Creissen; Linda Izzo; Angelo A Izzo
Journal:  Tuberculosis (Edinb)       Date:  2020-06-06       Impact factor: 3.131

7.  Association between toll-like receptors 9 (TLR9) gene polymorphism and risk of pulmonary tuberculosis: meta-analysis.

Authors:  Zhi Chen; Wei Wang; Jianqin Liang; Jinhe Wang; Shisheng Feng; Guangyu Zhang
Journal:  BMC Pulm Med       Date:  2015-05-08       Impact factor: 3.317

Review 8.  TLR1, 2, 4, 6 and 9 Variants Associated with Tuberculosis Susceptibility: A Systematic Review and Meta-Analysis.

Authors:  Haiko Schurz; Michelle Daya; Marlo Möller; Eileen G Hoal; Muneeb Salie
Journal:  PLoS One       Date:  2015-10-02       Impact factor: 3.240

9.  Association of polymorphisms in Toll-like receptors 4 and 9 with risk of pulmonary tuberculosis: a meta-analysis.

Authors:  Lianli Zhao; Kehun Liu; Xiangjun Kong; Zhenxia Tao; Yanxia Wang; Ying Liu
Journal:  Med Sci Monit       Date:  2015-04-18

10.  Association between Toll-Like Receptor 4 and Occurrence of Type 2 Diabetes Mellitus Susceptible to Pulmonary Tuberculosis in Northeast China.

Authors:  Yuze Li; Dianzhong Li; Jinfeng Zhang; Shurui Liu; Haijun Chen; Kun Wu
Journal:  Stem Cells Int       Date:  2016-03-31       Impact factor: 5.443

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.