Literature DB >> 23755297

Molecular characterization and functions of fatty acid and retinoid binding protein gene (Ab-far-1) in Aphelenchoides besseyi.

Xi Cheng1, Yu Xiang, Hui Xie, Chun-Ling Xu, Teng-Fei Xie, Chao Zhang, Yu Li.   

Abstract

Rice white tip nematode, Aphelenchoides besseyi, is a kind of plant parasitic nematodes that cause serious losses in rice and many other crops. Fatty acid and retinoid binding protein (FAR) is a specific protein in nematodes and is related to development, reproduction, infection to the host, and disruption of plant defense reactions, so the inhibition of FAR function is the potential approach to control A. besseyi. The full-length of Ab-far-1 cDNA is 805 bp, including 546 bp of ORF that encodes 181 amino acids. Software analysis revealed that the Ab-FAR-1 was rich in α-helix structure, contained a predicted consensus casein kinase II phosphorylation site and a hydrophobic secretory signal peptide, but did not have glycosylation sites. The Ab-FAR-1 had 52% homology to Gp-FAR-1 protein. The Ab-FAR-1 and Gp-FAR-1 were grouped in the same branch according to the phylogenetic tree. Fluorescence-based ligand binding analysis confirmed that the recombinant Ab-FAR-1 (rAb-FAR-1) bound with the fluorescent analogues 11-((5-dimethylaminonaphthalene-1-sulfonyl) amino) undecannoic acid (DAUDA), cis-parinaric acid and retinol, but the oleic acid would compete with the binding site. Quantitative PCR (qPCR) was used to assess the expression level of Ab-far-1 at different development stages of A. besseyi, the highest expression was found in the females, followed by eggs, juveniles and males. Using in situ hybridization technique, Ab-far-1 mRNA was present in the hypodermis of juveniles and adults, the ovaries of females and the testes of males. When A. besseyi was treated with Ab-far-1 dsRNA for 48 h, the silencing efficiency of Ab-far-1 was the best and the number of nematodes on the carrot was the least. Thus FAR plays important roles in the development and reproduction of nematodes. This study is useful and helpful to figure out a new way to control the plant parasitic nematodes.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23755297      PMCID: PMC3673936          DOI: 10.1371/journal.pone.0066011

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Rice white tip nematode, Aphelenchoides besseyi, is a kind of foliar nematodes that feed ecto- or endoparasitically above-ground parts of plant, it can parasite in more than 200 kinds of plants in 35 genera. Rice (Oryza sativa) and strawberry (Fragaria ananasa) are the most common hosts [1], [2]. A. besseyi is widely distributed and occurs in most rice growing areas of the world, and rice yield is reduced by 10%–71% in the occurred paddies [3]. At present, chemical seed treatment and soil application are the main approaches to control A. besseyi. But there are some risks of damaging the germination after treatment. On the other hand, chemical nematicide has not been recommended due to its high toxicity. With the development of molecular biology, the genetic engineering technology has been applied in the genome research of plant parasitic nematodes. The molecular methods are widely used to study the effective and safe way to prevent plant parasitic nematodes. Therefore, the studies on the genes that are related to the life activity and infection mechanism of plant parasitic nematodes are very important. In the processes of development and infection to the host, plant parasitic nematodes require fatty acids and retinol for lipid biosynthesis and assembly of macromolecular structures, but they are unable to synthesize fatty acids and retinol by themselves. To sustain their life activities, plant parasitic nematodes have to obtain these metabolites from their hosts and the environment through the lipid binding proteins (LBPs) [4], [5]. Nematodes have been found to produce a series of unusual proteins that exhibit high affinity binding to lipid, and these proteins can be divided into two different classes according to their molecular weight and structure features: polyprotein allergens/antigens (NPAs) and fatty acid and retinoid binding proteins (FARs) [6], [7]. FAR proteins which are rich in helix structure have different structure from proteins of similar biochemical function from other organism groups. FARs promote the absorption, transportation and specific localization of fatty acid and retinoid [4], [8]. Retinol plays important roles in gene activation, cell signaling, and tissue differentiation and repairation [5], [7], [8]. Thus the secreted FARs can help nematodes not only to obtain the lipid nutrition from the host, but also to infect the host and inhibit the host defense mechanism. The first identified FAR protein was the Ov-FAR-1 (formerly known as Ov20) from Onchocerca volvulus [9]. Ov-FAR-1 can promote the infection by reducing the defense of host, and cause worse damage to the host [9], [10]. Eight FARs have been identified in the model nematode Caenorhabditis elegans, named Ce-far-1 to 8 [7]. FARs have also been found in animal parasitic nematodes, including Ancylostoma caninum, Brugia malayi, Brugia pahangi, Ancylostoma ceylanicum, Acanthocheilonema viteae, Ascaris suum, Heligmosomoides polygyrus, Onchocerca gutturosa, Onchocerca dukei, Onchocerca ochengi, Loa loa, Wuchereria bancrofti, and Litomosoides sigmodontis [5], [8], [11], [12], [13], [14]. In plant parasitic nematodes, however, only one FAR from Globodera pallida (Gp-FAR-1) has been identified, which is present in the hypodermis of second-stage juvenile and is related to the defense system of plant host at the initial infection stage [15]. FAR plays a critical role in the development and infection processes of plant parasitic nematodes [15]. As an effective target, FAR has been attracted much attention to control plant parasitic nematodes. According to the expressed sequence tag (EST) of FAR gene from cDNA library of A. besseyi, we amplified the full-length cDNA of FAR gene from A. besseyi (Ab-far-1) and analyzed the structure and feature of Ab-far-1 gene with the bioinformatic method. We used fluorescence-based binding assays to investigate the binding activity of bacterial recombinant Ab-FAR-1 to fatty acid and retinol. We localized the Ab-far-1 mRNA at different development stages by in situ hybridization and detected the expression level of Ab-far-1 by quantitative PCR (qPCR). In addition, the function of Ab-far-1 gene was investigated by RNA interference (RNAi) approach. This is the first study to identify and analyze the Ab-far-1 gene, and to investigate its function using RNAi technique.

Materials and Methods

Ethics statement

We collected the nematodes in areas where rice white tip nematodes occurred and no specific permit was required. The field for nematodes collection was neither privately owned nor protected, and did not involve endangered or protected species.

Nematodes

A. besseyi used in this study was collected from the leaves of infected O. sativa in Nanjing City, Jiangsu Province, China where A. besseyi occurred and identified by laboratory of plant nematology, South China Agricultural University. A. besseyi was preserved and cultured on excised carrot (Daucus carota) disks in Petri dishes at 25°C in dark incubator [3], [16].

Nematode extraction

The carrot callus inoculated with A. besseyi for 30 days was mashed with a blender. The mashed solution was filtered through the combine sieves with aperture size of 0.147 mm and 0.026 mm. Nematodes were collected from 0.026 mm aperture sieve in a beaker and Petri dishes.

Cloning of full-length FAR gene from A. besseyi

Total RNA of 20,000 mixed stages nematodes was extracted with TRIzol reagent (Invitrogen, Carlbard, CA, USA), then treated with RQ1 RNase-Free DNase (Promega, Madison, WI, USA) at 37°C for 15 min. The cDNA sequences were amplified by a SMART RACE cDNA Amplification kit (Clontech, Japan). According to the EST sequences of A. besseyi FAR gene that was screened from the cDNA library of A. besseyi in our lab (unpublished, Fig. S1), 5' RACE primers (FAR-R1 and FAR-R2) and 3' RACE primers (FAR-F1and FAR-F2) (Table 1) were designed to amplify the cDNA sequence. The amplification products were purified and ligated into the pMD 18-T vector (Takara, Japan), and then transformed into Escherichia coli JM109 competent cells. The positive clones were sent to BGI Company for sequencing. Based on the sequencing results of the 5' and 3' RACE products, the specific primers of QCFF and QCFR (Table 1) were designed and used to amplify the full-length cDNA of A. besseyi FAR gene.
Table 1

Primers used in this study.

PrimerSequenceSource
FAR-F1 5′-GAGACTTTCCCGCAAATCACC-3′
FAR-F2 5′- ATCGACACCTACAAGAAATTGGCTG -3′
FAR-R1 5′- GCAGATGATTGTGACCGTTTAGTTC -3′
FAR-R2 5′- GATTGAAGCAGATGATTGTGACCGT -3′
QCFF 5′- CGTTGTTTCAGTAACTCACATCTTT -3′
QCFR 5′- GAACATACGAATACAACTAAAAGGA -3′
FARf-BamHI 5′-GAGAGAGGATCCAGCCTTCGTACCTTCGTTGT-3′
FARr-XhoI 5′-GAGAGACTCGAG GCAGATGATTGTGACCGTTTA-3′
18sF 5′- CTCGTGGTGGCTGGTATGCTG -3′
18sR 5′- GTTTCCCGTGTTGAGTCAAATTAAG -3′
qPCR-F 5′- TCGCTCTTCTGTCTTGCCATG -3′
qPCR-R 5′- GATGGATTTGTCTTCATCGGTA -3′
FAR-IN-T7S1 5′-TAATACGACTCACTATAGGGGCCTTCGTACCTTCGTTGTCTTG -3′
FAR-IN-A1 5′- GTTCTGGCACTTGTTGAATGCTC -3′
FAR-IN-T7A1 5′-TAATACGACTCACTATAGGGGTTCTGGCACTTGTTGAATGCTC-3′
FAR-IN-S1 5′- GCCTTCGTACCTTCGTTGTCTTG -3′
FARRiF 5′- TACGCCGAACTTACCGATGAA -3′
FARRiT7R 5′-TAATACGACTCACTATAGGGCAAGTCTGGCTTCTCTTCACCC -3′
FARRiT7F 5′-TAATACGACTCACTATAGGGTACGCCGAACTTACCGATGAA -3′
FARRiR 5′- CAAGTCTGGCTTCTCTTCACCC -3′
G-T7S5′-GGATCCTAATACGACTCACTATAGGGCACAAGTTCAGCGTGTCCGGCG-3 -3′Zhang et al., 2012
G-A 5′- CGATGCGGTTCACCAGGGTGTCG -3′ Zhang et al., 2012
G-T7A 5′-GGATCCTAATACGACTCACTATAGGG CGATGCGGTTCACCAGGGTGTCG -3′ Zhang et al., 2012
G-S 5′- CACAAGTTCAGCGTGTCCGGCG -3′ Zhang et al., 2012

Sequence analysis, alignment and phylogenetic studies

Sequence homology comparisons were conducted using BLASTX and BLASTN (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The protein transmembrane regions, theoretical isoelectric point, molecular weight, hydrophobicity and glycosylation sites were predicted by the Protein Machine software available at the Expasy site (http://www.expasy.ch/tools/). Predictions of a signal peptide for secretion and the cleavage site were performed at http://www.cbs.dtu.dk/services/SignalP/. The prediction of protein localization site was performed at http://psort.hgc.jp/form2.html. A theoretical 3D structure of Ab-FAR-1 was constructed with the automated mode of SWISS-MODEL. The amino acid sequences of FAR protein from A. besseyi and other six FAR proteins from four species of nematodes [17] were aligned using DNAMAN software (Lynnon Biosoft, Canada). Based on the amino acid sequences of Ab-FAR-1 and other 25 FAR proteins from 16 species of nematodes, a phylogenetic tree was constructed by the neighbor-joining method [18] with MEGA (Molecular Evolutionary Genetics Analysis, USA).

Expression and purification of recombinant Ab-FAR-1

To obtain purified Ab-FAR-1 protein,the full-length Ab-far-1 was amplified from the plasmid with primers FARf-BamHI and FARr-XhoI (Table 1), then cloned into prokaryotic expression vector pET-32a (Novagen, Madison, WI, USA) after digestion with BamHI and XhoI. The plasmid was introduced into E. coli DH5α for sequence confirmation. Recombinant plasmid DNA was introduced into E. coli BL21(DE3)for expression. Expression of the recombinant protein was examined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie brilliant blue staining after treatment with 1 mM isopropyl β-D-thiogalactopyranoside (IPTG). The recombinant fusion Ab-FAR-1 protein with His-tag at the N-terminus was purified by affinity chromatography using Ni Sepharose High Performanc (GE Healthcare, Sweden) according to the manufacturer's instructions. The purity of purified recombinant protein was confirmed by SDS-PAGE.

Ligand-binding experiments

The binding activity of purified Ab-FAR-1 protein to fatty acid was measured using the fluorescent analogue 11-((5-dimethylaminonaphthalene-1-sulfonyl) amino) undecannoic acid (DAUDA) (Sigma, USA), the naturally fluorescent cis-parinaric acid (Molecular Probes) (Cayman, USA), retinol (Sigma, USA) and oleic acid (Sigma, USA). Fluorescence measurements were performed at 20°C with FluoroMax 4 (HORIBA Jobin Yvon, France) in a total volume of 3 ml per well as described previously [15], [19]. The excitation wavelengths used for DAUDA, retinol and cis-parinaric acid were 345, 350 and 319 nm, respectively. DAUDA, cis-parinaric acid and oleic acid were prepared at 10 mM stock solution in ethanol. DAUDA and oleic acid were used at 1∶1000 dilutions in PBS; while cis-parinaric acid was diluted at 1∶2000 in PBS. Free retinol was freshly prepared at 10 mM in ethanol and further diluted at 1∶1000 in ethanol and added directly to the protein solutions. Dissociation constants were estimated in fluorescence titration experiments as described previously [5], [15], [19]. The dissociation constant (Kd) for rAb-FAR-1 binding to DAUDA and cis-parinaric acid were estimated by adding increasing concentrations of rAb-FAR-1 to 10 µM DAUDA in PBS and 10 µM cis-parinaric acid in PBS (total volume of 3 ml), respectively. To determine the Kd for rAb-FAR-1 binding to retinol, increasing concentrations of fluorescent ligand were added to 10 µM Ab-FAR-1 solution in Tris-HCl buffer. Fluorescence data were corrected for dilution and fitted by standard nonlinear regression techniques (using Microcal ORIGIN software) to a single noncompetitive binding model to give estimation of the dissociation constant (Kd) and maximal fluorescence intensity (Fmax).

Expression of Ab-far-1 mRNA at different development stages of A. besseyi

qPCR was used to assess the expression levels of Ab-far-1 at different development stages of A. besseyi: females, males, juveniles and eggs. RNA samples were prepared from 100 nematodes at each developmental stage using the MicroElute total RNA kit (OMEGA) according to the manufacturer's instructions. Total RNA was treated with RQ1 RNase-Free DNase (Promega) as described above. The RNA was quantified by a Nano-drop spectrophotometer and stored at -80°C for further analysis. All RNAs used for qPCR were prepared in triplicate. cDNA was synthesized by a ReverTra Ace qPCR RT kit (TOYOBO) with random primers according to the manufacturer's instructions. The specific primers qPCR-F and qPCR-R (Table 1) for Ab-far-1 were designed to detect Ab-far-1 expression level. The 140 bp of 18S rRNA (AY508035) was amplified as a reference gene using the primers 18sF and 18sR (Table 1). The qPCR was performed on CFX-96 (Bio-Rad) qPCR machine using SYBR Green Real-time PCR Master Mix-plus kit (TOYOBO) according to the manufacture's protocol. All assays were performed in triplicate. Initial data analysis was carried out to create Ct values using Bio-Rad CFX-96 manager software and to determine the relative expression level by the melt curves. 18S rRNA was used as a positive control in all experiments. All experiments were performed in triplicate.

Localisation of Ab-far-1 mRNA by using in situ hybridization

In situ hybridization was performed as described by De Boer et al. [20] with some modifications. 10,000 mixed stages nematodes, including females, males and juveniles separated from carrot callus were concentrated to a 30–50 µl pellet and fixed in 3% paraformaldehyde at 4°C for 16 h. The specific sense (FAR-IN-T7S1, FAR-IN-A1) and antisense (FAR-IN-T7A1, FAR-IN-S1) (Table 1) primers were designed to amplify DIG-labelled sense and antisense RNA probes (Roche, Germany) from full-length cDNA of Ab-far-1 gene. DIG-labelled sense or antisense RNA probe was added to the hybridization solution containing the nematode sections, and then rotated at 47°C for 12 h. After hybridization, the nematodes were examined and photographs were taken with differential interference microscopy.

Synthesis of Ab-far-1 dsRNA

The fragment of Ab-far-1 ORF was cloned into the vector pMD18-T (Takara, Japan), and confirmed by sequencing. Two primer pairs of FARRiF/FARRiT7R and FARRiT7F/FARRiR (Table 1) were designed to amplify the sense and antisense single-stranded RNA (ssRNA) products. The sense and antisense ssRNAs were transcribed from Ab-far-1 plasmid using the ScriptMAX Thermo T7 Transcription KIT (TOYOBO, Japan) according to the manufacturer's instructions, and mixed together in equal proportions and heated at 94°C for 10 min, then cooled to room temperature to allow the annealing of complementary strands. The dsRNA was purified with 1/10 amount of KAc (3 mol/l) and 2-fold amount of 95% ethanol overnight, then washed with 75% ethanol for 3 times and dissolved in deionized water. The quantity of dsRNA was measured by a Nano-drop spectrophotometer and analyzed by 1.2% agarose gel electrophoresis, and finally stored at −80°C for later use. Non-endogenous control dsRNA (125 bp) (green fouorescent protein gene, gfp) was generated with specific primers (G-T7S, G-A, G-T7A, and G-S) (Table 1) [21].

Knockdown of Ab-far-1 using dsRNA

500 mixed stage nematodes separated from carrot callus were collected in a DEPC-treated Eppendorf tube and washed twice with DEPC water, and then soaked in 50 µl Ab-far-1 dsRNA solution (2 µg/μl) and lightly shook in a rotary incubation (200 rpm) for 12 h, 24 h, 36 h and 48 h in the dark at 25°C. Non-endogenous gfp dsRNA solution 50 µl (2 µg/μl) was used as a control. After soaking in dsRNA, the nematodes were washed three times with DEPC water and the total RNA was then extracted by the MicroElute total RNA kit (OMEGA) as described above. qPCR was used to analyze the transcript suppression of Ab-far-1 in A. besseyi after dsRNA treatment. All assays were performed in triplicate. To test the reproductive capacity of Ab-far-1 silenced nematodes, thirty female nematodes separated from carrot callus were treated with dsRNA for 12 h, 24 h, 36 h and 48 h respectively. Then all nematodes were inoculated onto carrot callus and maintained in a dark incubator at 25°C for 35 days. Isolating and calculating the number of total nematodes in the carrot callus at last. Each treatment was carried out in 5 duplicates. All data in this study were subjected to analysis of variance (ANOVA) and multiple comparisons of means were conducted by Duncan's Multiple Range Test at p = 0.01 using SAS (Release 8.01).

Results

According to the EST sequences (486 bp) of FAR gene from cDNA library of A. besseyi, the specific primers for FAR gene were designed to amplify the 805 bp full-length cDNA sequence and cloned into pMD 18-T vector. The plasmid was named Ab-far-1, which included a 546 bp of open reading frame (ORF) for encoding a deduced 181 amino acids (GenBank accession number JQ686690) (Fig. S2). The ORF began with an ATG initiation codon at nucleotide 93 and terminated with TAA at nucleotide 638 (Fig. S2).

Sequence analysis of the Ab-FAR-1 protein

The Ab-FAR-1 protein encoded 181 amino acids with theoretical molecular mass of 20.5217 kDa, the molecular formula was C923H1514N238O280S3 with a theoretical isoelectric point of 6.66. The location site of Ab-FAR-1 protein was predicted in extracellular compartment (including cell wall). Ab-FAR-1 sequences had the highest similarity with the Gp-FAR-1 protein from G. pallida (GenBank accession number CAA70477.2, 52% identity and 73% similarity, E-value 1e-51) and the FAR from O. ochengi (GenBank accession number ACB70198.1, 51% identity and 73% similarity, E-value 1e-54). Ab-FAR-1 also showed higher similarities with the Ov-FAR-1 from O. volvulus (GenBank accession number Q25619, 50% identity and 73% similarity, E-value 8e-56) and Og-FAR-1 from O. gutturosa (GenBank accession number Q8WT59, 50% identity and 73% similarity, E-value 1e-55). Like other six FARs from four species of nematodes [17], Ab-FAR-1 protein contained a hydrophobic secretory signal peptide and was rich in α-helix but no extended β structure (Fig. S3). Moreover, the Ab-FAR-1 also contained a conserved casein kinase II phosphorylation site, but did not have the glycosylation sites like Ce-FAR-1 and Ce-FAR-2. In the phylogenetic tree (Fig. 1) constructed by the Ab-FAR-1 amino acid sequences and other 25 FAR proteins from 16 species of nematodes, Ab-FAR-1 of Aphelenchida nematode A. besseyi and Gp-FAR-1 of Tylenchida nematode G. pallida were present in the same branch of the phylogenetic tree, which suggests that they have a closer genetic relationship. In addition, all these 26 FAR proteins from 17 species of nematodes were divided into 6 groups: Spirurida, Ascaridida, Tylenchida, Aphelenchida, Strongylida, and Rhabditida.
Figure 1

Phylogenetic relationships among the amino acid sequences of fatty acid and retinoid binding proteins in nematodes.

Phylogram was constructed according to amino acid sequences depicting the evolutionary relationships among fatty acid and retinoid binding proteins of 26 different nematode species, Aphelenchoides besseyi FAR-1 highlighted by the underline. Accession number of the sequences was in brackets.

Phylogenetic relationships among the amino acid sequences of fatty acid and retinoid binding proteins in nematodes.

Phylogram was constructed according to amino acid sequences depicting the evolutionary relationships among fatty acid and retinoid binding proteins of 26 different nematode species, Aphelenchoides besseyi FAR-1 highlighted by the underline. Accession number of the sequences was in brackets.

Ligand binding

SDS-PAGE showed that the recombinant Ab-FAR-1 was well purified, with only one band of approximately 19-20 KDa, which was consistent with theoretical molecular mass (20 KDa) of Ab-FAR-1 (Fig. S4). The purified rAb-FAR-1 was found to bind the dansylated fatty acid DAUDA because a significant wavelength shift of peak fluorescence emission was observed (Fig. 2A). In buffer alone, the peak emission of DAUDA occurred at 537 nm, but moved to 463 nm upon addition of rAb-FAR-1 (Fig. 2A). The wavelength shift indicates that rAb-FAR-1 has a highly apolar binding site, and the degree of shift is unusually large for lipid transporter proteins but typical for FAR protein. These characteristics have been demonstrated by previous studies [13], [15], [17], [22], [23], [24], [25], [26]. After the addition of oleic acid to DAUDA, protein complex produced a pronounced drop in the fluorescence intensity (487 nm) (Fig. 2A), indicating the oleic acid can displace DAUDA from the binding site. The retinol binding activity of purified Ab-FAR-1 test showed that the fluorescence emission of retinol was minimal in buffer alone, but was substantially increased to 461 nm when the retinol was added to the rAb-FAR-1 solution (Fig.2B). After the addition of oleic acid to retinol, the protein complex produced an obvious drop in the fluorescence intensity (467 nm) (Fig.2B). rAb-FAR-1 was also found to bind the intrinsically fluorescent cis-parinaric acid. In control buffer, the emission peak of cis-parinaric acid appeared at 410 nm, but moved to 412 nm upon addition of rAb-FAR-1 (Fig.2C). The effects of subsequent addition of retinol to the rAb-FAR-1+cis-parinaric acid and addition of oleic acid solution to the rAb-FAR-1+cis-parinaric acid+ retinol were different (Fig.2C). These results indicate that the retinol and fatty acid binding sites are congruent, overlapping, or interactive, and the addition of oleic acid can competitively displace cis-parinaric acid.
Figure 2

Ligand binding by rAb-FAR-1.

(A) Ab-FAR-1. The reverse change of DAUDA emission was observed after the addition of oleic acid to the rAb-FAR-1+DAUDA complex. The wavelengths of peak emission by DAUDA were different. (B) Fluorescence emission spectra (excitation at 350 nm) of retinol in ethanol alone or after the addition of rAb-FAR-1. The competitive effect of oleic acid was also found. (C) Fluorescence emission spectra (excitation at 319 nm) of cis-parinaric acid alone or after the addition of rAb-FAR-1.The effects of the subsequent addition of retinol to the rAb-FAR-1+cis-parinaric acid and addition of oleic acid solution to the rAb-FAR-1+cis-parinaric acid+ retinol were examined.

Ligand binding by rAb-FAR-1.

(A) Ab-FAR-1. The reverse change of DAUDA emission was observed after the addition of oleic acid to the rAb-FAR-1+DAUDA complex. The wavelengths of peak emission by DAUDA were different. (B) Fluorescence emission spectra (excitation at 350 nm) of retinol in ethanol alone or after the addition of rAb-FAR-1. The competitive effect of oleic acid was also found. (C) Fluorescence emission spectra (excitation at 319 nm) of cis-parinaric acid alone or after the addition of rAb-FAR-1.The effects of the subsequent addition of retinol to the rAb-FAR-1+cis-parinaric acid and addition of oleic acid solution to the rAb-FAR-1+cis-parinaric acid+ retinol were examined. Fluorescence titration experiments were performed to determine the binding affinity of DAUDA, retinol and cis-parinaric acid. Figure 3 showed typical saturation binding curves for each of the three fluorescent ligands. The titration curve (corrected for the background fluorescence of DAUDA) in Figure 3A predicted a Kd of 3.405×10−6 M for the Ab-FAR-1: DAUDA interaction. We also demonstrated binding of Ab-FAR-1 to retinol (Kd of 3.408×10−6 M) (Fig. 3B) and cis-parinaric acid (Kd of 6.693×10−6 M) (Fig. 3C). These values were within the general range of dissociation constants reported for other FAR proteins [5], [7], [8], [15], [19]. The results indicate that Ab-FAR-1 is a functional protein and has binding activities to fatty acid and retinol in vitro.
Figure 3

Fluorescent titration lipid binding analysis of rAb-FAR-1.

(A) Change in relative fluorescence intensity (excitation at 345 nm) of DAUDA (10 µM) in the presence of increasing concentrations of rAb-FAR-1. The best fit curve was used to determine the dissociation constant (Kd) for the DAUDA: rAb-FAR-1 interaction. (B) Change in relative fluorescence intensity (excitation at 350 nm) of 10 µM rAb-FAR-1 in the presence of increasing concentrations of retinol. The curve was used to derive the equilibrium dissociation constant (Kd) for the retinol: rAb-FAR-1 interaction. (C) Change in relative fluorescence intensity (excitation at 319 nm) of cis-parinaric acid (10 µM) in the presence of increasing concentrations of rAb-FAR-1. The best fit curve was used to determine the dissociation constant (Kd) for the cis-parinaric acid: rAb-FAR-1 interaction.

Fluorescent titration lipid binding analysis of rAb-FAR-1.

(A) Change in relative fluorescence intensity (excitation at 345 nm) of DAUDA (10 µM) in the presence of increasing concentrations of rAb-FAR-1. The best fit curve was used to determine the dissociation constant (Kd) for the DAUDA: rAb-FAR-1 interaction. (B) Change in relative fluorescence intensity (excitation at 350 nm) of 10 µM rAb-FAR-1 in the presence of increasing concentrations of retinol. The curve was used to derive the equilibrium dissociation constant (Kd) for the retinol: rAb-FAR-1 interaction. (C) Change in relative fluorescence intensity (excitation at 319 nm) of cis-parinaric acid (10 µM) in the presence of increasing concentrations of rAb-FAR-1. The best fit curve was used to determine the dissociation constant (Kd) for the cis-parinaric acid: rAb-FAR-1 interaction.

Expression and localization of Ab-far-1 mRNA

The qPCR results showed that Ab-far-1 mRNA transcript was present in all developmental stages, the highest transcript levels noted in females, while its expression in eggs, juveniles and males accounted for 25%, 14.9%, and 4.7% of the expression level in females, respectively (Fig. 4). The results of in situ hybridization showed that Ab-far-1 mRNA was present in the hypodermis of juveniles (Fig. 5C), the hypodermis and ovaries of females (Fig. 5 D, E), and in the hypodermis and testes of males (Fig. 5F). No hybridization signal was detected in the nematodes after incubation with the control sense probe (Fig. 5A, B).
Figure 4

Expression of the Ab-far-1 in 100 eggs, females, juveniles and males, respectively of Aphelenchoides besseyi.

Bars indicate standard errors of mean data (n = 3) and different letters indicate significant differences (p<0.01) between treatments.

Figure 5

Tissue localisation of Ab-far-1 mRNA in juveniles, females and males of Aphelenchoides besseyi using in situ hybridization.

(A and B) No signal in A. besseyi section was hybridized with sense Ab-far-1 DIG- Labeled RNA probe. (C) Ab-far-1 was present in the hypodermis of juveniles. (D) Ab-far-1 was present in the hypodermis of females. (E) Ab-far-1 was present in the ovaries of females. (F) Ab-far-1 was present in the hypodermis and testes of males. st: stylet, mb: medium bulb, h: hypodermis, ov: ovaries, v: vulva, t: testis.

Expression of the Ab-far-1 in 100 eggs, females, juveniles and males, respectively of Aphelenchoides besseyi.

Bars indicate standard errors of mean data (n = 3) and different letters indicate significant differences (p<0.01) between treatments.

Tissue localisation of Ab-far-1 mRNA in juveniles, females and males of Aphelenchoides besseyi using in situ hybridization.

(A and B) No signal in A. besseyi section was hybridized with sense Ab-far-1 DIG- Labeled RNA probe. (C) Ab-far-1 was present in the hypodermis of juveniles. (D) Ab-far-1 was present in the hypodermis of females. (E) Ab-far-1 was present in the ovaries of females. (F) Ab-far-1 was present in the hypodermis and testes of males. st: stylet, mb: medium bulb, h: hypodermis, ov: ovaries, v: vulva, t: testis.

The effect of RNAi

After treatment with Ab-far-1 dsRNA, the expression of Ab-far-1 mRNA in A. besseyi was detected by the qPCR. Compared with the relative expression level of Ab-far-1 mRNA in the corresponding control nematodes (gfp dsRNA treatment), the relative expression of Ab-far-1 mRNA in nematodes treated with Ab-far-1 dsRNA was reduced by 63.2% at 12 h, 55.1% at 24 h, 71.8% at 36 h, and 76% at 48 h (Fig. 6). The expression level of Ab-far-1 mRNA was reduced with the increasing incubation time with dsRNA, while the non-endogenous gfp dsRNA control had no effect on the expression of Ab-far-1 mRNA at different time points.
Figure 6

Expression of the Ab-far-1 mRNA in Aphelenchoides besseyi treated with Ab-far-1 double-stranded (ds) RNA.

G12, G24, G36 and G48 indicates expression of Ab-far-1 mRNA in control nematodes soaked by non-endogenous gfp dsRNA solution for 12 h, 24 h, 36 h and 48 h, respectively. F12, F24, F36 and F48 indicates expression of Ab-far-1 mRNA in nematodes soaked by Ab-far-1 dsRNA for 12 h, 24 h, 36 h and 48 h, respectively. Bars indicate standard errors of mean data (n = 3) and different letters indicate significant differences (p<0.01) between treatments.

Expression of the Ab-far-1 mRNA in Aphelenchoides besseyi treated with Ab-far-1 double-stranded (ds) RNA.

G12, G24, G36 and G48 indicates expression of Ab-far-1 mRNA in control nematodes soaked by non-endogenous gfp dsRNA solution for 12 h, 24 h, 36 h and 48 h, respectively. F12, F24, F36 and F48 indicates expression of Ab-far-1 mRNA in nematodes soaked by Ab-far-1 dsRNA for 12 h, 24 h, 36 h and 48 h, respectively. Bars indicate standard errors of mean data (n = 3) and different letters indicate significant differences (p<0.01) between treatments. After being treated with dsRNA for 12 h, 24 h, 36 h and 48 h and inoculated onto carrot callus for 35 days, A. besseyi treated with Ab-far-1 dsRNA had significantly (p<0.01) lower reproduction than those treated with gfp dsRNA at all time points. The reproduction of nematodes was significantly (p<0.01) decreased with the increasing exposure time to Ab-far-1 dsRNA. The reproduction of nematodes treated with gfp dsRNA did not show difference at different treatment time points (Fig. 7).
Figure 7

Number of Aphelenchoides besseyi on carrot callus after inoculation of 30 females 35 days later, respectively.

G12, G24, G36 and G48 indicates number of A. besseyi after inoculating 30 females treated by non-endogenous gfp dsRNA solution for 12 h, 24 h, 36 h and 48 h, respectively. F12, F24, F36 and F48 indicates number of A. besseyi after inoculating 30 females treated by Ab-far-1 dsRNA for 12 h, 24 h, 36 h and 48 h, respectively. Bars indicate standard errors of mean data (n = 5) and different letters indicate significant differences (p<0.01) among treatments.

Number of Aphelenchoides besseyi on carrot callus after inoculation of 30 females 35 days later, respectively.

G12, G24, G36 and G48 indicates number of A. besseyi after inoculating 30 females treated by non-endogenous gfp dsRNA solution for 12 h, 24 h, 36 h and 48 h, respectively. F12, F24, F36 and F48 indicates number of A. besseyi after inoculating 30 females treated by Ab-far-1 dsRNA for 12 h, 24 h, 36 h and 48 h, respectively. Bars indicate standard errors of mean data (n = 5) and different letters indicate significant differences (p<0.01) among treatments.

Discussion

FAR protein is a specific protein only in the nematodes, which plays a critical role in the development and reproduction in nematodes, and in the processes of infecting host [7], [15], [27]. In this study, we obtained the full-length sequences of Ab-far-1 in A. besseyi, which is the first report for the FAR gene in Aphelenchida nematodes. The secondary structure of Ab-FAR-1 was rich in α-helix but without β extended structure, which is an important factor that sets FAR apart from the similar lipid-binding proteins of vertebrates [17], [19], [28], [29], [30], [31]. There are four conserved Proline residues in Ab-FAR-1 and other six FAR proteins amino acid sequences in sequence alignment. Proline is an inclined interrupt helical structure and cannot generate the hydrogen bond to sustain the conformation of α-helix and is an amino acid which requires less free energy to fold [32]. But there is Glutamic or Alanine residue behind the two Proline residues in the middle of first helix. The Glutamic and Alanine are the strongest nucleate α-helices [33], which may influence the secondary structure of FAR. It has been reported that FAR proteins are secreted from the cell to the extracellular environment where they presumably play roles in the sequestration and transport of fatty acids and retinoids to maintain the nematodes normal life activity during the infection to the host [9], [13], [15], [17]. A hydrophobic secretory signal peptide was identified in the Ab-FAR-1 sequences, which indicates Ab-FAR-1 may be secreted from the cell to the extracellular environment. Furthermore, the Ab-FAR-1 also contained a conserved casein kinase II phosphorylation site, which is appeared in all known nematodes FAR proteins [13], [15], [17], [19]. Phosphorylation is known to regulate the biological activities of many proteins, including gene regulation, homodimerisation control and the stability of α-helices [34], [35], [36], [37], [38], [39]. Thus we assume that the phosphorylation sites may play an important role in the process of the infection of A. besseyi to the hosts. It is believed that FAR protein is necessary for the nematodes not only to bind lipids like linoleic and linolenic acids to maintain the metabolism, destroy the plant defense systems and complete the infection, but also to bind retinoid in collagen synthesis, embryonic development and reproduction [8], [15]. In this study, the expression of Ab-far-1 mRNA at different nematode stages showed the expression was highest in females and lowest in males, higher in eggs than in juveniles, which conformed to their individual biological functions. The female of A. besseyi plays key roles in infection and reproduction, while the number and infection ability of male is lower than female and the male is not necessary for the reproduction of the nematode as it is capable of parthenogenesis. The egg and juvenile are responsible for reproduction and infection, respectively, which indicates that this protein may play an important role in the formation of the embryo and cell differentiation. It was also found that the FAR gene expression at different developmental stages was associated the biological functions in animal parasitic nematodes. The Hc-FAR-1 gene expression of Haemonchus contortus was higher in adult than in larvae [27] and AceFAR-1 mRNA expression was lowest in male than other developmental stages of A. ceylanicu [5]. In plant parasitic nematodes G. pallida, Prior [15] reported the gp-far-1 mRNA was present in the second-stage juveniles, virgin females and adult female, but did not analyze the differences of its expression level. In situ hybridization results revealed that Ab-far-1 mRNA was present in the hypodermis of A. besseyi. The cuticle layer, hypodermis and internal muscle layer form the nematode body wall, and the hypodermis is one of the most active areas in the nematodes. The expression of Ab-far-1 in the hypodermis may help nematodes to utilize the fatty acid and retinoid from the hosts and the environment quickly to maintain the autologous metabolism. Meanwhile, Ab-far-1 in the hypodermis may help nematodes to neutralize plant defense and to complete the infection. The gp-far-1 mRNA was localized in the hypodermis of the infectious second-stage juveniles of G. pallida [15]. In addition, Ab-far-1 mRNA was also present in the ovaries of females and the testes of males, but signals appeared diffuse, whether is related to the internal structure of ovaries and testes is not clear because the nematodes were cut off, fixed and hybridized in situ hybridization, it needs further study to be confirmed. In this paper, RNAi was employed to further verify the Ab-far-1 function. To our knowledge, it has not been reported in other nematodes FAR gene study. After the treatment with Ab-far-1 dsRNA, the expression of Ab-far-1 and the reproduction of nematodes were decreased with the increasing exposure time. After treatment with dsRNA for 48 h, the silencing efficiency of Ab-far-1 was the maximum and the reproduction of nematodes was the least. This may be because the FAR protein can bind with fatty acids and retinol. Since the retinol is thought to be essential for collagen synthesis and embryonic development, down-regulation of Ab-far-1 by RNAi leads to less binding with retinol, and thus causes the reduced reproduction in A. besseyi. This evidence further proves the roles of Ab-FAR-1 in the development and reproduction of A. besseyi. The transgenic plant with the expression of specific dsRNA to the target gene in nematodes would result in the inhibition of target gene in nematodes after feeding [40]. Thus, the expression of specific dsRNAs for nematode development-related and parasitic genes in transgenic plants is a potentially way to enhance the resistance to nematodes and to control plant parasitic nematodes. FAR protein is not only a kind of protein related to development, reproduction, infection and interfered the plant defense system, but also a specific protein only existed in the nematodes [7], [27]. Moreover, the Ab-FAR-1 gene has not been found in mammal and other animals, so this transgenic plant containing Ab-FAR-1 dsRNA will not cause any safety issue to the environment and other organisms. Therefore, it is imperative to consider the generation of transgenic plant containing Ab-FAR-1 dsRNA, which will be an effective method to control A. besseyi. EST sequence of fatty acid and retinoid binding protein gene. (TIF) Click here for additional data file. cDNA sequence and its deduced amino acid sequence. atg, Translation starting signal. taa, Translation termination signal. Nucleotide sequence are denoted in lowercase and deduced amino acid sequence are marked in dark gray. (TIF) Click here for additional data file. The structural predictions of -FAR-1 and its amino acid sequence alignments with other nematode FAR proteins. Ov-FAR-1, Onchocerca volvulus FAR (Q25619); Bm-FAR-1, Brugia malayi FAR (Q93142); Gp-FAR-1, Globodera pallida FAR (CAA70477); Ce-FAR-1, Caenorhabditis elegans FAR-1 (NP 499010); Ce-FAR-2, C. elegans FAR-2 (NP 499011); Ce-FAR-6, C. elegans FAR-6 (NP 502561); Ab-FAR-1, A. besseyi FAR-1; Lowercase, putative secretory signal peptides; shaded boxes, positions where amino acids are conserved in all the sequences; underscored, consensus N-linked glycosylation sites; boldface, conserved casein kinase II phosphorylation site; In Consensus line, uppercase amino acids which are conserved at that position in all of the sequences, lowercase amino acid which are conserved at that position in more than half of the sequences, # indicates any of NDQEBZ. The Jpred line shows the secondary strucure prediction from submission of the multiple alignment to the Jpred secondary structure prediction programme. H Prediction for α-helix; gaps regions for which no structural prediction emerged. No β-structure was predicted by Jpred or any other secondary structure prediction programmes. (TIF) Click here for additional data file. Sodium dodecyl sulphate polyacrylamide gel of purified His- -FAR-1 and r -FAR-1. Lane 1, purified His-Ab-FAR-1; Lane 2, purified rAb-FAR-1; Lane M, PageRuler Prestained protein Ladder (Sofar Technology, China). (TIF) Click here for additional data file.
  35 in total

1.  Carrot callus tissue for culture of endoparasitic nematodes.

Authors:  R W Reise; R N Huettel; R M Sayre
Journal:  J Nematol       Date:  1987-07       Impact factor: 1.402

2.  Genetic and structural analysis of the protein stability problem.

Authors:  B W Matthews
Journal:  Biochemistry       Date:  1987-11-03       Impact factor: 3.162

3.  The neighbor-joining method: a new method for reconstructing phylogenetic trees.

Authors:  N Saitou; M Nei
Journal:  Mol Biol Evol       Date:  1987-07       Impact factor: 16.240

4.  Dimerization is required for the activity of the protein histidine kinase CheA that mediates signal transduction in bacterial chemotaxis.

Authors:  M G Surette; M Levit; Y Liu; G Lukat; E G Ninfa; A Ninfa; J B Stock
Journal:  J Biol Chem       Date:  1996-01-12       Impact factor: 5.157

Review 5.  The polyprotein lipid binding proteins of nematodes.

Authors:  M W Kennedy
Journal:  Biochim Biophys Acta       Date:  2000-02-09

6.  The ABA-1 allergen of the parasitic nematode Ascaris suum: fatty acid and retinoid binding function and structural characterization.

Authors:  M W Kennedy; A Brass; A B McCruden; N C Price; S M Kelly; A Cooper
Journal:  Biochemistry       Date:  1995-05-23       Impact factor: 3.162

7.  The complexity of the secreted NPA and FAR lipid-binding protein families of Haemonchus contortus revealed by an iterative proteomics-bioinformatics approach.

Authors:  Lisha Kuang; Michelle L Colgrave; Neil H Bagnall; Malcolm R Knox; Min Qian; Gene Wijffels
Journal:  Mol Biochem Parasitol       Date:  2009-07-15       Impact factor: 1.759

8.  Studies on fatty acid-binding proteins. The detection and quantification of the protein from rat liver by using a fluorescent fatty acid analogue.

Authors:  T C Wilkinson; D C Wilton
Journal:  Biochem J       Date:  1986-09-01       Impact factor: 3.857

9.  Characterisation of an immunodominant glycoprotein antigen of Onchocerca volvulus with homologues in other filarial nematodes and Caenorhabditis elegans.

Authors:  T I Tree; A J Gillespie; K J Shepley; M L Blaxter; R S Tuan; J E Bradley
Journal:  Mol Biochem Parasitol       Date:  1995-02       Impact factor: 1.759

10.  The FAR protein family of the nematode Caenorhabditis elegans. Differential lipid binding properties, structural characteristics, and developmental regulation.

Authors:  Antonio Garofalo; Marie-Claire Rowlinson; Ngwa A Amambua; Jacqueline M Hughes; Sharon M Kelly; Nicholas C Price; Alan Cooper; David G Watson; Malcolm W Kennedy; Janette E Bradley
Journal:  J Biol Chem       Date:  2002-12-26       Impact factor: 5.157

View more
  25 in total

1.  Characterization of Three Novel Fatty Acid- and Retinoid-Binding Protein Genes (Ha-far-1, Ha-far-2 and Hf-far-1) from the Cereal Cyst Nematodes Heterodera avenae and H. filipjevi.

Authors:  Fen Qiao; Lilian Luo; Huan Peng; Shujie Luo; Wenkun Huang; Jiangkuan Cui; Xin Li; Lingan Kong; Daohong Jiang; David J Chitwood; Deliang Peng
Journal:  PLoS One       Date:  2016-08-01       Impact factor: 3.240

Review 2.  Function of lipid binding proteins of parasitic helminths: still a long road.

Authors:  Jose F Lombardo; Jorge L Pórfido; Martín S Sisti; A Nahili Giorello; Santiago Rodríguez; Betina Córsico; Gisela R Franchini
Journal:  Parasitol Res       Date:  2022-02-16       Impact factor: 2.289

3.  CRISPR/Cas12a Coupled With Recombinase Polymerase Amplification for Sensitive and Specific Detection of Aphelenchoides besseyi.

Authors:  Anpeng Zhang; Bin Sun; Jianming Zhang; Can Cheng; Jihua Zhou; Fuan Niu; Zhongyong Luo; Luzhen Yu; Cui Yu; Yuting Dai; Kaizhen Xie; Qiyan Hu; Yue Qiu; Liming Cao; Huangwei Chu
Journal:  Front Bioeng Biotechnol       Date:  2022-06-30

4.  RNA-Seq revealed that infection with white tip nematodes could downregulate rice photosynthetic genes.

Authors:  Hong-Le Wang; Si-Hua Yang; Mei Lv; Shan-Wen Ding; Jun-Yi Li; Chun-Ling Xu; Hui Xie
Journal:  Funct Integr Genomics       Date:  2019-11-12       Impact factor: 3.410

5.  Rice susceptibility to root-knot nematodes is enhanced by the Meloidogyne incognita MSP18 effector gene.

Authors:  Maíra Grossi-de-Sa; Anne-Sophie Petitot; Deisy A Xavier; Maria Eugênia L Sá; Itamara Mezzalira; Magda A Beneventi; Natalia F Martins; Hugues K Baimey; Erika V S Albuquerque; Maria F Grossi-de-Sa; Diana Fernandez
Journal:  Planta       Date:  2019-06-19       Impact factor: 4.116

6.  A Nematode Calreticulin, Rs-CRT, Is a Key Effector in Reproduction and Pathogenicity of Radopholus similis.

Authors:  Yu Li; Ke Wang; Hui Xie; Yan-Tao Wang; Dong-Wei Wang; Chun-Lin Xu; Xin Huang; De-Sen Wang
Journal:  PLoS One       Date:  2015-06-10       Impact factor: 3.240

7.  Genome-wide tissue-specific gene expression, co-expression and regulation of co-expressed genes in adult nematode Ascaris suum.

Authors:  Bruce A Rosa; Douglas P Jasmer; Makedonka Mitreva
Journal:  PLoS Negl Trop Dis       Date:  2014-02-06

8.  Transcriptomic analysis of the rice white tip nematode, Aphelenchoides besseyi (Nematoda: Aphelenchoididae).

Authors:  Feng Wang; Danlei Li; Zhiying Wang; Airong Dong; Lihong Liu; Buyong Wang; Qiaoli Chen; Xiaohan Liu
Journal:  PLoS One       Date:  2014-03-17       Impact factor: 3.240

9.  A new fungus-mediated RNAi method established and used to study the fatty acid and retinol binding protein function of the plant-parasitic nematode Aphelenchoides besseyi.

Authors:  Shanwen Ding; Dongwei Wang; Chunling Xu; Sihua Yang; Xi Cheng; Xiaofang Peng; Chun Chen; Hui Xie
Journal:  RNA Biol       Date:  2020-12-14       Impact factor: 4.652

10.  Cathepsin B Cysteine Proteinase is Essential for the Development and Pathogenesis of the Plant Parasitic Nematode Radopholus similis.

Authors:  Yu Li; Ke Wang; Hui Xie; Dong-Wei Wang; Chun-Ling Xu; Xin Huang; Wen-Jia Wu; Dan-Lei Li
Journal:  Int J Biol Sci       Date:  2015-07-15       Impact factor: 6.580

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.