BACKGROUND: A-kinase anchoring proteins (AKAPs) are scaffolding molecules that coordinate and integrate G-protein signaling events to regulate development, physiology, and disease. One family member, AKAP13, encodes for multiple protein isoforms that contain binding sites for protein kinase A (PKA) and D (PKD) and an active Rho-guanine nucleotide exchange factor (Rho-GEF) domain. In mice, AKAP13 is required for development as null embryos die by embryonic day 10.5 with cardiovascular phenotypes. Additionally, the AKAP13 Rho-GEF and PKD-binding domains mediate cardiomyocyte hypertrophy in cell culture. However, the requirements for the Rho-GEF and PKD-binding domains during development and cardiac hypertrophy are unknown. METHODOLOGY/PRINCIPAL FINDINGS: To determine if these AKAP13 protein domains are required for development, we used gene-trap events to create mutant mice that lacked the Rho-GEF and/or the protein kinase D-binding domains. Surprisingly, heterozygous matings produced mutant mice at Mendelian ratios that had normal viability and fertility. The adult mutant mice also had normal cardiac structure and electrocardiograms. To determine the role of these domains during β-adrenergic-induced cardiac hypertrophy, we stressed the mice with isoproterenol. We found that heart size was increased similarly in mice lacking the Rho-GEF and PKD-binding domains and wild-type controls. However, the mutant hearts had abnormal cardiac contractility as measured by fractional shortening and ejection fraction. CONCLUSIONS: These results indicate that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, these domains regulate aspects of β-adrenergic-induced cardiac hypertrophy.
BACKGROUND: A-kinase anchoring proteins (AKAPs) are scaffolding molecules that coordinate and integrate G-protein signaling events to regulate development, physiology, and disease. One family member, AKAP13, encodes for multiple protein isoforms that contain binding sites for protein kinase A (PKA) and D (PKD) and an active Rho-guanine nucleotide exchange factor (Rho-GEF) domain. In mice, AKAP13 is required for development as null embryos die by embryonic day 10.5 with cardiovascular phenotypes. Additionally, the AKAP13Rho-GEF and PKD-binding domains mediate cardiomyocyte hypertrophy in cell culture. However, the requirements for the Rho-GEF and PKD-binding domains during development and cardiac hypertrophy are unknown. METHODOLOGY/PRINCIPAL FINDINGS: To determine if these AKAP13 protein domains are required for development, we used gene-trap events to create mutant mice that lacked the Rho-GEF and/or the protein kinase D-binding domains. Surprisingly, heterozygous matings produced mutant mice at Mendelian ratios that had normal viability and fertility. The adult mutant mice also had normal cardiac structure and electrocardiograms. To determine the role of these domains during β-adrenergic-induced cardiac hypertrophy, we stressed the mice with isoproterenol. We found that heart size was increased similarly in mice lacking the Rho-GEF and PKD-binding domains and wild-type controls. However, the mutant hearts had abnormal cardiac contractility as measured by fractional shortening and ejection fraction. CONCLUSIONS: These results indicate that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, these domains regulate aspects of β-adrenergic-induced cardiac hypertrophy.
A-kinase anchoring proteins (AKAPs) organize multi-protein signaling complexes to control a wide range of signaling events, including those important for development [1], [2], fertility [3], [4], learning and memory [5]–[7], and cardiac structure and physiology [8]–[11]. The diverse AKAP family members all bind protein kinase A (PKA) and many other signaling proteins, such as protein kinase C (PKC) and D (PKD), to create unique signaling complexes [12], [13]. Many of these signaling proteins are activated by common intracellular second messengers (e.g., cyclic AMP (cAMP) or calcium), which activate PKA and PKC, respectively. If the activated signaling proteins are left uncontrolled, they could nonspecifically affect multiple downstream proteins. However, AKAPs provide signaling specificity by anchoring multi-protein complexes close to specific downstream substrates. Thus, AKAPs integrate multiple upstream signals into specific downstream events by organizing multi-protein signaling complexes at specific cellular locations.In the heart, the signaling events coordinated by AKAPs control aspects of cardiac growth, remodeling [9], [14], [15], and physiology, including excitation/contraction (EC) coupling and calcium regulation [16], [17]. The physiological roles of several AKAPs in coordinating EC coupling have been studied in isolated cardiomyocytes and whole organisms [18]. However, the roles of AKAPs in coordinating cellular growth and remodeling during cardiac hypertrophy have been limited to studies in isolated cardiomyocytes [9], [14], [19], [20]. Interestingly, many of the signaling pathways involved in cardiac remodeling are also important in the developing heart.We studied AKAP13 in mice because of its expression pattern, published knockout phenotype, and the well-characterized signaling pathways it coordinates in isolated cardiomyocytes. We first identified AKAP13 because its expression is up-regulated during mouse fetal development [21] and mouse embryonic stem (ES) cell differentiation [22] (Information S1). In addition, AKAP13 is highly expressed in the adult heart [23], [24]. Second, a null allele of AKAP13 causes embryonic death and exhibits cardiac defects [11]. Finally, AKAP13 coordinates a signaling complex that transduces cardiac remodeling signals induced by G protein-coupled receptors (GPCRs) into hypertrophic responses in isolated cardiomyocytes [14], [20].AKAP13 is a large gene that encodes for three main transcripts, AKAP-Lbc [23], Brx [24], and Lbc [25], through the use of alternative promoters. The protein isoforms encoded by these three transcripts share a common carboxyl-terminal region that contains a guanine nucleotide exchange factor (GEF) domain and PKD binding domains (Fig. 1). The unique amino-terminus of AKAP-Lbc encodes the PKA binding domain [23], [26], [27]. The roles these AKAP13 protein domains play during hypertrophic signaling have been well studied in isolated rat cardiomyocytes. Several GPCR ligands that signal through the G-protein pathways G12/13 and Gq activate the GEF domain of AKAP13 and AKAP13-bound PKC, respectively [14], [20]. Once activated, the GEF domain activates RhoA, which leads to cardiomyocyte hypertrophy [20]. Activated PKC activates co-bound PKD, which, through several additional steps, activates the transcription factor MEF2C and leads to hypertrophy [14], [26], [28].
Figure 1
Gene-traps disrupt AKAP13 in multiple locations.
(A) Schematic of the AKAP13 genomic locus. Exons are depicted with black bars, cassette exons with a grey box, and alternative promoters with arrows. The three gene-trap insertions are indicated. (B) Diagram of the gene-trap constructs (blue boxes) integrated between AKAP13 exons (open boxes with exon numbers). The gene-trap vector contains a strong splice acceptor (SA), βGeo cassette (β−galactosidase and neomyocin resistance genes), and stop codon, as well as a polyadenylation (pA) sequence. The splicing events indicated were confirmed by RT-PCR and sequencing. Primers used to genotype the wild-type and gene-trap alleles are shown (black arrows). (C) Resulting protein fusions of AKAP-Lbc, Brx, and Lbc isoforms with βGeo for the gene-trap mutational series. PKA = protein kinase A binding domain, GEF = Rho-guanine nucleotide exchange factor domain, PKD = protein kinase D binding domain, LZ = leucine zipper domain. (D) Sample genotyping of mouse tail clips for the AKAP13 gene-trap mutations using primers in (B). WT = Wild-type, Het = Heterozygote, Hom = Homozygote.
Gene-traps disrupt AKAP13 in multiple locations.
(A) Schematic of the AKAP13 genomic locus. Exons are depicted with black bars, cassette exons with a grey box, and alternative promoters with arrows. The three gene-trap insertions are indicated. (B) Diagram of the gene-trap constructs (blue boxes) integrated between AKAP13 exons (open boxes with exon numbers). The gene-trap vector contains a strong splice acceptor (SA), βGeo cassette (β−galactosidase and neomyocin resistance genes), and stop codon, as well as a polyadenylation (pA) sequence. The splicing events indicated were confirmed by RT-PCR and sequencing. Primers used to genotype the wild-type and gene-trap alleles are shown (black arrows). (C) Resulting protein fusions of AKAP-Lbc, Brx, and Lbc isoforms with βGeo for the gene-trap mutational series. PKA = protein kinase A binding domain, GEF = Rho-guanine nucleotide exchange factor domain, PKD = protein kinase D binding domain, LZ = leucine zipper domain. (D) Sample genotyping of mouse tail clips for the AKAP13 gene-trap mutations using primers in (B). WT = Wild-type, Het = Heterozygote, Hom = Homozygote.The same signaling pathways coordinated by AKAP13 to regulate isolated cardiomyocyte hypertrophy could be required for cardiac development. Despite the finding that AKAP13-null embryos die, likely from cardiovascular defects [11], the protein domains and coordinated signaling pathways of AKAP13 required for development are unknown. Both the G12/13 and Gq signaling pathways, which can signal upstream of AKAP13, are required for development of the mouse cardiovascular system [29], [30]. In addition, proteins downstream of AKAP13 are required for proper development since mutant MEF2C and PKDmouse embryos die from heart formation defects and unknown causes, respectively [31], [32].In this study, we asked if the signaling events coordinated by AKAP13 in isolated cardiomyocytes were important for cardiac development and hypertrophic remodeling in mice. We hypothesized that the AKAP13 protein domains for Rho-GEF activity and PKD binding are required for mouse development. To test this hypothesis, we mated AKAP13 gene-trap mutant mouse lines and assessed them for viable offspring. Unexpectedly, we found that mice lacking the Rho-GEF and PKD-binding domains had normal viability. These mice also had normal cardiac electrical activity, as assessed by 6-lead electrocardiograms (ECGs), and cardiac structure.We then hypothesized that the Rho-GEF and PKD-binding domains of AKAP13 are important for cardiac remodeling in response to β-adrenergic-induced cardiac hypertrophy. To test this hypothesis, we treated mice with isoproterenol for 14 days, measured cardiac structural and functional changes by echocardiography, and analyzed heart size and structure by morphology and histology. Surprisingly, we found that AKAP13Rho-GEF and PKD-binding deficient mice induced cardiac hypertrophic remodeling but had abnormal cardiac contractility as measured by fractional shortening (FS) and ejection fraction (EF).
Results
Gene-Trap Events Disrupt AKAP13 in Multiple Locations
An AKAP13 knockout allele causes embryonic death in mice, possibly from cardiac defects [11]. However, AKAP13 contains multiple protein domains, and it is unclear which domains are required for development. In addition, the AKAP13 gene locus utilizes alternative promoters to drive expression of at least three different isoforms, AKAP-Lbc, Brx, and Lbc.To determine if the AKAP13Rho-GEF and PKD-binding domains are required for mouse development, we generated AKAP13 mutant mice from gene-trapped ES cells. The gene-trap construct uses a strong splice acceptor to create a fused mRNA of the upstream AKAP13 exons with the trapping cassette [33]. The resulting fusion protein contains the amino-terminus of AKAP13 fused to βGeo, which confers β-galactosidase activity and neomyocin resistance. These fusion proteins create truncation mutants that can be used to dissect the role of AKAP13 protein domains in vivo.We used the International Gene Trap Consortium (IGTC) database (at www.genetrap.org) [34] and the IGTC Sequence Tag Alignments track on the UCSC Genome Browser [35] to select three gene-trap events at different positions of the AKAP13 gene, ΔBrx (from ES cell line AG0213), ΔGEF (CSJ306), and ΔPKD (CSJ288), for further analysis (Fig. 1A). We confirmed the splicing of upstream AKAP13 exons into the gene-trap cassette (Fig. 1B) by RT-PCR and sequencing from total ES cell RNA. We also identified the insertion site of each gene-trap event by long-range PCR and designed genotyping strategies for these mutant lines (Fig. 1B, D). These three gene-trap events create a mutational series that affects specific AKAP13 isoforms and protein domains (Fig. 1C). The ΔBrx mutation creates a fusion of the AKAP-Lbc and Brx isoforms with βGeo that disrupts the Rho-GEF and PKD-binding domains for these two isoforms. However, the Lbc isoform should be normally expressed. The ΔGEF mutation is expected to be the most severe as it creates a fusion of all three isoforms that disrupts the Rho-GEF and PKD-binding domains. Finally, the ΔPKD mutation disrupts the PKD-binding domain of all three isoforms while the Rho-GEF domain remains intact. Male chimeric mice were generated from these three gene-trapES cell lines and crossed to female C57Bl/6 mice to generate heterozygotes. We used these mice to study the roles of AKAP13Rho-GEF and PKD-binding domains in vivo.To verify that the gene-trap events disrupt the expected AKAP13 protein domains, we generated corresponding V5-tagged AKAP-Lbc truncation constructs and expressed them in HEK293 cells (Fig. 2A). To determine the effect of these truncations on Rho-GEF activity, we immunoprecipitated the AKAP-Lbc truncation mutants and performed in vitro Rho-GEF assays. As expected, both AKAP-Lbc-ΔGEF and -ΔBrx had disrupted Rho-GEF activity (Fig. 2B
top panel). Western blot analysis confirmed that all the AKAP-Lbc truncation constructs were expressed and immunoprecipitated to an equivalent extent (Fig. 2B
bottom panels). We next tested these AKAP-Lbc truncations for their ability to bind PKD by immunoprecipitation of the AKAP-Lbc protein complexes, followed by in vitro kinase assays and immunoblotting. As expected, the AKAP-Lbc-ΔPKD, -ΔGEF, and -ΔBrx protein complexes all lacked PKD activity and binding (Fig. 2C). Finally, we confirmed that these AKAP-Lbc truncation mutants could immunoprecipitate PKA and that PKA activity was unaffected (Fig. 2D). These results show that the AKAP-Lbc-ΔGEF and -ΔBrx truncations disrupt AKAP13Rho-GEF activity and PKD binding. Furthermore, the AKAP-Lbc-ΔPKD truncation disrupts PKD binding but still contains Rho-GEF activity. Thus, these results indicate that the gene-trap events will disrupt the expected AKAP13 protein domains.
Figure 2
The gene-trap induced truncations of AKAP13 disrupt the expected protein domains.
(A) Expression constructs corresponding to the AKAP13 gene-trap events were generated using V5-tagged AKAP-Lbc truncation mutants. (B-D) These expression constructs were transfected into HEK293 cells and protein complexes were co-immunoprecipitated using anti-V5 antibody. (B) Rho-GEF activity was measured after immunoprecipitation (IP). Both AKAP-Lbc-ΔGEF and -ΔBrx had disrupted Rho-GEF activity, compared to AKAP-Lbc-WT and -ΔPKD. Immunoblotting (IB) for AKAP-Lbc-V5 with anti-V5 antibody confirmed that the AKAP-Lbc truncation mutants were expressed and immunoprecipitated at an equivalent extent. (C) Protein kinase D (PKD) activity was measured following IP. The AKAP-Lbc-ΔPKD, -ΔGEF, and -ΔBrx protein complexes lacked PKD activity compared to AKAP-Lbc-WT. Immunoblotting for GFP-PKD1 with anti-GFP antibody confirmed that only AKAP-Lbc-WT bound PKD1. The bottom gel image confirmed that GFP-PKD1 was expressed at the same level in all conditions. (D) Protein kinase A (PKA) activity was measured after IP. All AKAP-Lbc truncation mutants immunoprecipitated PKA activity and bound PKAc. The means and standard deviations are graphed for three independent experiments. One-way ANOVA and Bonferroni’s multiple comparison tests were conducted (Prism 5; GraphPad). *, p<0.05; ***, p<0.001.
The gene-trap induced truncations of AKAP13 disrupt the expected protein domains.
(A) Expression constructs corresponding to the AKAP13 gene-trap events were generated using V5-tagged AKAP-Lbc truncation mutants. (B-D) These expression constructs were transfected into HEK293 cells and protein complexes were co-immunoprecipitated using anti-V5 antibody. (B) Rho-GEF activity was measured after immunoprecipitation (IP). Both AKAP-Lbc-ΔGEF and -ΔBrx had disrupted Rho-GEF activity, compared to AKAP-Lbc-WT and -ΔPKD. Immunoblotting (IB) for AKAP-Lbc-V5 with anti-V5 antibody confirmed that the AKAP-Lbc truncation mutants were expressed and immunoprecipitated at an equivalent extent. (C) Protein kinase D (PKD) activity was measured following IP. The AKAP-Lbc-ΔPKD, -ΔGEF, and -ΔBrx protein complexes lacked PKD activity compared to AKAP-Lbc-WT. Immunoblotting for GFP-PKD1 with anti-GFP antibody confirmed that only AKAP-Lbc-WT bound PKD1. The bottom gel image confirmed that GFP-PKD1 was expressed at the same level in all conditions. (D) Protein kinase A (PKA) activity was measured after IP. All AKAP-Lbc truncation mutants immunoprecipitated PKA activity and bound PKAc. The means and standard deviations are graphed for three independent experiments. One-way ANOVA and Bonferroni’s multiple comparison tests were conducted (Prism 5; GraphPad). *, p<0.05; ***, p<0.001.
AKAP13 Is Broadly Expressed During Mouse Development and in Adult Tissue
Despite the requirement of AKAP13 for mouse development, its expression pattern during this process is unknown. In addition to disrupting the AKAP13 protein, the gene-trap events report the expression pattern of AKAP13 because the endogenous AKAP13 promoters drive expression of the AKAP13-βGeo fusion proteins.To determine the expression of AKAP13 during mouse development, we conducted X-Gal staining of AKAP13+/ΔGEF embryos at E8.5, E9.5, E10.5, and E14.5 (Fig. 3). We found X-Gal staining in the head folds, notochord, and somites of E8.5 embryos but little to no staining in the looping heart (Fig. 3A, B). At E9.5, the staining pattern was broadly expanded with higher levels of expression in the heart (Fig. 3C). There was also staining in the vasculature, eye, ear, somites, gut and brain. E10.5 embryos had a staining pattern similar to that of E9.5 embryos (Fig. 3D). However, there was stronger staining throughout the heart (Fig. 3D, E). E14.5 embryos had high levels of staining in the atrial and ventricular myocardium and endocardium, trabeculae, and outflow tract (Fig. 3F–H). There was also staining in skeletal muscle, tongue, gut, kidney, lung, urinary system, and the choroid plexus of the brain (Fig. 3F). Finally, the yolk sac and umbilical cord of mouse embryos stained positive with X-Gal (Fig. 3I). We found the same staining patterns in AKAP13+/ΔBrx and AKAP13+/ΔPKD embryos, and no staining in wild-type embryos was detected. These results show that AKAP13 is broadly expressed during mouse development with increasing levels of expression in the heart and outflow tract. They also show that AKAP13 is expressed in skeletal and smooth muscle throughout the developing embryo.
Figure 3
AKAP13 is broadly expressed during mouse development.
(A–D) Whole-mount AKAP13+/ΔGEF embryos stained with X-Gal (in blue) to identify AKAP13-βGeo expression at (A&B) E8.5, (C) E9.5, and (D) E10.5. (A&B) E8.5 embryos showed expression in the head folds, notochord, and somites. (C) Right side view of E9.5 embryo showed expression in the heart (ht), brain, eye (arrow), otic pit (arrowhead), gut, and somites. (D) Right side view of E10.5 embryo showed similar expression as in (C) with higher expression in the heart (ht). (E) Frontal view of an E10.5 heart showed high levels of expression in the ventricle (v), bulbous cordis (bc), and outflow tract (oft). (F) Sagittal and (H) transverse sections of E14.5 embryos stained with X-Gal and nucleofast red. E14.5 embryos showed expression in the heart (ht), tongue (t), lung (l), gut (g), kidney (k), skeletal muscle, brain (arrow), and urogenital region (arrowhead). (G&I) Close ups of the hearts boxed in F and H, respectively, showed expression in atrial (at), and ventricular (v) myocardium, endocardium and trabeculae. The right and left atria (ra & la) and ventricles (rv & lv) all showed expression with higher levels in the left ventricle (lv). There was also expression in the aorta (a). (J) X-Gal staining of E9.5 embryos with the yolk sac attached showed expression in the yolk sac (ys). Black scale bars are 0.5 mm.
AKAP13 is broadly expressed during mouse development.
(A–D) Whole-mount AKAP13+/ΔGEF embryos stained with X-Gal (in blue) to identify AKAP13-βGeo expression at (A&B) E8.5, (C) E9.5, and (D) E10.5. (A&B) E8.5 embryos showed expression in the head folds, notochord, and somites. (C) Right side view of E9.5 embryo showed expression in the heart (ht), brain, eye (arrow), otic pit (arrowhead), gut, and somites. (D) Right side view of E10.5 embryo showed similar expression as in (C) with higher expression in the heart (ht). (E) Frontal view of an E10.5 heart showed high levels of expression in the ventricle (v), bulbous cordis (bc), and outflow tract (oft). (F) Sagittal and (H) transverse sections of E14.5 embryos stained with X-Gal and nucleofast red. E14.5 embryos showed expression in the heart (ht), tongue (t), lung (l), gut (g), kidney (k), skeletal muscle, brain (arrow), and urogenital region (arrowhead). (G&I) Close ups of the hearts boxed in F and H, respectively, showed expression in atrial (at), and ventricular (v) myocardium, endocardium and trabeculae. The right and left atria (ra & la) and ventricles (rv & lv) all showed expression with higher levels in the left ventricle (lv). There was also expression in the aorta (a). (J) X-Gal staining of E9.5 embryos with the yolk sac attached showed expression in the yolk sac (ys). Black scale bars are 0.5 mm.Previous studies using northern blot analysis found AKAP13 to be highly expressed in human heart tissue with less expression in other tissues, including the lung and kidney [23], [24]. However, the expression patterns of AKAP13 within these organs remain unknown. To determine the expression pattern of AKAP13 within adult mouse organs, we conducted X-Gal staining of AKAP13+/ΔGEF heart, kidney, and brain samples (Fig. 4). We found X-Gal staining throughout the entire heart and in the pulmonary arteries and aorta (Fig. 4A). In the kidney, the cortex, arteries and ureter stained positive (Fig. 4C). The vasculature of the brain, olfactory bulb, and part of the cerebellar cortex stained positive (Fig. 4D). The same staining patterns were seen in kidney and brain from AKAP13+/ΔBrx and AKAP13+/ΔPKD adult mice. Surprisingly, AKAP13+/ΔPKD hearts lacked staining in the ventricles; however, there was still staining in the atria, pulmonary arteries, aorta, and ventricular vasculature (Fig. 4B). These results show that AKAP13 is highly expressed in the adult heart and vasculature and is expressed in specific regions of additional organs, including the kidney and brain.
Figure 4
AKAP13 is expressed in adult heart, kidney, and brain.
Adult AKAP13+/ΔGEF organs were bisected and stained with X-Gal (in blue) to determine AKAP13-βGeo expression in heart (A), kidney (C) and brain (D). (A) The AKAP13-ΔGEF hearts showed strong staining throughout the entire heart, including the left (la) and right (ra) atria, left (lv) and right (rv) ventricles, pulmonary artery, and aorta. (B) AKAP13-ΔPKD hearts had staining in the atria pulmonary artery, and aorta, as expected, but lacked staining in the ventricles. The blood vessels of the ventricles stained positive. (C) The kidney cortex (c), ureter (u), and arteries (ar) stained positive. (D) The interior of the right hemisphere of the brain showed staining of the olfactory bulb (ob), vasculature (arrow), and part of the cerebellum (cbx). Black scale bars are 1 mm.
AKAP13 is expressed in adult heart, kidney, and brain.
Adult AKAP13+/ΔGEF organs were bisected and stained with X-Gal (in blue) to determine AKAP13-βGeo expression in heart (A), kidney (C) and brain (D). (A) The AKAP13-ΔGEF hearts showed strong staining throughout the entire heart, including the left (la) and right (ra) atria, left (lv) and right (rv) ventricles, pulmonary artery, and aorta. (B) AKAP13-ΔPKD hearts had staining in the atria pulmonary artery, and aorta, as expected, but lacked staining in the ventricles. The blood vessels of the ventricles stained positive. (C) The kidney cortex (c), ureter (u), and arteries (ar) stained positive. (D) The interior of the right hemisphere of the brain showed staining of the olfactory bulb (ob), vasculature (arrow), and part of the cerebellum (cbx). Black scale bars are 1 mm.
AKAP13 Rho-GEF and PKD-Binding Domains Are Not Required for Mouse Development
Recently, an AKAP13-null mouse was reported to die at E9.5–E10.5 during embryonic development, and it was proposed that this was due to a loss of Rho-GEF signaling [11]. Since AKAP13 also encodes for PKA and PKD binding domains, we asked whether the AKAP13Rho-GEF and PKD-binding domains were required for mouse development. To answer this question, we conducted heterozygote crosses for the three mutant mouse lines and assessed the matings for viable offspring. We found that all of these matings produced homozygous mutant offspring at the expected Mendelian ratios (Table 1). In addition, the homozygous mutant mice lacked gross abnormalities, were fertile, and had normal viability.
Table 1
Genotypes of pups from heterozygous AKAP13 mutant matings.
Genotype
Expected Mendelian Ratio %
Observed Ratios % (Number of Pups)
ΔBrx
ΔGEF
ΔPKC
WT
25
23 (n = 39)
25 (n = 52)
25 (n = 64)
Het
50
54 (n = 91)
56 (n = 116)
54 (n = 141)
Hom
25
23 (n = 39)
19 (n = 39)
21 (n = 55)
WT = Wild-type, Het = Heterozygote, Hom = Homozygote.
WT = Wild-type, Het = Heterozygote, Hom = Homozygote.To verify that the gene-trap mutations disrupt full-length AKAP13 expression, we conducted quantitative PCR on total RNA from newborn pup heart and lung tissue (Fig. 5). We used TaqMan probes to measure relative expression of the E4-5, Brx-9, and E37-38 exon-exon junctions (Fig. 5A). As expected, we found that none of the gene-trap mutations changed the expression of the AKAP13 E4-5 junction, which lies upstream of the three gene-trap insertion sites (Fig. 5B). The expression of the Brx-9 junction was reduced in a dose-dependent manner only in ΔBrxmice, and AKAP13ΔBrx/ΔBrxmice completely lacked expression at this exon-exon junction (Fig. 5C). These results were also expected because the ΔBrx insertion site lies between the Brx specific exon and exon 9, and the other two gene-trap insertions are downstream of this exon-exon junction. Finally, all three gene-trap mutations decreased expression of the E37-38 junction in a dose-dependent manner, as expected (Fig. 5D). The ΔGEF mutation was particularly effective at reducing expression, as the AKAP13ΔGEF/ΔGEFmice completely lacked expression of this exon-exon junction.
Figure 5
Full-length AKAP13 mRNA levels are reduced by the gene-trap events.
(A) TaqMan gene expression assays were used to measure the expression of AKAP13 transcripts at the indicated exon-exon junctions (E4-5, Brx-9, & E37-38). (B) Quantitative PCR analysis of wild-type (WT), heterozygote (Het) and homozygote (Hom) neonatal mouse heart and lung RNA for AKAP13 showed that none of the gene-trap mutations affected expression of the E4-5 exon-exon junction. The ΔBrx gene-trap dose dependently decreased expression of the Brx-9 exon-exon junction. Expression of the Brx-9 junction was eliminated in the AKAP13ΔBrx/ΔBrx mice. All three gene-traps decreased expression of the E37-38 exon-exon junction in a dose-dependent manner. Expression of the E37-38 junction was eliminated in the AKAP13ΔGEF/ΔGEF mice. The means and standard deviations are graphed for six mice per genotype. One-way ANOVA and Bonferroni’s multiple comparison tests were conducted (Prism 5; GraphPad). †, p<0.10; *, p<0.05; **, p<0.01.
Full-length AKAP13 mRNA levels are reduced by the gene-trap events.
(A) TaqMan gene expression assays were used to measure the expression of AKAP13 transcripts at the indicated exon-exon junctions (E4-5, Brx-9, & E37-38). (B) Quantitative PCR analysis of wild-type (WT), heterozygote (Het) and homozygote (Hom) neonatal mouse heart and lung RNA for AKAP13 showed that none of the gene-trap mutations affected expression of the E4-5 exon-exon junction. The ΔBrx gene-trap dose dependently decreased expression of the Brx-9 exon-exon junction. Expression of the Brx-9 junction was eliminated in the AKAP13ΔBrx/ΔBrxmice. All three gene-traps decreased expression of the E37-38 exon-exon junction in a dose-dependent manner. Expression of the E37-38 junction was eliminated in the AKAP13ΔGEF/ΔGEFmice. The means and standard deviations are graphed for six mice per genotype. One-way ANOVA and Bonferroni’s multiple comparison tests were conducted (Prism 5; GraphPad). †, p<0.10; *, p<0.05; **, p<0.01.Contrary to our expectations, these results indicate that the AKAP13 gene-trap mutations do not affect development or viability. Specifically, the ΔBrx mutation eliminates expression of the Brx-9 exon-exon junction indicating that the Brx isoform of AKAP13 is not required for development or viability. Likewise, the ΔGEF mutation completely eliminates expression of E24-25 (data not shown) and E37-38. Additionally, we showed that the ΔGEF truncation disrupts the AKAP13Rho-GEF and PKD-binding domains (Fig. 2). Thus, these results show that the AKAP13Rho-GEF and PKD-binding domains are not required for mouse development or viability.
Cardiac Electrical Activity and Structure Is Normal in AKAP13 Mutant Mice
Since AKAP13 is highly expressed during cardiac development and throughout the adult heart (Fig. 3 & 4) and regulates cardiomyocyte physiology [14], [20], we asked whether the ΔGEF mutation affected adult cardiac electrical activity or structure. To address this, used 6-lead ECG to analyze heart activity and then harvested the hearts from 16–18-week-old male homozygous mutant and wild-type control mice.ECG analysis showed that heart rate (HR), PR interval, P wave duration, QRS interval, and corrected QT interval (QTc) of AKAP13ΔGEF/ΔGEFmice were indistinguishable from wild-type littermates (Table 2). Gross morphology showed that the ΔGEF hearts had normal atrial and ventricular structures (Fig. 6A) and a properly formed pulmonary artery and aorta. Additionally, the wild-type and ΔGEF hearts were the same size as assessed by the heart weight to tibia length (HW/TL) ratios (Fig. 6B). Hearts from AKAP13ΔBrx/ΔBrx and AKAP13ΔPKD/ΔPKDmice also had normal morphology and size (data not shown). Histological analysis of ΔGEF hearts by hematoxylin and eosin (H&E) staining showed proper cardiomyocyte organization and structure (Fig. 6C). Finally, the ΔGEF hearts had normal levels of Masson’s trichrome staining, indicating no change in cardiac fibrosis (Fig. 6D). These results indicate that the loss of AKAP13Rho-GEF and PKD-binding domains does not affect cardiac electrical activity or structure under normal physiological conditions.
Table 2
Six-Lead ECG analysis of AKAP13-ΔGEF mutant mice.
Genotype
Heart Rate
PR (ms)
P (ms)
QRS (ms)
QTc (ms)
WT
462.3±30.6
38.4±3.2
9.16±1.14
11.3±1.3
52.2±3.5
ΔGEF
437.1±17.9
39.1±2.3
9.30±0.61
11.5±1.0
55.4±5.7
Heart rate is in beats per minute, ms = milliseconds.
Values are given as the mean ± standard deviation for six mice in each genotype.
Figure 6
AKAP13-ΔGEF mutant mice had normal cardiac structure.
(A) Hearts isolated from six wild-type (WT) and six AKAP13ΔGEF/ΔGEF (ΔGEF) adult male mice at 16–18 weeks of age had normal gross morphology; representative images shown. White scale bar is 1 mm. (B) WT and ΔGEF hearts were the same size as measured by heart weight to tibia length (HW/TL) ratios (in milligrams per millimeter). Means and standard deviations are graphed for six hearts of each genotype. Hearts were sectioned for histology and stained with (C) H&E or (D) Masson’s trichrome. The bottom panels of C&D are higher magnifications of the boxed regions in the top panels. (C) Cardiac structure was normal in ΔGEF hearts (top), and cardiomyocytes had proper organization (bottom). (D) ΔGEF hearts had normal levels of fibrosis as assessed by Masson’s trichrome staining. Black scale bars in C&D are 1 mm (top), 50 µm (C bottom), and 250 µm (D bottom).
AKAP13-ΔGEF mutant mice had normal cardiac structure.
(A) Hearts isolated from six wild-type (WT) and six AKAP13ΔGEF/ΔGEF (ΔGEF) adult male mice at 16–18 weeks of age had normal gross morphology; representative images shown. White scale bar is 1 mm. (B) WT and ΔGEF hearts were the same size as measured by heart weight to tibia length (HW/TL) ratios (in milligrams per millimeter). Means and standard deviations are graphed for six hearts of each genotype. Hearts were sectioned for histology and stained with (C) H&E or (D) Masson’s trichrome. The bottom panels of C&D are higher magnifications of the boxed regions in the top panels. (C) Cardiac structure was normal in ΔGEF hearts (top), and cardiomyocytes had proper organization (bottom). (D) ΔGEF hearts had normal levels of fibrosis as assessed by Masson’s trichrome staining. Black scale bars in C&D are 1 mm (top), 50 µm (C bottom), and 250 µm (D bottom).Heart rate is in beats per minute, ms = milliseconds.Values are given as the mean ± standard deviation for six mice in each genotype.
AKAP13 ΔGEF Mice Have an Abnormal Response to β-Adrenergic-Induced Cardiac Hypertrophy
AKAP13 coordinates many signaling processes to mediate the cellular response to cardiac hypertrophic signals [14], [20], [36], [37]. Specifically, the AKAP13Rho-GEF and PKD-binding domains transduce hypertrophic signaling events in isolated cardiomyocytes [14], [20]; however, it is unclear if they are required for the hypertrophic response in mice. Thus, we asked whether the AKAP13Rho-GEF and PKD-binding domains are required for a β-adrenergic-induced cardiac hypertrophic response in mice. To answer this, we implanted mini-osmotic pumps into 22–32-week-old wild-type and AKAP13ΔGEF/ΔGEF littermate mice to infuse PBS vehicle (Veh) or isoproterenol (Iso; 60 mg/kg per day) for 14 days [38]. Iso activates β-adrenergic receptors to induce cardiac hypertrophy [39] partially through PKD signaling [31]. To assess the cardiac structural and functional response to β-adrenergic-mediated cardiac hypertrophy, we conducted echocardiography on mice in a blinded fashion. We recorded echocardiograms before pump implantation to obtain a baseline value and on day 13 of treatment. We then isolated the hearts from these mice on day 14 of treatment to further analyze cardiac structural changes.M-Mode echocardiogram recordings on day 13 showed that Iso treatment increased left ventricular wall thickness in wild-type and AKAP13ΔGEF/ΔGEFmice. However, the degree of cardiac contraction was lower in the Iso-treated ΔGEFmice than wild-type mice (Fig. 7A). Cardiac structural and functional changes were quantified from the echocardiogram recordings (Fig. 7B–E). Iso treatment increased left ventricular mass (LV Mass) in both wild-type (51%) and ΔGEF (60%) mice from baseline values (Fig. 7B). Left ventricular anterior wall thickness at diastole (LVAW;d) increased in both wild-type (43%) and ΔGEF (34%) mice treated with Iso (Fig. 7C). Left ventricular posterior wall thickness was increased similarly to LVAW (data not shown). There was no difference in LV Mass or LVAW;d between the wild-type and ΔGEFmice at baseline or after Iso treatment. These results show that the ΔGEFmice induce structural changes associated with cardiac hypertrophy.
Figure 7
AKAP13-ΔGEF mutant mice undergo cardiac remodeling but have abnormal contractility in response to β-adrenergic-induced hypertrophy.
(A) Representative M-Mode echocardiogram images showed a thicker left ventricular wall in wild-type (WT) and AKAP13ΔGEF/ΔGEF (ΔGEF) male mice treated with isoproterenol (Iso; 60 mg/kg per day for 13 days) than in those treated with PBS vehicle (Veh). Iso treatment increased the magnitude of contraction in WT mice but not in ΔGEF mice. The horizontal black scale bar is 200 ms; the vertical black scale bars are 1 mm. (B–E) Quantification of echocardiography data for left ventricle structural and functional changes in response to Iso treatment. Echocardiograms were recorded the day before mini-osmotic pumps were implanted for baseline levels (0) and after 13 days of Iso (+) or Veh (-) treatment. (B) Both WT and ΔGEF mice increased left ventricular (LV) mass to the same level with Iso treatment. (C) LV anterior wall thickness at diastole (LVAW;d) was increased to the same level in both WT and ΔGEF mice treated with Iso. (D) The percent of fractional shortening (FS) was greater in wild-type mice treated with Iso compared to baseline or Veh treatment. FS was not different in ΔGEF mice treated with Iso compared to baseline or Veh controls. However, ΔGEF mice treated with Iso tended to have reduced FS compared to wild-type controls. (E) The percent ejection fraction (EF) also was greater in wild-type mice treated with Iso than baseline or Veh treatment. Again, EF was not different in ΔGEF treated with Iso compared to baseline or Veh controls, but tended to be less than wild-type controls. The means and standard deviations are graphed in B–E for seven WT and nine ΔGEF mice at baseline (0), three WT and three ΔGEF mice with Veh treatment, and four WT and six ΔGEF mice with Iso treatment. One-way ANOVA and Bonferroni’s multiple comparison tests were conducted (Prism 5; GraphPad). †, p<0.10; *, p<0.05; **, p<0.01; ***, p<0.001.
AKAP13-ΔGEF mutant mice undergo cardiac remodeling but have abnormal contractility in response to β-adrenergic-induced hypertrophy.
(A) Representative M-Mode echocardiogram images showed a thicker left ventricular wall in wild-type (WT) and AKAP13ΔGEF/ΔGEF (ΔGEF) male mice treated with isoproterenol (Iso; 60 mg/kg per day for 13 days) than in those treated with PBS vehicle (Veh). Iso treatment increased the magnitude of contraction in WT mice but not in ΔGEFmice. The horizontal black scale bar is 200 ms; the vertical black scale bars are 1 mm. (B–E) Quantification of echocardiography data for left ventricle structural and functional changes in response to Iso treatment. Echocardiograms were recorded the day before mini-osmotic pumps were implanted for baseline levels (0) and after 13 days of Iso (+) or Veh (-) treatment. (B) Both WT and ΔGEFmice increased left ventricular (LV) mass to the same level with Iso treatment. (C) LV anterior wall thickness at diastole (LVAW;d) was increased to the same level in both WT and ΔGEFmice treated with Iso. (D) The percent of fractional shortening (FS) was greater in wild-type mice treated with Iso compared to baseline or Veh treatment. FS was not different in ΔGEFmice treated with Iso compared to baseline or Veh controls. However, ΔGEFmice treated with Iso tended to have reduced FS compared to wild-type controls. (E) The percent ejection fraction (EF) also was greater in wild-type mice treated with Iso than baseline or Veh treatment. Again, EF was not different in ΔGEF treated with Iso compared to baseline or Veh controls, but tended to be less than wild-type controls. The means and standard deviations are graphed in B–E for seven WT and nine ΔGEFmice at baseline (0), three WT and three ΔGEFmice with Veh treatment, and four WT and six ΔGEFmice with Iso treatment. One-way ANOVA and Bonferroni’s multiple comparison tests were conducted (Prism 5; GraphPad). †, p<0.10; *, p<0.05; **, p<0.01; ***, p<0.001.We next assessed cardiac contractility by calculating left ventricular FS and EF from echocardiogram recordings (Fig. 7D, E). At day 13 of Iso treatment, wild-type mice had 15% greater FS (Fig. 7D) and 22% greater EF (Fig. 7E) than Veh-treated controls. However, ΔGEFmice treated with Iso showed no differences in FS or EF as compared to vehicle controls. Moreover, ΔGEFmice treated with Iso tended to have reduced FS and EF as compared to wild-type controls that trended towards significance (p<0.1). We also found that Iso treatment increased heart rate for both wild-type and ΔGEFmice (Table 3). These results show that despite similar hypertrophic structural changes, the ΔGEFmice have an abnormal functional response to chronic Iso treatment as measured by cardiac contractility.
Table 3
Heart rate changes with Iso treatment.
Genotype
Baseline
Vehicle
Isoproterenol
WT
431.0±31.1 (n = 7)
446.7±62.8 (n = 3)
554.3±17.9 (n = 4)
ΔGEF
439.9±43.6 (n = 9)
477.7±57.9 (n = 3)
569.2±20.1 (n = 6)
Heart rate is in beats per minute.
Values are given as the mean ± standard deviation.
Heart rate is in beats per minute.Values are given as the mean ± standard deviation.Morphological analysis of whole hearts verified that Iso treatment induced cardiac hypertrophy in both wild-type and AKAP13ΔGEF/ΔGEFmice to a similar extent (Fig. 8A). HW/TL increased in wild-type mice treated with Iso from a Veh-treated value of 11.97±0.81 (mean ± SD, n = 3) to 16.07±2.01 mg/mm (n = 4; p = 0.022). Similarly, HW/TL increased in ΔGEFmice from a Veh-treated value of 12.47±3.49 (n = 3) to 15.58±2.12 mg/mm (n = 6; p = 0.133). H&E staining of histological sections of these hearts showed that Iso treatment increased left ventricular wall thickness in both sets of mice (Fig. 8B, top). Closer examination of the cardiomyocytes at the top of the left ventricular wall showed increased interstitial cells between the myocytes and a looser myocyte configuration in Iso-treated than Veh-treated hearts (Fig. 8B, bottom). Iso treatment also increased fibrosis in the myocardium of both wild-type and ΔGEF hearts as assessed by Masson’s trichrome staining (Fig. 8C). This fibrosis was interspersed within the myocardium. Qualitative analysis of these heart sections suggested that there was more fibrosis in the ΔGEF than wild-type hearts. Quantification of Masson’s trichrome staining also suggested a trend for increased fibrosis in the ΔGEF hearts (10.11±8.42%, n = 6, for ΔGEF vs. 5.63±2.10%, n = 4, for wild-type; p = 0.336). Interestingly, one of the Iso-treated ΔGEF hearts had a large area of fibrosis at the top of the right and left ventricular walls (>25% of myocardial area).
Figure 8
AKAP13-ΔGEF mutant mice induced cardiac hypertrophy in response to chronic isoproterenol treatment.
(A) Hearts from wild-type (WT) and AKAP13ΔGEF/ΔGEF (ΔGEF) male mice showed hypertrophy with isoproterenol (Iso) treatment (60 mg/kg per day for 14 days). Three WT and three ΔGEF mice were treated with PBS vehicle (Veh), and four WT and six ΔGEF mice were treated with Iso; representative images are shown. White scale bar is 1 mm. Hearts were sectioned for histology and stained with (B) H&E or (C) Masson’s trichrome. (B) WT and ΔGEF left ventricular walls were thickened by Iso treatment (top). Higher magnification of the upper left ventricular wall (box) showed disruption of myocyte organization in Iso-treated hearts (bottom). (C) Fibrosis increased throughout the WT and ΔGEF hearts as assessed by Masson’s trichrome staining. Iso-treated ΔGEF hearts appeared to have more fibrosis than Iso-treated WT hearts. Higher magnification of the left ventricular wall (box) showed fibrosis within the myocardium (bottom). Black scale bars in B&C are 1 mm (top), 50 µm (B bottom), and 250 µm (C bottom).
AKAP13-ΔGEF mutant mice induced cardiac hypertrophy in response to chronic isoproterenol treatment.
(A) Hearts from wild-type (WT) and AKAP13ΔGEF/ΔGEF (ΔGEF) male mice showed hypertrophy with isoproterenol (Iso) treatment (60 mg/kg per day for 14 days). Three WT and three ΔGEFmice were treated with PBS vehicle (Veh), and four WT and six ΔGEFmice were treated with Iso; representative images are shown. White scale bar is 1 mm. Hearts were sectioned for histology and stained with (B) H&E or (C) Masson’s trichrome. (B) WT and ΔGEF left ventricular walls were thickened by Iso treatment (top). Higher magnification of the upper left ventricular wall (box) showed disruption of myocyte organization in Iso-treated hearts (bottom). (C) Fibrosis increased throughout the WT and ΔGEF hearts as assessed by Masson’s trichrome staining. Iso-treated ΔGEF hearts appeared to have more fibrosis than Iso-treated WT hearts. Higher magnification of the left ventricular wall (box) showed fibrosis within the myocardium (bottom). Black scale bars in B&C are 1 mm (top), 50 µm (B bottom), and 250 µm (C bottom).The echocardiography and morphological results showed that AKAP13ΔGEF/ΔGEFmice induce cardiac hypertrophy in response to chronic β-adrenergic stimulation. However, the ΔGEFmice had lower levels of cardiac contractility than wild-type mice. Moreover, the ΔGEFmice also appeared to have increased fibrosis. These results indicate that the AKAP13Rho-GEF and PKD-binding domains are not required for β-adrenergic induced cardiac hypertrophy. However, the results indicate that these AKAP13 domains do regulate aspects of cardiac hypertrophy.
Discussion
In this study, we investigated the roles of the Rho-GEF and PKD-binding domains of AKAP13 in mouse development, adult cardiac physiology, and hypertrophic remodeling. Contrary to our expectations, our results show that these AKAP13 domains are not required for mouse development, normal adult cardiac architecture, or β-adrenergic-induced cardiac hypertrophy. However, the AKAP13Rho-GEF and PKD-binding domains may regulate the compensatory response to cardiac hypertrophy. In developing mice, AKAP13 was broadly expressed with high levels in the cardiovascular system, and in the adult heart, expression remained high. Despite the disruption of the AKAP13Rho-GEF and PKD-binding domains in AKAP13ΔGEF/ΔGEFmice, we found that these mice were born at a normal Mendelian ratio, had normal viability, and were fertile. Additionally, the mutant adult mice had normal cardiac structure and function. The ΔGEFmice induced cardiac remodeling in response to chronic isoproterenol treatment. However, these mice had abnormal cardiac contractility and slightly increased fibrosis in response to chronic isoproterenol treatment.Contrary to our expectations that the AKAP13-ΔGEF mutation would phenocopy AKAP13-null mice, we found that AKAP13ΔGEF/ΔGEFmice developed normally. A previous study reported that AKAP13-null embryos die at E9.5–10.5, display a thinned myocardium and loss of trabeculation, and have decreased expression of cardiac developmental genes [11]. The authors proposed that these phenotypes were due to the loss of AKAP13Rho-GEF activity in the heart [11]. However, AKAP13 also coordinates a PKC-PKD signaling pathway, and both the Rho-GEF and PKC-PKD pathways regulate cardiomyocyte hypertrophic growth [14], [20]. We expected that eliminating both the Rho-GEF and PKD-binding domains of AKAP13 would cause embryonic lethality and phenocopy the AKAP13-null mutation. However, our results show that AKAP13-mediated Rho-GEF and PKD signaling are not required for mouse development. These results, combined with the published AKAP13-null mouse phenotype, indicate that other AKAP13 protein domains are required for mouse development.The PKA-binding domain of AKAP13 is an intriguing candidate for the developmentally required AKAP13 protein domain. The AKAP13-ΔGEF mutation used in this study fuses the amino-terminus of AKAP13, including the PKA binding domain, to the βGeo cassette. We confirmed that this mutation eliminates full-length AKAP13 mRNA but maintains expression of mRNA upstream of the gene-trap insertion. Thus, the AKAP13 region upstream of the ΔGEF mutation seems to be sufficient for mouse development, possibly through binding PKA. AKAP13-bound PKA inhibits AKAP13-Rho-GEF activity [40] and enhances PKD signaling [14], [26] in isolated cardiomyocytes. If PKA binding to AKAP13 were required for development, it would suggest a novel AKAP13-mediated signaling pathway. The requirement for AKAP13-PKA binding during development would not be unprecedented since proper regulation of PKA signaling is required for mouse development [41]. Moreover, the cardiac-specific disruption of a regulatory subunit of PKA, which holds the kinase in an inactive state until cyclic AMP activation, results in a thinning of the myocardium and loss of trabeculation [42]. Interestingly, the phenotype observed after cardiac disruption of PKA regulation [42] is very similar to the phenotype described for the AKAP13-null mouse [11]. Alternatively, an unappreciated AKAP13 protein domain could be required for development. Additional mutational analysis of the AKAP13 gene locus is required to fully investigate these possibilities.AKAP13 is expressed in many tissues during mouse development, and we were surprised that the AKAP13ΔGEF/ΔGEFmice had no obvious developmental phenotypes. This suggests that additional proteins might compensate for the loss of AKAP13-mediated Rho and PKD signaling. Several additional AKAP family members are expressed during mouse development. Two that might have compensatory roles are AKAP6 (mAKAP) and AKAP12 (Gravin). AKAP6 is expressed developmentally and becomes highly expressed in cardiac and skeletal muscle [43] to coordinate PKA, small GTPases [19], and calcium signaling events [44], [45]. AKAP12 is broadly expressed in mouse embryos and in the adult heart [46] and is required for gastrulation in zebrafish [2]. AKAP12 coordinates PKA, PKC, and Raf signaling events to regulate cellular shape changes and movement [47]. Additionally, Rho signaling may be compensated for by the large Rho-GEF containing structural protein, Obscurin, which is required for proper cardiac, muscle, and brain development in zebrafish [48]. The roles of AKAP6, AKAP12, and Obscurin during mouse development are unknown, and disruption of these proteins may produce developmental defects. It would also be interesting to determine if these scaffolds provide functional redundancy for the loss of AKAP13 protein domains by creating double mutant mice.AKAP13ΔGEF/ΔGEFmice had normal viability, and their adult cardiac structure and electrical activity were indistinguishable from wild-type littermates despite high levels of AKAP13 expression in the heart. These results indicate that AKAP13Rho-GEF and PKD-binding domains are not required for mouse survival or normal cardiac physiology. This suggests that additional proteins provide redundancy in controlling Rho and PKD signaling during heart maturation and normal physiology. The scaffolding molecules AKAP6 and AKAP12, as well as Obscurin, could again provide this redundant function. Additional Rho-GEF proteins, including p115RhoGEF and p63RhoGEF, are expressed in cardiomyocytes and could provide redundancy for RhoA signaling [49]. AKAP13 is also expressed in other organs, such as the vasculature, kidney, lung, gut and brain. Since we did not detect gross phenotypes in these tissues, other proteins might compensate for the loss of AKAP13Rho-GEF and PKD signaling in these tissues as well. Alternatively, AKAP13 may not regulate normal physiology but may specifically regulate cellular stress responses.We then decided to test the role of the Rho-GEF and PKD-binding domains for cardiac remodeling in response to β-adrenergic-mediated cardiac hypertrophy. AKAP13 transduces multiple upstream signaling events including α- and β-adrenergic, angiotensin, and endothilin receptor signaling during cardiomyocyte hypertrophy [14], [20], [36], [37]. The AKAP13Rho-GEF and PKD-binding domains are important for the induction of isolated cardiomyocyte hypertrophy in response to many of these signaling [14], [20]. Additionally, PKD is required for the cardiac hypertrophic response to several stresses, including isoproterenol activation of β-adrenergic receptors in vivo
[31]. Thus, we were surprised that AKAP13ΔGEF/ΔGEFmice induced cardiac remodeling to a similar extent as wild-type controls upon chronic β-adrenergic stimulation. This indicates that the Rho-GEF and PKD-binding domains of AKAP13 are not required for β-adrenergic induced cardiac hypertrophy in mice and that another AKAP regulates this process. AKAP6 could regulate cardiac remodeling in vivo because it transduces adrenergic signaling events, such as isoproterenol stimulation, into cardiomyocyte hypertrophy in vitro
[9]. Despite the cardiac hypertrophic response to isoproterenol, the AKAP13Rho-GEF and PKD-binding domains might be important for regulating phenylephrine, angiotensin II, and endothelin-1-induced cardiac remodeling. The pathways activated by these molecules signal through AKAP13 to induce hypertrophy in isolated cardiomyocytes [14], [20]. Thus, the series of mutant mice described in this study provide a great resource to investigate the role of specific AKAP13 protein domains in regulating cardiac hypertrophy induced by these molecules in vivo.Even though AKAP13ΔGEF/ΔGEFmice induced cardiac hypertrophy, they had abnormal cardiac FS and EF in response to isoproterenol treatment. Both FS and EF tended to be lower in ΔGEFmice treated with Iso than in wild-type controls on day 13 of treatment (p<0.1). In addition, FS and EF were increased in wild-type mice but not in ΔGEFmice treated with Iso (Fig. 7D, E). The increased contractility in the wild-type mice treated with Iso indicates that, at this time, the mice are still in the compensatory phase of hypertrophy and have not yet reached cardiac dysfunction [50], [51]. These results indicate that the AKAP13Rho-GEF and PKD-binding domains are important for regulating aspects of the cardiac hypertrophic response to chronic β-adrenergic stimulation. There are several possible models why the ΔGEFmouse hearts have abnormal cardiac contractility, compared to wild-type controls. One likely model is that the AKAP13-ΔGEFmice might reach cardiac dysfunction more quickly than the wild-type mice. In agreement with this, the mutant mice undergo cardiac hypertrophic remodeling and tend to have slightly higher fibrosis than wild-type mice after chronic isoproterenol treatment. Our study examined cardiac function at a single time point during chronic isoproterenol treatment. To determine if AKAP13 coordinates a cardioprotective role during hypertrophy, future experiments will require continual monitoring of cardiac function from the initiation of hypertrophy until full heart failure is reached. An alternative model is that AKAP13 directly mediates increased cardiac contraction in response to isoproterenol treatment. The AKAP13-coordinated signaling complex that includes PKA, PKC, and RhoA could mediate this direct regulation of cardiac contractility. This model could be tested using acute isoproterenol treatment of mutant mice or isolated cardiomyocytes. Finally, the AKAP13Rho-GEF and PKD-binding domains might be required for signaling through compensatory pathways, including additional adrenergic or angiotensin pathways, activated during cardiac hypertrophy. Measuring cardiac contractility during acute stimulation of α- and β-adrenergic and angiotensin pathways in AKAP13 mutant mice could help determine the direct pathways AKAP13 regulates.The regulatory elements that control expression of AKAP13 isoforms in specific tissues remain unknown. ΔPKDmice lacked AKAP13-βGeo expression specifically in ventricular cardiomyocytes of adult hearts. This suggests that the ΔPKD mutation disrupts a cis-regulatory element required for AKAP13 expression in ventricular cardiomyocytes. Furthermore, there are several conserved elements within the ΔPKD-disrupted intron that could function as ventricular myocyte enhancer elements. A detailed analysis of these possible enhancer elements would be required to test this possibility. Additionally, a more detailed characterization of the AKAP13 isoforms expressed during development and in adult tissues could aid in designing future studies. Evidence of additional splicing events from GenBank cDNAs and ESTs suggests alternative termination and cassette exons that could result in functionally important protein isoforms for development or adult physiology. In fact, the main AKAP13 isoforms appear to localize to different subcellular sites with AKAP-Lbc localizing to the cytoplasm and cytoskeleton and Brx localizing to the cytoplasmic and nuclear compartments [11], [24], [52]. A closer examination of all the transcripts expressed from the AKAP13 gene locus is needed to better understand the effects of certain mutations on AKAP13 protein structure. Since AKAP13 undergoes extensive alternative splicing to produce multiple protein isoforms, it may be necessary to add back specific transcripts in an AKAP13-null background to identify the unique roles played by each isoform during mouse development and disease.Finally, the mice created in this study should prove valuable for investigating AKAP13 functions in additional tissues and diseases. Since AKAP13 is highly expressed in the vasculature, it may transduce angiotensin II, or endothelin-1 signals into vascular responses. Genome-wide studies have linked AKAP13 to corneal thickness of the eye [53] and Alzheimer’s disease-associated tau phosphorylation [54]. Since we found AKAP13 expression in the eye and specific regions of the brain during development, further investigation into the role of AKAP13 in these processes is warranted. Additionally, AKAP13 may function in regulating immunity as it mediates glucocorticoid signaling in lymphocytes [55] and Toll-like receptor 2 signaling in epithelial and leukemia cell lines [52]. Finally, AKAP13 has been associated with several types of cancer, including leukemia [25], breast cancer [24], [56], [57], and colorectal cancer [58]. From these studies, AKAP13 appears to have diverse functions in a multitude of tissues. Despite this, we do not see an obvious phenotype in unstressed mice that lack the Rho-GEF and PKD-binding domains of AKAP13. Thus, we propose that these domains function to transduce acute signaling events in response to stresses.In summary, we found that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal adult cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, we found that the AKAP13Rho-GEF and PKD-binding domains regulate aspects of β-adrenergic-induced cardiac hypertrophy possibly through cardioprotective roles. These findings suggest that additional AKAP13 protein domains are sufficient for regulating normal mouse development, but that AKAP13 is critical for transducing signaling events that regulate stress responses, such as regulating cardiac function during hypertrophy. The mice generated in this study provide an ideal system to investigate the roles of specific AKAP13 protein domains in mediating these stress responses. They could also be used to investigate the roles of AKAPs in pathological responses to injury, particularly in tissues expressing AKAP13, such as blood vessels, the eye, and the brain.
Materials and Methods
Ethics Statement
All mouse studies were conducted in accordance with protocols approved by the Institutional Animal Care and Use Committee and the Laboratory Animal Research Center at the University of California, San Francisco. Protocol ID: AN080925-02B.
Expression Analysis of the AKAP Gene Family
Publicly available microarray datasets were analyzed by GC-RMA to determine expression profiles during mouse development [21] and ES cell differentiation [22]. Gene expression during mouse development was compared to expression in a blastocyst (GEO series GSE1133). Gene expression during mouseES cell differentiation was compared to pluripotent mouseES cells (GSE3749). The largest fold change was reported when greater than an absolute fold change of 1.8. The data set containing mouse developmental time points also included a large number of adult tissues. We considered a gene to be present (P) during mouse development if its expression was twofold higher than the minimum expression across all samples.
Characterization of AKAP13 Gene-Trap ES Cells
Gene-trap events within AKAP13 were identified from the International Gene Trap Consortium (IGTC) database (at www.genetrap.org) and the IGTC Sequence Tag Alignments track on the UCSC Genome Browser [34], [35]. From the sequence tag alignments, we identified ten uniquely trapped exons for AKAP13. We mapped these trapping events onto the AKAP13 protein to identify the domains affected by the traps. The following cell lines were obtained from the Mutant Mouse Regional Resource Centers: AG0213 (for AKAP13-ΔBrx), CSJ306 (for AKAP13-ΔGEF), & CSJ288 (for AKAP13-ΔPKC) (Fig. 1). The feeder-free gene-trapES cell lines were cultured in normal growth media supplemented with murineleukemia inhibiting factor as described [33]. Correct splicing of AKAP13 exons into the gene-trap construct was verified by RT-PCR and sequencing. Total RNA was extracted from ES cells with Trizol (Invitrogen), and RT-PCR was conducted using the SuperScript III One-Step RT-PCR kit (Invitrogen). Forward primers for RT-PCR were designed using Primer3 (Table 4A) [59]. The resulting products were sequence verified and confirmed the expected AKAP13–gene-trap splicing events.
Table 4
Primer Sequences.
A. RT-PCR primers for AKAP13-gene trap splicing
Primer Name
Location (Mutant)
Sequence (5'-3')
Size (bp)
MJS218
Exon 8 (ΔBrx)
ACACCCAAGATGAAGCAAGG
441
MJS219
Exon Brx (ΔBrx)
AATTTCGGACCTGTGTGAGC
573
MJS220
Exon 21–22 (ΔGEF)
TGGAGTTGGCAATGATGAGA
674
AKAPlbc-F1_MS
Exon 27 (ΔPKC)
TGAAGAGCACAACAGGAAGG
432
MJS213
Gene Trap (Univ. Rev)
TAATGGGATAGGTCACGT
B. Long-Range PCR primers in the gene trap construct
Primer Name
Location
Sequence (5'-3')
MJS236
βGal (Rev)
CCCTGCCATAAAGAAACTGTTACCC
MJS237
Neo
GTGGAGAGGCTATTCGGCTATGACT
C. Genotyping primers
Primer Name
Allele Identified
Sequence (5'-3')
Size (bp)
MJS299
Univ. ΔBrx (For)
TGGCATCTACCCAGGATCTC
MJS390
WT ΔBrx (Rev)
CAAAGGCCATCTGCACACC
1697
MJS284
GT ΔBrx (Rev)
GTGAGGCCAAGTTTGTTTCC
1275
MJS274
Univ. ΔGEF (For)
TACCAAATAACAGTGCCTGCTCTCC
MJS253
WT ΔGEF (Rev)
ATCTTGAGTGTGCGGATGTGATGTA
1533
MJS214
GT ΔGEF (Rev)
AGTATCGGCCTCAGGAAGATCG
1182
MJS339
WT ΔPKC (For)
TGTCTCTGGCCTGTTTGTGA
1112
MJS340
WT ΔPKC (Rev)
TCGGAAGAGGTTAAGGGACA
MJS272
GT ΔPKC (For)
ACATTTCCCCGAAAAGTGC
435
MJS260
GT ΔPKC (Rev)
GGCTCACACTGGGTTCAATC
(A) RT-PCR primers for verifying AKAP13 gene-trap splicing events are listed. The primer locations and mutant line verified are indicated. The size of the RT-PCR product is given in base pairs (bp). (B) The common long-range PCR primers within the gene-trap construct are listed. These primers were used with AKAP13 specific genomic DNA primers to identify the gene-trap insertion. (C) The genotyping primers used to identify the wild-type and mutant allele for the three mutant mouse lines are listed. The primer direction is also given: forward (For) and reverse (Rev). The size of the PCR product is given in base pairs (bp).
(A) RT-PCR primers for verifying AKAP13 gene-trap splicing events are listed. The primer locations and mutant line verified are indicated. The size of the RT-PCR product is given in base pairs (bp). (B) The common long-range PCR primers within the gene-trap construct are listed. These primers were used with AKAP13 specific genomic DNA primers to identify the gene-trap insertion. (C) The genotyping primers used to identify the wild-type and mutant allele for the three mutant mouse lines are listed. The primer direction is also given: forward (For) and reverse (Rev). The size of the PCR product is given in base pairs (bp).The genomic insertion sites for the gene-trap events were identified by long-range PCR of genomic DNA using Phusion High-Fidelity DNA Polymerase (Finnzyme). In summary, Primer3 was used to design ∼25mer forward and reverse primers with melting temperatures of 62–68°C throughout the introns containing the gene-trap insertions. These designed primers were used with common primers within the gene-trap construct to amplify genomic DNA (Table 4B). The PCR products were cloned into pCR-XL-TOPO (Invitrogen) and sequenced to identify the genomic insertion sites.
In Vitro Co-Immunoprecipitations
Full-length and truncation mutants for AKAP-Lbc were cloned into pcDNA3.1 with C-terminal fusion to V5. HEK293 cells were transfected with the AKAP-Lbc-V5 and pEGFP-PKD1 constructs and lysed as described [26]. Lysates were incubated on ice for 10 min and centrifuged at 20,000×g for 15 min at 4°C. Cleared lysates were incubated with Anti-V5 antibody (Invitrogen) for 1 h at 4°C with rocking, followed by precipitation of antibody-antigen complexes with protein A-agarose (Millipore). Immunoprecipitates were washed 5×1 ml in lysis buffer, eluted in SDS-PAGE sample buffer, and separated by SDS-PAGE. Antibodies used for immunoblotting were: anti-V5 (mouse; 1∶5000) from Invitrogen, anti-GFP (mouse; 1∶000) from Clontech, and anti-PKAc (rabbit; 1∶1000) from Cell Signaling.
In Vitro Kinase Assays
After immunoprecipitation of AKAP-Lbc-V5, immune complexes were washed five times with IP buffer (10 mM sodium phosphate, pH 6.95, 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 1% Triton X-100) and then resuspended in kinase assay buffer (50 mM Tris-HCl, pH 7.5, 5 mM MgCl2). Assays were performed as described [60]. PKD activity assays were carried out in a total reaction volume of 50 µl, including 100 µM Syntide-2, 5 µM ATP, and 5 µCi of [γ-32P]-ATP in kinase assay buffer. Reactions were incubated for 20 min at 30°C, starting with the addition of ATP. Reactions were terminated by centrifugation and the reaction mix (40 µl) was spotted onto P81 phosphocellulose paper (Whatman). The phosphocellulose papers were washed three times with 75 mM phosphoric acid, once with acetone and then dried. Kinase activity was determined by liquid scintillation counting. PKA activity assays were performed as described for PKD. Before the assay, PKA catalytic subunit was eluted from AKAP-Lbc immune complexes by adding 50 µl of 10 mM cAMP and incubating for 20 min. PKA assays were carried out at 30°C for 20 min in a total reaction volume of 50 µl, using 20 µl of eluted PKA catalytic subunit, 200 µM Kemptide, 5 µM ATP, and 5 µCi of [γ-32P]-ATP in kinase assay buffer.
In Vitro Rho-GEF Assays
After immunoprecipitation of AKAP-Lbc-V5, immune complexes were washed five times with IP buffer (10 mM sodium phosphate buffer, pH 6.95, 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 1% Triton X-100) and incubated with RhoA (40 pmol) in binding buffer (50 mM Tris-HCl, pH 7.5, 1 mM DTT, 0.5 mM EDTA, 50 mM NaCl, 5 mM MgCl2, 0.05% polyoxyethylene-10-lauryl ether (C12E10), and 10 µM GTPγS with ∼500 cpm/pmol [35S]GTPγS) in a final reaction volume of 50 µL. Reactions were terminated after 20 min incubation at 30°C by addition of wash buffer. GTPγS binding to RhoA was determined as described [61]. [35S]-GTPγS (specific activity = 1,250 Ci/mmol) was obtained from PerkinElmer Life Sciences.
Mouse Studies
Chimeric mice were generated by the Gladstone Transgenic Gene-Targeting Core by injecting C57Bl/6 blastocysts with the gene-trapped ES cell lines AG0213, CSJ306 and CSJ288. Male chimeric mice (N0) were backcrossed to C57Bl/6 (National Cancer Institute, National Institutes of Health) females and the resulting progeny (N1) were genotyped to identify heterozygotes carrying the gene-trap allele. Mice were genotyped from tail clips with a REDExtract-N-Amp Tissue PCR Kit (Sigma Aldrich) and the primer pairs listed in Table 4C. Heterozygous mice were inter-crossed to obtain homozygous mice, AKAP13ΔBrx/ΔBrx (from AG0213), AKAP13ΔGEF/ΔGEF (from CSJ306), AKAP13ΔPKC/ΔPKC (from CSJ288), for the three gene-trap mutational events, and litters were analyzed for Mendelian ratios at 3 weeks of age. All studies performed in this report used littermate and age-matched control and mutant mice generated from heterozygous crosses.These mouse lines will be available through the Mutant Mouse Regional Resource Center (MMRRC).
X-Gal Staining of Gene-Trap Embryos and Adult Tissue
To identify AKAP13 expression patterns during development, whole-mount embryos at embryonic day (E)8.5, E9.5, and E10.5 and cryosectioned E14.5 embryos were stained with X-Gal. To determine embryonic ages, the morning a post-coital plug was identified was designated as E0.5. Whole embryos (E8.5, E9.5, and E10.5) were fixed in 2% formaldehyde (Sigma), 0.2% glutaraldehyde (Sigma), 0.02% sodium deoxycholate (Sigma), and 0.01% Nonidet P-40 substitute (Fluka) in PBS (Mediatech) for 15 to 45 min, depending on age, at 4°C. Embryos were permeabilized in 0.02% sodium deoxycholate and 0.01% Nonidet P-40 substitute in PBS at 4°C overnight. Embryos were stained in 5 mM potassium ferricyanide (Sigma), 5 mM potassium ferrocyanide (Sigma), 2 mM MgCl2 (Sigma), 1 mg/ml X-Gal (Fermentas, AllStar Scientific, or Invitrogen), 0.02% sodium deoxycholate and 0.01% Nonidet P-40 substitute in PBS at 37°C for 5 hours. Embryos were post-fixed in 4% paraformaldehyde (PFA) at 4°C overnight. Images were obtained on a Leica MZ16F dissecting microscope with a Leica DFC500 camera and Leica Application Suite software.E14.5 embryos were bisected and fixed in 4% PFA and 0.2% glutaraldehyde in PBS for 1 hour at 4°C. The embryos were sucrose protected and frozen in Tissue-Tek OCT (Sakura Finetek). Cryostat sections were stained with X-Gal and mounted. Mosaic images of entire sagittal and transverse sections were obtained using an inverted Axiovert 200 M microscope and AxioCam HRc (Carl Zeiss) camera. Individual images were stitched together to create a mosaic image using AxioVision Software. Higher magnification images of specific regions of interest were obtained using an upright Leica DM4000B microscope with a QImaging Retiga EXi Fast 1394 camera and Image-Pro Plus software.Adult organs were obtained from euthanized 17–18-week-old mice. Mice were perfused with 10 mM KCl (Sigma), followed by PBS, and finally with 4% PFA. Heart, kidney, and brain samples were bisected and organs were fixed in 4% PFA for 1 hour at 4°C. Organs were permeabilized in 2 mM MgCl2, 0.01% sodium deoxycholate and 0.02% Nonidet P-40 substitute in PBS at 4°C overnight. They were stained in 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl2, 1 mg/ml X-Gal, 0.02% sodium deoxycholate and 0.01% Nonidet P-40 substitute in PBS at 37°C for 5 hours. Organs were post-fixed in 4% PFA at 4°C overnight. Images were obtained on a Leica MZ FLIII dissecting microscope with an AxioCam (Carl Zeiss) camera and Openlab 4.0.4 software.
Quantitative PCR Analysis
Gene expression analysis was performed on total RNA isolated from neonatal mouse heart and lung tissue. Wild-type, heterozygous, and homozygous samples were collected from six mice each for the three mouse lines. Heart and lung samples were homogenized (4.5 mm Tissue Tearor, Research Products International) in Trizol (Invitrogen). cDNA was generated from 1 µg of TurboDNAse-treated (Ambion) total RNA with the SuperScript III First Strand Synthesis kit and random hexamers (Invitrogen) as described by the manufacturer. Expression was assessed using TaqMan probesets (Applied Biosystems) for AKAP13 exon-exon junctions E4-5 (Mm01320101_m1), Brx-9 (Mm01318390_m1), and E37-38 (Mm01320099_m1) as well as GAPDH (Mm99999915_g1) and β-actin (Mm00607939_s1). Reactions were run on an Applied Biosystems 7900HT real-time thermocycler. Samples were assayed in technical triplicates and average AKAP13 expression levels were determined from GAPDH and β-actin normalized values. Relative expression was calculated against wild-type mouse samples. Means ± standard deviations were reported for six mice of each genotype. One-way ANOVA and Bonferroni’s multiple comparison tests were conducted to determine significant differences (Prism 5; GraphPad).
Electrocardiographic Analysis
Six-lead ECG analysis was conducted on 16–18-week-old wild-type and AKAP13ΔGEF/ΔGEF (ΔGEF) littermate male mice anesthetized with inhaled Isoflurane, USP (Baxter and Phoenix Pharmaceutical) [62]. In brief, anesthetized mice were placed on a heating pad, and body temperature was continually monitored to maintain at 36–37°C. Needle electrodes were implanted subcutaneously at each limb and ECGs were recorded for leads I, II, III, aVR, aVL, and aVF using the AD Instruments system: Dual BioAmp (ML135), PowerLab 4/30 (ML866) and Chart5 Pro (v5.4.2). ECG data were acquired for 15–45 seconds for each lead. The ECG recordings were analyzed using the mouse preset option in Chart5 Pro. The ECG signals were averaged within each lead and the temporal locations of P Start, P Peak, P End, QRS Start, QRS Max, QRS End, T Peak, and T End were identified and manually adjusted as needed. Values were calculated for heart rate, PR interval, P wave duration, QRS interval, and corrected QT interval (using the provided Mitchell et. al calculation). These calculated values were averaged across all leads for a given mouse. Means ± standard deviations were reported for six mice of each genotype. Two-tailed student’s t-test was conducted to determine significant differences (Excel).
Cardiac Structural Analysis
Hearts were isolated from the six wild-type and six ΔGEF littermate mice used for ECG analysis. Mice were weighed and euthanized and their hearts were collected and weighed. Hearts were washed with heparin (5 µg/ml) and PBS to remove the blood and incubated in 25 mM KCl to relax the cardiac muscle. The hearts were fixed in 4% PFA at 4°C overnight. The right tibia was removed and the length was measured using calipers (Scienceware). Hearts were imaged using a Leica MZ FLIII dissecting microscope with an AxioCam (Carl Zeiss) camera and Openlab 4.0.4 software. The hearts were then embedded in paraffin for sectioning. Five-micron sections were cut, deparaffinized, rehydrated, and stained with hematoxylin and eosin (H&E) and Masson’s trichrome following standard protocols. Mosaic images of entire heart sections were obtained using an inverted Axiovert 200 M microscope and AxioCam HRc (Carl Zeiss) camera. Individual images were stitched together to create a mosaic image using AxioVision Software. Higher magnification images of specific regions of interest were obtained using an upright Leica DM4000B microscope with a QImaging Retiga EXi Fast 1394 camera and Image-Pro Plus software.
Isoproterenol-Induced Cardiac Hypertrophy
Cardiac hypertrophy was induced in 22–32-week-old wild-type and AKAP13ΔGEF/ΔGEF (ΔGEF) littermate mice [38]. Mice were treated for 14 days with isoproterenol (60 mg/kg per day; Sigma) diluted in PBS (Iso) or PBS alone (vehicle; Veh) using mini-osmotic pumps (Alzet Model 2002) implanted subcutaneously into the peritoneum. Three wild-type and three ΔGEFmice were Veh-treated, four wild-type and six ΔGEFmice were Iso-treated. On day 14 after initiating treatment, mice were weighed and euthanized. Their hearts were collected, weighed, and processed for structural analysis as described above. Sections were stained with H&E or Masson’s trichrome. Fibrosis was quantified from mosaic images of Masson’s trichrome stained sections using Image-Pro Plus software. Means ± standard deviations were reported. Two-tailed student’s t-test was conducted to determine significant differences (Excel and Prism 5; GraphPad).One additional ΔGEFmouse was treated with Iso and died on the fourth day of treatment. Baseline echocardiography indicated that this mouse had enlarged right and left atria.
Echocardiography
Baseline (before implantation of mini-osmotic pumps) and end-point (day 13) echocardiograms were recorded for isoflurane-anesthetized mice as described [63]. M-Mode and B-Mode echocardiograms were recorded using the Vevo 770 Imaging System and RMV707B probe (VisualSonics). M-Mode measurements were taken for diastolic and systolic left ventricular anterior wall (LVAW;d & LVAW;s), internal diameter (LVID;d & LVID;s), and posterior wall (LVPW;d & LVPW;s). Corrected left ventricular mass (LV Mass; mg) was calculated from these measurements:
.Left ventricle fractional shortening (FS) was also calculated from these measurements:Measurements were made on three separate heartbeats for each mouse.B-Mode measurements were taken for endocardial area and major axis at diastole and systole (End Area;d, End Area;s, & End Major;d, End Major;s respectively). These B-Mode measurements were used to calculate endocardial volume at diastole and systole (End Vol;d & End Vol;s), left ventricular stroke volume (End SV), and left ventricular ejection fraction (EF):One set of B-Mode measurements were made per mouse.Means ± standard deviations were reported. One-way ANOVA and Bonferroni’s multiple comparison tests were conducted to determine significant differences (Prism 5; GraphPad).
Statistical Analysis
Two-tailed student’s t-tests were performed using Excel or Prism 5 (GraphPad) software. One-way ANOVA followed by Bonferroni’s multiple comparison tests were performed using Prism 5 software (GraphPad).Analysis of cardiac and developmental expression and gene-trap events for the AKAP family. A literature review was conducted to identify AKAPs expressed in cardiac tissue and that have cardiac phenotypes in cell culture or animals. The type of cardiac phenotype is indicated: Hyper = hypertrophy, Ca2+ = calcium regulation, K+ = potassium regulation, Dev = development. Publicly available microarray data sets were mined to determine the expression of AKAPs during mouse development and embryonic stem (ES) cell differentiation. Absolute fold changes are reported when greater than 1.8, and expressed, but unchanged, genes are marked as present (P). The number of uniquely trapped exons for each AKAP gene is indicated.(DOC)Click here for additional data file.
Authors: Paul S Amieux; Douglas G Howe; Heidi Knickerbocker; David C Lee; Thomas Su; George S Laszlo; Rejean L Idzerda; G Stanley McKnight Journal: J Biol Chem Date: 2002-05-09 Impact factor: 5.157
Authors: Graeme K Carnegie; F Donelson Smith; George McConnachie; Lorene K Langeberg; John D Scott Journal: Mol Cell Date: 2004-09-24 Impact factor: 17.970
Authors: Andrew I Su; Tim Wiltshire; Serge Batalov; Hilmar Lapp; Keith A Ching; David Block; Jie Zhang; Richard Soden; Mimi Hayakawa; Gabriel Kreiman; Michael P Cooke; John R Walker; John B Hogenesch Journal: Proc Natl Acad Sci U S A Date: 2004-04-09 Impact factor: 11.205
Authors: Jens Fielitz; Mi-Sung Kim; John M Shelton; Xiaoxia Qi; Joseph A Hill; James A Richardson; Rhonda Bassel-Duby; Eric N Olson Journal: Proc Natl Acad Sci U S A Date: 2008-02-14 Impact factor: 11.205
Authors: Jennifer L Gu; Stefan Müller; Valeria Mancino; Stefan Offermanns; Melvin I Simon Journal: Proc Natl Acad Sci U S A Date: 2002-06-20 Impact factor: 11.205
Authors: Lei Chen; Michelle L Marquardt; David J Tester; Kevin J Sampson; Michael J Ackerman; Robert S Kass Journal: Proc Natl Acad Sci U S A Date: 2007-12-19 Impact factor: 11.205
Authors: Rick B Vega; Brooke C Harrison; Eric Meadows; Charles R Roberts; Philip J Papst; Eric N Olson; Timothy A McKinsey Journal: Mol Cell Biol Date: 2004-10 Impact factor: 4.272
Authors: Michael D Kritzer; Jinliang Li; Catherine L Passariello; Marjorie Gayanilo; Hrishikesh Thakur; Joseph Dayan; Kimberly Dodge-Kafka; Michael S Kapiloff Journal: Circ Heart Fail Date: 2014-05-08 Impact factor: 8.790
Authors: Domenico M Taglieri; Keven R Johnson; Brian T Burmeister; Michelle M Monasky; Matthew J Spindler; Jaime DeSantiago; Kathrin Banach; Bruce R Conklin; Graeme K Carnegie Journal: J Mol Cell Cardiol Date: 2013-10-23 Impact factor: 5.000
Authors: C Blake Nichols; Chia-Wei Chang; Maura Ferrero; Brent M Wood; Matthew L Stein; Amanda J Ferguson; Derrick Ha; Robert R Rigor; Sven Bossuyt; Julie Bossuyt Journal: Circ Res Date: 2014-03-18 Impact factor: 17.367