Molecular mapping of a sunflower rust resistance gene from HAR6.

Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

Introduction

Sunflower (Helianthus annuus L. var. macrocarpus Ckll.) is grown all over the world for three main purposes: beauty (ornamental sunflower), direct consumption of the seeds (confectionary sunflower) and oil production (oilseed sunflower). By far, the last of them is the most important objective in terms of acreage and production (Fernández-Martínez ). Sunflower oil has been traditionally viewed as a healthy vegetable oil and it is considered premium oil for salad, cooking and margarine production and is also being evaluated as a source of biodiesel. With a cultivated acreage of over 22 million ha and an annual production of around 9 million ton, sunflower is grown on every continent, but its production is mainly concentrated in the Russian Federation, Ukraine, India and Argentina. Sunflower oil is the fourth most important vegetable oil in world trade after soy, palm and colza oils. Sunflower is primarily an oil crop, with high protein meal being a by-product. The world production of sunflower pellets is also important, as it is the principal grinding subproduct. Argentina is the leading exporter and the European Union is the greatest importing block (Sala ).

Sunflower rust, caused by Puccinia helianthi Schw., is a serious fungal disease that can cause significant losses in both yield and seed quality of cultivated sunflower especially in Australia, Argentina, South Africa and USA (Sendall , Yang ). P. helianthi is autoecious and macrocyclic rust that occurs on wild perennial, wild annual and cultivated Helianthus species (Markell ).

Deployment of resistant cultivars provides an effective approach for disease control, eliminates the use of fungicides and minimizes crop losses. Several genes conferring resistance to different physiological races of rust have been identified in sunflower including: R, R, R, R, R, Pu, R, R and R (Gong , Lawson , Miah and Sackston 1970, Miller , Yang ). In addition to the already named rust resistance genes, several inbred lines and interspecific germplasm lines were reported to have resistance to different rust races of sunflower (Bulos , Quresh ). Many of these sources have been discovered in Australia, Argentina and North America, and most of them are traced back to wild H. annuus (Sendall ).

HAR6 (PI607509) is a confectionary sunflower germplasm population developed and released by the USDA-ARS and the North Dakota Experimental Station (USA) in 2001 (Miller and Gulya 2001). It was developed from a French sunflower accession named 6 SC U6 L6 (PI650362). HAR6 is resistant to rust physiological races 7771 (Miller and Gulya 2001) and 336 (Qi ) but shows susceptibility when inoculated with some isolates belonging to the physiological group race 700 (Moreno ). Recently, the inheritance of rust resistance in HAR6 was reported to be controlled by one dominant gene located on linkage group (LG) 13 (Bulos ).

A significant problem is that sunflower rust resistance genes are frequently overcome by virulent races within a short time period after introduction to agriculture. Consequently, it is necessary to search for new rust resistance genes/alleles and to pyramid several resistance genes in a single cultivar to achieve effective resistance. In this sense the objectives of this work were to map the resistance factor present in HAR6 and also to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes.

Materials and Methods

Rust isolate

The rust isolate B.A. & S. 2009, belonging to physiological race 760, is a single-pustule derived isolate obtained by harvesting urediniospores from a single pustule of field growing susceptible plants in summer 2008–2009 at Venado Tuerto, Santa Fe, Argentina (Moreno ). Urediniospores were increased by inoculating an aqueous spore suspension onto 21-day-old seedlings of susceptible oilseed line HA89 with a paintbrush in the first multiplication cycle. After collecting the urediniospores from these plants, a second multiplication cycle was carried out inoculating the freshly collected urediniospores with a vacuum-pump powered atomizer onto 21-day-old seedlings of HA89 previously sprayed with distilled water.

Plant materials and mapping population

The HAR6 sunflower germplasm population was obtained from the U.S. National Plant Germplasm System (NPGS, USA). Seeds of this population were sown under greenhouse conditions and inoculated as above with rust isolate B.A. & S. 2009. The original population was heterogeneous for its reaction to this isolate since susceptible and resistant plants were observed. One resistant plant was selfed and its progeny was inoculated again with the same isolate and no segregation for resistance was detected. These resistant plants were bulk-harvested and coded as HAR6-1. This inbred line was used for mapping purposes. HAR6-1 was emasculated during flowering and crossed with R702CLPlus. R702CLPlus is a restorer, proprietary, rust susceptible, imidazolinone resistant line (Sala ). Hybridity of F1 plants was checked by molecular markers. One selected F1 plant was selfed to obtain F2 seeds which were sown under greenhouse conditions. Ninety six F2 plants were selfed and seeds from each plant were harvested separately to provide F2:3 families. Progeny test of this F2:3 families for rust resistance indicate the genotype of their F2 plants.

Evaluation of rust resistance

Twenty five seeds from each of the 96 F2:3 families were planted in 20 × 20 × 30 cm pots, given a total of approximately 2400 F3 individuals. Twenty seeds of the lines HA89, HAR6-1 and R702CLPlus were planted in three replications as controls. Plants were grown in a greenhouse under natural light conditions supplemented with 400 W halide lamps to provide a 16 h day length. Day/night temperatures were 25 and 20°C, respectively.

The F3 plants, parental lines and susceptible control (HA89) were inoculated with P. helianthi spores of race 760 at the V2 developmental stage (Schneiter and Miller 1981), using the procedure described by Gulya and Masirevic (1996). After inoculation, plants were incubated in sealed chambers at 100% humidity in a dark room for 16 h at 18–20°C. Plants were then returned to the greenhouse and maintained as described previously. Evaluation of symptoms was conducted twelve days after inoculation, using a 0–4 rating that classifies 0, 1 and 2 as resistant plants and 3 and 4 as susceptible (Yang ). In this way, F2:3 families could be unequivocally scored as resistant (R), susceptible (S), or Segregant (Seg).

DNA marker analysis

Genomic DNA was isolated from young leaves of the parental lines and F2 individuals using Qiagen DNeasy 96 Plant Kit (Qiagen Inc., USA). DNA quality and quantity was determined using agarose gel electrophoresis.

Fifteen microsatellite (SSR) markers located on LG13 of the public sunflower genome map (Tang , Yu ) and two other SSRs from INTA Castelar located on the same LG (Paniego ) were screened for polymorphism in the parental lines. Additionally, three SSR markers were developed from the BAC clone P408L01 located on LG13 (Genbank accession HQ222362, Bachlava ), using the SSR Hunter version 1.3 software (http://www.biosoft.net/dna/SSRHunter.htm) utilizing parameters set to more than seven repetitions for di-nucleotide repeats, five for tri-, four for tetra- and three for penta-and hexa-nucleotide repeats (Li and Wan 2005). Sequences of the primers of these SSR markers are provided in Table 1. The SCAR marker HRG01 (Horn ) located on LG13 was also used.

Table 1

Primer sequence information of three SSR markers developed from the sequence of the BAC clone P408L01

Marker name	Sequences		Motif
	Forward	Reverse
NidGi1	cttgcacaaaggcccaaa	tttttcatgatgttgatctccaa	at
NidGi2	gacaactgcaacgctccata	cctggtgaaatcagatgcag	tcc
NidGi3	gaggagggtagccctcaaag	gacttcgtgtagccggtctc	mix

PCR assays were conducted in 10 μl reaction volume containing 1× PCR buffer, 400 μM dNTPs, 2.5 mM MgCl2, 0.5 U Taq DNA Polymerase (Biotools, Madrid, Spain), 0.4 μM of each primer and 50 ng of genomic DNA. PCR cycling conditions were as follows: an initial denaturation step at 95°C for 3 min, followed by 38 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 45 s and a final extension step at 72°C for 10 min. The PCR products were visualized on either 4% Metaphor agarose stained with SybrSafe (Invitrogen Life Technologies, Carlsbad, USA) or 6% polyacrylmide gels with silver nitrate staining (Silver Sequence; Promega Biotech, Madison, USA).

Linkage analysis

Genetic distances between the rust resistance gene and the molecular markers were calculated using Map Maker v2.0 (Lander ) with default parameters of LOD 3.0 and the Kosambi mapping function (Kosambi 1944). Goodness of fit to a 1:2:1 segregation ratio of F2 genotypes for rust reaction from the F3 families was tested by means of a chi-square analysis.

Conversion of a susceptible line to its rust resistance isoline

To confirm the usefulness of the marker tightly linked to the rust resistance gene in a breeding program, a susceptible line was converted to its rust resistance isoline by using a marker assisted backcross procedure. The susceptible line R702CLPlus was crossed with HAR6-1 and the F1 was backcrossed to the susceptible parent. Two hundred SSR markers developed by Tang and Yu were screened for polymorphisms between donor and recipient lines. Thirty four well distributed polymorphic SSR markers were selected for recipient genome background selection. Six hundred BC1F1 individuals were screened by the marker for the rust resistance gene to select rust resistant plants. These plants were also screened for genetic background similarity with the recipient line by using the already selected SSR markers. One selected BC1F1 individual was backcrossed again with the susceptible parent to obtain the BC2F1 progeny (364 plants). One BC2F1 plant selected by using the previously described procedure was selfed to obtain a BC2F2 population. This population was screened again by molecular markers and one selected plant was selfed to obtain a BC2F3 family. Twenty plants of this family were screened for their rust resistance as described above.

Results

Inheritance of rust resistance from HAR6

The inbred lines HA89 and R702CLPLus were highly susceptible to rust isolate B.A. & S 2009 showing big pustules (reaction type 4), whereas the selected inbred line HAR6-1 was resistant, with only localized necrosis at infection sites (reaction type 1). F1 plants were scored as resistant, indicating a dominant effect of the resistance gene (Table 2). The 96 F2 individuals segregated at a ratio of 74 R : 22 S which did not differ significantly from the expected 3 : 1 ratio (χ2 = 0.222, df = 1, p = 0.637). Rust phenotyping of 96 F2:3 families showed that the F2 population had 26 homozygous resistant, 48 heterozygous and 22 susceptible plants. A Chi-square test indicated that this fits a theoretical 1RR : 2Rr:1rr segregation ratio (χ2 = 0.333, df = 2, p = 0.846) which would be expected for a single segregating dominant gene. The combined F2 and F2:3 family data indicated that resistance in HAR6-1 was conferred by a single dominant gene, which was temporarily designated as R.

Table 2

Inheritance of rust resistance in HAR6. Response of sunflower plants [Resistant (R), Susceptible (S)] to rust in F1, F2 and BC1F1 populations resulting from crosses between resistant line HAR6 and R702CLPlus and Chi-square tests of single locus model for control of resistance

Rust Reaction	F1		F2		Ratio Tested	X2 p-value	F2:3			Ratio tested	X2 p-value
	R	S	R	S			R	H	S
Number of plants	20	0	74	22	3 : 1	0.637	26	48	22	1 : 2 : 1	0.846

Identification of SSR markers linked to the resistance gene

A set of 21 SSR selected from LG13 was screened to identify polymorphisms among resistant and susceptible parental lines. Only eight of them showed polymorphism between parental lines and were used for F2 genotypic analysis. Genotyping of these markers in the entire F2 population showed that markers ORS224, NidGi1, HRG01, ORS581, ZVG61, HA3330, HA4011 and ORS316 were mapped close to the R locus. ORS581 and ZVG61 were each found to be linked in coupling to the resistant gene at 1.5 and 0.7 cM, and exhibited dominant and co-dominant inheritance patterns respectively (Fig. 1).

Fig. 1

R in HAR6 was mapped to LG13. Eight markers were located in a region spanning 97.4 cM of genetic distance.

The BC1F1 population was screened with the molecular marker ZVG61, tightly linked to R and 286 plants were selected. These plants were screened with 34 additional SSR polymorphic markers well distributed in the sunflower genome to select a plant highly similar to the susceptible parent. BC2F1 plants were screened in the same way and a single plant was selfed to obtain a BC2F2 family. Fifty seven plants of this backcross generation were screened for homozygosity by the marker ZVG61 in order to detect homozygous plants for the resistant gene R. Thirteen homozygous plants were detected and they were screened for two remaining SSR markers to select for genetic background. One plant which was highly similar to R702CLPlus and homozygous for ZVG61 was selected and selfed. Twenty selfed individuals from this plant showed completely resistance to rust isolate B.A. & S 2009 indicating that a marker assisted backcrossing procedure for introgressing R into a susceptible oilseed background is feasible.

Discussion

The rapid changes that occur in the virulence of P. helianthi represent a continuous threat to the effectiveness of existing rust-resistance inbred lines and hybrids. This threat has spurred a vigorous search for genes conferring broad resistance or resistance to specific new races. Moreover, it is not advisable to use only one resistance gene in developing new cultivars. Rather, several different resistance genes should be employed, either by growing different hybrids carrying the different resistance genes or by pyramiding such genes. This strategy may extend the life cycle of each gene by keeping the selection pressure on the pathogen population as low as possible. Strong resistance genes effective against all known races could be overcome soon by new pathogen races if used alone. On the other hand, hybrids that combine strong genes with already overcome hypostatic genes may be resistant to such new races (Kelly and Miklas 1998). Hence, the combination of both type of genes, will extend the useful life of the overcome genes and will provide more durable resistance (Lawson ). Several sources conferring resistance to rust have been identified but only a few of them have been genetically characterized, mapped and linked to molecular markers. Up to the present, six sunflower rust resistance genes were genetically mapped to LGs 2 (R), 8 (R), 9 (R) and 13 (R/R/R), providing an opportunity to combine more rust resistance genes in an inbred line (Lawson , 2011, Qi , 2011b, Yu ).

Rust resistance in the line HAR6 was shown to be controlled by a single dominant gene by means of classical genetic analysis of F2 population derived from the cross of the susceptible line R702CLPlus with HAR6-1 and later confirmed in the analysis of the F2:3 families. This genetic factor, tentatively named R, was mapped to LG13 between molecular markers ZVG61 and ORS581, at 0.7 and 1.5 cM, respectively. The marker ZVG61 proved to be efficient for selection purposes to convert a susceptible line to a rust resistant isoline by means of marker assisted backcross selection.

Other rust resistance genes were also mapped on this LG. The rust resistant locus R, present in sunflower inbred lines HA-R1, HA-R3, HA-R4 and HA-R5, was mapped to the same genomic region flanked by markers ZVG61 and ORS581 (Qi ). Likewise, two other genes coming from different sources and named R have been mapped to LG13. One of them traces back to the proprietary line P2 (Lawson ) and maps near ORS191 (Lawson , Yu ). The other resistant gene traces back to the inbred line RHA340 and maps 0.2 cM away from RGC260 and 3 cM away from ORS316 (Bachlava , Radwan ). Additionally, the rust resistant factor present in the inbred line RHA397 which traces back to South African germplasm is allelic to the gene R (Gong ). Finally, R, a gene derived from a wild population of H. annuus also is located at the lower end of LG 13 (Qi ). In summary, up to the present the genetic factors (genes and/or alleles) carried by nine rust resistant sources are localized in the same genomic region of the LG13 of the sunflower consensus map. Clusters of genes conferring resistance to plant diseases in the host chromosomes have been identified in diverse plant species (Jones and Dangl 2006 and references herein). Genes within a cluster can be allelic variants of the same gene or closely linked genes. Interestingly, this region of the sunflower genome was previously described as a region populated of resistant gene analogs of CC-NBS-LRR subfamily (Radwan , Radwan 2010).

Three out of the four inbred lines carrying R (HA-R1, HA-R3 and HA-R4) were derived from an Argentinean interspecific pool obtained from crosses among Russian open pollinated varieties and the wild sunflower species H. annuus, H. argophyllus and H. petiolaris. The fourth line carrying R, HA-R5, was derived from a selection of the Argentine open pollinated cultivar Guayacan INTA (Gulya 1985). R from RHA340 traces back to the wild species H. argophyllus (Miller and Gulya 1988). HAR6, in turns, derived from a French introduction (Miller and Gulya 2001) and R from a wild population of H. annuus (Seiler and Jan 1997). It is clear that the rust resistant sources located in this region of LG13 are very diverse from a genealogical point of view.

Furthermore, these sources are also very different from a pathological point of view. In fact, HA-R1, HA-R3, HA-R4 and HA-R5 are members of the international set of rust differentials (Gulya and Masirevic 1988) and for this reason, they can be easily recognized by their pattern of resistance/ susceptibility to different rust races. In addition, all of them are susceptible to the North American race 777. HAR6, on the other hand, is resistant to this physiological race (Qi ) but shows susceptibility to certain isolates belonging to race 700 (Moreno ). R is resistant to race 700 (NA race 4, Miller and Gulya 1988), but is not effective against the new virulent races of 336 and 777 (Qi ). Tests with race 777 distinguished R and R; the first being susceptible, the second resistant, but both these genes are resistant to race 336 (Qi ).

All these rust resistant sources seem to encode different rust resistance specificities and appear to be different from each other taking into account the genealogical and pathological information available. Nevertheless, it is imperative to carry out allelism tests and to saturate this region with different types of molecular markers in order to determine the organization of this particular genomic region.

Anticipatory resistance breeding involves the breeding for disease resistance to virulent pathotypes before they become prevalent and cause significant yield and economic losses (McIntosh and Brown 1997). As was pointed out by Lawson for sunflower rust, precognition and thus strategic planning, these occurrences require a detailed understanding of the virulence structure in the pathogen population, the main mechanisms driving pathotype evolution and genetic understanding of the main resistance genes available in cultivars. In this sense, molecular markers tightly linked to the resistance genes permit to pyramidize different genes conferring resistance in a single line. Furthermore, R belongs to a cluster of rust resistance genes which are located at the end of LG13, as was the case for many other clusters of resistance gene analogs in the sunflower genome (Radwan ). A fine elucidation of this particular architecture will have an impact on molecular breeding, not only by the design of molecular markers targeting these regions, but also for the design of completely new regions combining useful disease resistant genes from different sources by recombination and selection with allele specific markers (Paniego ).