Literature DB >> 23469094

Contribution of V(H) replacement products in mouse antibody repertoire.

Lin Huang1, Miles D Lange, Yangsheng Yu, Song Li, Kaihong Su, Zhixin Zhang.   

Abstract

VH replacement occurs through RAG-mediated recombination between the cryptic recombination signal sequence (cRSS) near the 3' end of a rearranged VH gene and the 23-bp RSS from an upstream unrearranged VH gene. Due to the location of the cRSS, VH replacement leaves a short stretch of nucleotides from the previously rearranged VH gene at the newly formed V-D junction, which can be used as a marker to identify VH replacement products. To determine the contribution of VH replacement products to mouse antibody repertoire, we developed a Java-based VH Replacement Footprint Analyzer (VHRFA) program and analyzed 17,179 mouse IgH gene sequences from the NCBI database to identify VH replacement products. The overall frequency of VH replacement products in these IgH genes is 5.29% based on the identification of pentameric VH replacement footprints at their V-D junctions. The identified VH replacement products are distributed similarly in IgH genes using most families of VH genes, although different families of VH genes are used differentially. The frequencies of VH replacement products are significantly elevated in IgH genes derived from several strains of autoimmune prone mice and in IgH genes encoding autoantibodies. Moreover, the identified VH replacement footprints in IgH genes from autoimmune prone mice or IgH genes encoding autoantibodies preferentially encode positively charged amino acids. These results revealed a significant contribution of VH replacement products to the diversification of antibody repertoire and potentially, to the generation of autoantibodies in mice.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23469094      PMCID: PMC3585286          DOI: 10.1371/journal.pone.0057877

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The variable region exons of the immunoglobulin (Ig) genes are generated through sequential rearrangement of previously separated VH, DH (for heavy chain only), and JH gene segments catalyzed by the recombination activating gene products (RAG1 and RAG2) [1]–[5]. The specific joining of VH, DH, and JH gene segments is directed by the recombination signal sequences (RSSs) [6], [7]. The RSS consists of a highly conserved heptamer and a nonamer, separated by a non-conserved spacer region with either 12-bp or 23-bp nucleotides [6]–[9]. Efficient recombination occurs between a 12 bp RSS- and a 23 bp RSS-flanked gene segments [6], [7]. After RAG-mediated cleavage, the resulting double strand DNA breaks are repaired by the Non-Homologous End Joining (NHEJ) pathway [4], [5]. The coding end hairpins are opened and re-joined to form the coding exon of Ig gene, whereas the signal ends are ligated to form an excision circle and released from the chromosomal DNA [6], [7]. Rearrangement of Ig heavy (IgH) chain genes starts with a DH to JH recombination on one allele of the IgH loci in early progenitor (pro) B cells followed by recombining a VH gene segment to the DJH joint in late pro B cells [4], [5]. If the rearrangement is non functional, pro B cells will start to rearrange the second IgH allele [4], [5]. Functionally rearranged IgH genes will be expressed as the µ heavy chains to form pre-B cell receptors with the non-rearranged components, Vpre-B and lambda 5 [10]–[15]. Signaling from the pre-BCR will stimulate pre B cell proliferation and subsequent IgL gene rearrangement [14], [15]. The IgL gene variable region exon is generated by a one step rearrangement between a VL segment and a JL segment in the small precursor (pre-) B cells [4], [5], [16]. Due to the random recombination process, two thirds of the V(D)J rearrangement products might be out of reading frame and cannot express functional Ig peptides. Even if the IgH gene rearrangements are productive, they might fail to pair with the surrogate or conventional light chains. B cells lacking functional pre-B cell receptors (pre-BCRs) or B cell receptors (BCRs) cannot develop further along the B lineage pathway [14], [17]. Moreover, functionally expressed BCRs may be self-reactive. In all these cases, early B lineage cells retain the abilities to initiate secondary RAG-mediated recombination to alter the rearranged Ig genes, a process known as receptor editing [18]–[20]. Editing of rearranged IgL genes can occur through RAG-mediated secondary recombination between any upstream VL gene to a downstream JL gene [21]–[26]. The intervening DNA fragment containing the previously rearranged VLJL joint is deleted during the editing process [24]–[26]. As a default mechanism, pre-B cells with non-functional rearrangements on both Igκ alleles can initiate de novo rearrangements at the Igλ locus [26]. Accumulating studies indicated that non-functional or autoreactive IgH gene rearrangements can be edited through a VH replacement process [27]–[33]. VH replacement occurs through RAG-mediated recombination between a cryptic RSS embedded at the 3′ end of the rearranged VH gene with the 23 bp RSS from a upstream VH gene [31]. VH replacement was originally observed in murine pre-B cell leukemia cells, which generated functional IgH genes from non-functional IgH rearrangements [27], [28]. The potential biological function of VH replacement in editing IgH genes encoding anti-DNA antibodies was demonstrated in a series of studies using engineered mouse models carrying knocked-in IgH V(D)J rearrangements encoding anti-DNA antibodies [29], [34], [35]; Later studies also provided evidence that VH replacement was employed to diversity the antibody repertoire in mouse carrying knocked-in IgH genes encoding anti-NP antibodies [30], [36] and to rescue B cells with two alleles of non-functional IgH rearrangements [32], [33]. Despite of these findings in engineered mice, evidence for ongoing VH replacement during B cell development in normal mouse and contribution of VH replacement products to the mouse antibody repertoire were lacking for a long time [37], [38]. Due to the location of the cRSS at the 3′ end of VH germline gene, VH replacement renews almost the entire VH coding region but leaves a short stretch of nucleotides from the previously rearranged VH gene at the newly formed V-D junction [28], [31]. These remnants can be used as VH replacement footprints to trace the occurrence of VH replacement and to identify potential VH replacement products through analyzing IgH gene sequences [31]. Our previous analysis of 412 human IgH gene sequences estimated that VH replacement products contribute to about 5% of the primary B cell repertoire in human [31]. A recent analysis of IgH genes generated from knock-in mice expressing IgH genes encoding anti-DNA antibodies showed that 7.5% of the newly generated IgH genes contain pentameric VH replacement footprints [39]. Similar frequency of VH replacement products were also found in IgH genes obtained from the wild type B6 mice [39]. To explore the contribution of VH replacement products to the diversification of mouse IgH repertoire, we developed a Java based VH replacement footprint analyzer (VHRFA) program and analyzed 17,179 mouse IgH gene sequences from the National Center for Biotechnology Information (NCBI) database to identify VH replacement products. These results revealed a significant contribution of VH replacement products to the murine IgH repertoire and the enrichment of VH replacement products in several strains of autoimmune prone mice.

Results

The Mouse IgH Sequence Repertoire

To analyze a large number of IgH gene sequences and to identify potential VH replacement products, we developed a Java based VH Replacement Footprint Analyzer (VHRFA) program. Using the VHRFA program, we analyzed 17,179 mouse IgH gene sequences from the NCBI databases to identify VH replacement products. First, the potential VH, DH, and JH germline gene usage were assigned using the IMGT/V-QUEST program by sending batches of sequences using the VHRFA program (shown in Table S1). Based on the IgH CDR3 region sequences, clonally identical sequences were stripped out. There are 11309 unique IgH gene sequences; 10159 of them have clearly identifiable VH, DH, and JH genes; 9774 of them are productive and 373 of them are non-productive IgH rearrangements. In these IgH genes, different families of VH genes are used differentially (Fig. 1). There are 63683 (65%) functional IgH genes using the IGHV1/VHJ558 family of VH genes; 911 (or 9.3%) functional IgH genes using the IGHV5/VH7183 family of VH genes. The other families of VH genes, including IGHV4/X-24, IGHV11/CP3, IGHV12/CH27, IGHV13/3609N, and IGHV15/VH15A, are used at much lower frequencies (Fig. 1A). Among the non-functional IgH rearrangements, the usages of most VH gene families are similar to those in functional IgH genes, but the usages of the IGHV5/VH7183 and IGHV3/36–60 gene families are increased (Fig. 1A). Among different DH genes, the IGHD1-1 gene is used the most frequent in almost 39% of the IgH sequences (Fig. 1B). For the JH genes, the IGHJ2 gene is used the most frequent in 43% of IgH genes (Fig. 1C). It should be noted that these 17179 mouse IgH sequences were derived from about 861 published reports (Table S2), presumably from more than 861 experiments with different mice. This analysis represents a comprehensive view of the IgH repertoire of the current available mouse IgH gene sequences in the NCBI database.
Figure 1

Immunoglobulin VH, DH, and JH gene usages in the mouse IgH sequence repertoire.

The mouse IgH gene sequence data set containing 17,179 entries was downloaded from NCBI databases. The potential VH, DH, and JH germline gene assignments were performed using the IMGT/V-QUEST program by sending batches of sequences by the VHRFA program. Clonally redundant IgH sequences were removed if they contain identical CDR3 regions. The usages of different families of VH germline genes (A), DH genes (B), and JH (C) genes in the functional or non-functional unique IgH genes were analyzed.

Immunoglobulin VH, DH, and JH gene usages in the mouse IgH sequence repertoire.

The mouse IgH gene sequence data set containing 17,179 entries was downloaded from NCBI databases. The potential VH, DH, and JH germline gene assignments were performed using the IMGT/V-QUEST program by sending batches of sequences by the VHRFA program. Clonally redundant IgH sequences were removed if they contain identical CDR3 regions. The usages of different families of VH germline genes (A), DH genes (B), and JH (C) genes in the functional or non-functional unique IgH genes were analyzed.

Identification of VH Replacement Products

In the initial test, we use the VHRFA program to identify potential VH replacement products in 271 mouse IgH gene sequences described previously [40]. Among them, 252 unique IgH genes have clearly identifiable VH, DH, and JH germline genes. Then, we searched for VH replacement footprint motifs with 3, 4, 5, 6, or 7 nucleotides within the VH-DH junction (N1) regions of these IgH genes. VH replacement can only introduce VH replacement footprint in the N1 region. As an internal control, we searched for similar VH replacement footprint motifs in the DH-JH junction (N2) regions of these IgH genes, which are likely generated by random nucleotide addition. The frequencies of 3, 4, and 5-mer VH replacement footprint motifs in the N1 regions are significantly higher than those in the N2 regions (Table 1, top), suggesting that the distribution of such motifs in the N1 region is not due to random nucleotide addition. Based on the identification of the pentameric VH replacement footprints within the N1 regions, we estimate that the frequency of VH replacement products is 5.5% in these 252 mouse IgH gene sequences (Table 1, Top). If we consider the 4- or 3-mer of VH replacement footprints in the N1 regions, the frequencies of VH replacement products in these 252 IgH genes will be 21.2% or 38%, respectively (Table 1, top and the identified VH replacement products with 4-mer VH replacement footprints are shown in Table S5).
Table 1

Frequencies of VH replacement footprint motifs with different length in the N1 and N2 regions of the mouse IgH genes.

Number of unique Sequencesa Number of Sequences with V, D, J genesb Minimal Length of VH replacement footprintVH replacement footprint motifs in the N1 regionc VH replacement footprint motifs in the N2 regiond p-valuee Frequency of VH replacement products (%)f
Test IgH genesg 2712523101650.000140.1
455230.000121.8
51440.03085.5
6200.47860.79
7100.31680.39
NCBI IgH genesh 11309101593338426220.000133.55
416099790.000115.95
55342560.00015.29
6179500.00011.77
74580.00010.45

Unique sequences were identified after removal of IgH sequences with identical CDR3 regions.

Total number of IgH gene sequences with clearly identifiable VH, DH, and JH genes.

N1 region refers to the V-D junction.

N2 region refers to the D-J junction.

The frequencies of potential VH replacement footprint motifs in the N1 and N2 regions were compared by two-tailed Chi-square with Yate’s correction. p<0.05 was considered significant and p<0.0001is considered extremely significant.

Numbers of IgH gene sequences with VH replacement “footprint” motifs in the N1 regions were divided by the total number of IgH gene sequences with V, D, J gene assignment.

Mouse IgH gene sequences were previously described.

The mouse IgH gene sequences were downloaded from the NCBI database on May 7, 2011. The GI numbers of these sequences were included in Table S1.

Unique sequences were identified after removal of IgH sequences with identical CDR3 regions. Total number of IgH gene sequences with clearly identifiable VH, DH, and JH genes. N1 region refers to the V-D junction. N2 region refers to the D-J junction. The frequencies of potential VH replacement footprint motifs in the N1 and N2 regions were compared by two-tailed Chi-square with Yate’s correction. p<0.05 was considered significant and p<0.0001is considered extremely significant. Numbers of IgH gene sequences with VH replacement “footprint” motifs in the N1 regions were divided by the total number of IgH gene sequences with V, D, J gene assignment. Mouse IgH gene sequences were previously described. The mouse IgH gene sequences were downloaded from the NCBI database on May 7, 2011. The GI numbers of these sequences were included in Table S1. Further analysis of the 14 identified VH replacement products validated the assignment of VH replacement footprints by the VHRFA program (Table 2). Theoretically, VH replacement occurs through an upstream VH gene replacing a downstream rearranged VH gene. Among these 14 identified potential VH replacement products, 11 of them were likely generated through upstream VH genes replacing downstream VH genes; 3 of them did not follow such order (Table 2).
Table 2

List of potential VH replacement products in the test IgH sequences.

Sequence IDVH gene3′ VH PN1DH Potential footprint donorPositiona
FJ816520IGHV1S132tgtgcaagagggaggacctIGHD2-14IHGV8-10, IGHV8-14, IGHV8S2Y
FJ150867IGHV14-3tgtgcaagagggagaggggggcgtgatcIGHD1-1IGHV3-3, IGHV10-3, IGHV13-1Y
FJ150854IGHV1S132tgtgcaagagcgaacg IGHD2-12IGHV7-1Y
GU907018IGHV1-9tgtgccagaggagga IGHD1-1IGHV8-10, IGHV8-14, IGHV8S2Y
FJ816537IGHV1-74tgtgcaa gagaggIGHD2-12IGHV3-3, IGHV10-3, IGHV13-1Y
FJ816495IGHV1-47tgtgcaagg gagag IGHD1-1IGHV3-3, IGHV10-3, IGHV13-1Y
GU907010IGHV1-5tgtacaaga gagac IGHD2-1IGHV10-1, IGHV12-3Y
GU907038IGHV1-4tgtgcaagatc gaagg IGHD2-3IGHV3-1Y
FJ816546IGHV1-4tgtgcaag gaagaggIGHD1-1IGHV8-12, IGHV1-11, IGHV12-3Y
FJ816592IGHV14-1tgtgc cagag IGHD2-14IGHV2-6-7Y
FJ816442IGHV14-1tgtgcta aaacctcIGHD1-1IGHV2-3, IGHV2-6-6Y
FJ816522IGHV2-9-1tgtgccagagatcggggatatcgIGHD2-14IGHV7-3N
GU906999IGHV14-3tgtgctagaggagga IGHD1-1IGHV8-10, IGHV8-14, IGHV8S2N
GU906995IGHV14-3tgtgctggaggagga IGHD1-1IGHV8-10, IGHV8-14, IGHV8S2N

The identified VH replacement footprints in the N1 regions are underlined.

The relative positions of the potential donors and recipient VH genes in the identified VH replacement product were analyzed to determine if the VH replacement occurred through an upstream VH gene replacing a downstream VH gene (Y) or a downstream VH gene replacing an upstream gene (N). Only functional VH germline genes were used in this analysis.

The identified VH replacement footprints in the N1 regions are underlined. The relative positions of the potential donors and recipient VH genes in the identified VH replacement product were analyzed to determine if the VH replacement occurred through an upstream VH gene replacing a downstream VH gene (Y) or a downstream VH gene replacing an upstream gene (N). Only functional VH germline genes were used in this analysis.

Contribution of VH Replacement Products to the Mouse IgH Repertoire

Next, we analyzed the 11,309 unique mouse IgH gene sequences from the NCBI database using the VHRFA program to search for VH replacement products. We performed separated analyses to identify VH replacement footprints with 3, 4, 5, 6, and 7 nucleotides in the VH-DH junction (N1) regions. As internal controls, we also searched for the similar motifs in the DH-JH junction (N2) regions. The frequencies of identified VH replacement footprints with 3, 4, 5, 6, or 7 nucleotides in the N1 regions are significantly higher than those in the N2 regions (Table 1, bottom). These results indicate that the presence of these motifs at the N1 region is not due to random nucleotide addition. With a stringent setting to search for the pentameric VH replacement footprints at the N1 regions, 5.29% of the IgH genes contain such motifs and can be assigned as potential VH replacement products. If we consider VH replacement footprints with 4 or 3 nucleotides, 15.95% or 33.55% of the IgH genes, respectively, contain such motifs and can be assigned as potential VH replacement products (Table 1, bottom). These results revealed a significant contribution of VH replacement products to the diversification of the murine IgH repertoire.

Distribution of VH Replacement Products in IgH Genes Using Different Families of VH Genes

As we showed earlier, different VH gene families are used at different frequencies in the 10159 mouse IgH gene sequences. Next, we analyzed the distribution of the identified VH replacement products with 5-mer footprint motifs in IgH genes using different VH gene families. Among all the IgH genes using different families of VH genes, the frequency of VH replacement products in IgH genes using the VH2/Q52 genes is significantly higher than that in the overall mouse IgH sequences (Table 3). The frequencies of VH replacement products in IgH genes using the other VH gene families are quite similar. For example, although the IGHV1/VHJ558 and IGHV5/VH7183 families are used most frequently and the IGHV4/X-24, IGHV12/CH27, and IGHV14/SM7 families are used at very low frequencies, the frequencies of VH replacement products in IgH genes using the IGHV1/VHJ558, IGHV5/VH7183, IGHV4/X-24, IGHV12/CH27, and IGHV14/SM7 families are similar (Table 3). These results indicate that although different families of VH genes are used differentially during the primary V(D)J recombination, they are similarly targeted for secondary recombination during VH replacement. As an internal negative control, we analyzed the N1 regions of IgH genes using the DH proximal VH5-2/7183.2 gene. Among the 56 functional IgH genes using the VH5-2/7183.2 gene, there is no pentameric VH replacement footprints in the N1 regions. Such result provides supporting evidence that the presence of pentameric footprints in the N1 regions of mouse IgH genes is contributed by VH replacement.
Table 3

Frequencies of VH replacement products in IgH genes using different families of mouse VH genes.

VH familyNumber of IgH gene sequencesMotifs in the N1 regionFrequency of VH replacement products (%)a
VH1/J55865303144.81
VH2/Q52665558.27c
VH3/36-60565305.31
VH4/X-245735.26
VH5/7183998686.81
VH6/J60613164.58
VH7S10725383.16
VH8/360913996.47
VH9/VGAM3-8144117.64
VH10/VH1012743.15
VH11/CP33700
VH12/CH274336.98
VH13/3609N7114.29
VH14/SM7459265.66
VH15/VH15A400
VH5-2/7183.2b 5600

Number of IgH gene sequences with VH replacement “footprint” motifs in the N1 regions divided by the total number of IgH gene sequences assigned to a VH gene family.

Functional IgH genes using the VH5-2/7183.2 gene were analyzed for potential VH replacement footprints in the N1 regions.

The frequency of VH replacement products using VH2/Q52 family of VH genes is significantly higher than the overall frequency of VH replacement products in mouse IgH genes.

Number of IgH gene sequences with VH replacement “footprint” motifs in the N1 regions divided by the total number of IgH gene sequences assigned to a VH gene family. Functional IgH genes using the VH5-2/7183.2 gene were analyzed for potential VH replacement footprints in the N1 regions. The frequency of VH replacement products using VH2/Q52 family of VH genes is significantly higher than the overall frequency of VH replacement products in mouse IgH genes.

Enrichment of VH Replacement Products in IgH Genes Derived from Different Strains of Autoimmune Prone Mice and IgH Genes Encoding Autoantibodies

To explore the biological significance of VH replacement in mouse, we analyzed the distribution of VH replacement products in IgH genes correlating with different keywords in the NCBI database. Based on the identification of 5-mer VH replacement footprints within the N1 regions, the frequencies of VH replacement products in IgH genes derived from C57BL/6 and BALB/c strains of mice are 3.17% and 5%, respectively (Fig. 2A and Table S6). Such numbers may serve as the basal levels of VH replacement products in these mice. Comparing IgH genes derived from several strains of mice, the frequencies of VH replacement products are highly elevated in IgH genes derived from different strains of autoimmune prone mice (Fig. 2A). In particular, the frequencies of VH replacement product are elevated in IgH genes derived from lupus prone NZB/NZW F1, NZM2410, MRL/lpr, and SLE1/SLE3 mice. In IgH genes derived from mice carrying the spontaneous Faslpr mutation (MRL/MpJ-Lpr/Lpr), the frequency of VH replacement products is 15.38%. In IgH genes from the Sle1/Sle3 mice, the frequency of VH replacement products is 30%. These frequencies are significantly higher than that in the BALB/c or C57BL/6 mice (p<0.05, two tailed Chi-square test) (Fig. 2A). The elevated levels of VH replacement products in autoimmune prone mice suggest that VH replacement products contribute to the generation of autoantibodies. Indeed, further analyses of the IgH genes encoding different antibodies showed that the frequencies of VH replacement products are 12.1% in IgH genes encoding ANA antibody and 9.34% in IgH genes encoding anti-DNA antibodies. These levels are significantly higher than those in the BALB/c or C57BL/6 mice. As a negative control, the frequency of VH replacement products in IgH genes obtained from mice immunized with NP is 3.66%, which is similar to that in the C57BL/6 mice. Taken together, these results provide the first information that VH replacement products are highly enriched in IgH genes derived from different strains of autoimmune prone mice and in IgH genes encoding anti-DNA and ANA autoantibodies.
Figure 2

Enrichment of VH replacement products in IgH genes derived from different strains of autoimmune prone mice and IgH genes encoding autoantibodies.

The frequencies of VH replacement products in IgH genes derived from different strains of mice were analyzed using the VHRFA program based on the keyword linked to each IgH gene in the NCBI database. VH replacement products were assigned based on the identification of (A) 5-mer VH replacement footprints, (B) 4-mer VH replacement footprints, or (C) 3-mer VH replacement footprints within the VH-DH junctions (N1 regions). The frequencies of VH replacement products in different subcategories were compared with that in the BALB/c mice. n, number of IgH sequences in each subcategory. Statistical significance was determined using a two-tailed Chi square test with Yate’s correction. p<0.05 (*) is considered significant and p<0.0001 (**) is considered extremely significant. The detailed sequence analysis and the identified VH replacement products with 5-mer VH replacement footprints correlating with keywords are included in Table S6.

Enrichment of VH replacement products in IgH genes derived from different strains of autoimmune prone mice and IgH genes encoding autoantibodies.

The frequencies of VH replacement products in IgH genes derived from different strains of mice were analyzed using the VHRFA program based on the keyword linked to each IgH gene in the NCBI database. VH replacement products were assigned based on the identification of (A) 5-mer VH replacement footprints, (B) 4-mer VH replacement footprints, or (C) 3-mer VH replacement footprints within the VH-DH junctions (N1 regions). The frequencies of VH replacement products in different subcategories were compared with that in the BALB/c mice. n, number of IgH sequences in each subcategory. Statistical significance was determined using a two-tailed Chi square test with Yate’s correction. p<0.05 (*) is considered significant and p<0.0001 (**) is considered extremely significant. The detailed sequence analysis and the identified VH replacement products with 5-mer VH replacement footprints correlating with keywords are included in Table S6. Using the VHRFA program, we also analyzed the frequencies of VH replacement products based on the 4- or 3-mer of VH replacement footprints in IgH genes derived these diseased subcategories. Extending the assignment of VH replacement products with considering the 4- and 3-mer VH replacement footprints clearly increases the frequencies of VH replacement products in IgH genes from all subcategories. With considering the 4-mer VH replacement footprints, the frequencies of VH replacement products in IgH genes derived from NZB/NZW, MRL/lpr, SLE1, SLE1/SLE3 and IgH genes encoding anti-DNA and ANA antibodies are significantly higher than that in the BALB/c mice (p<0.05, two tailed Chi-square test) (Fig. 2B); with considering the 3-mer VH replacement footprints, the frequencies of VH replacement products in IgH genes derived from NZB/NZW, NZM2410, MRL/lpr, SLE1, SLE1/SLE3, NOD/NOR and IgH genes encoding auto antibodies, anti-DNA antibodies, and ANA antibodies are significantly higher than that in the BALB/c mice (p<0.05, two tailed Chi-square test) (Fig. 2C). Taken together, these results showed that VH replacement products are enriched in IgH genes derived from different strains of autoimmune prone mice and in IgH genes encoding autoantibodies.

The Identified VH Replacement Footprints Preferentially Encode Charged Amino Acids

Our previous analysis of the identified VH replacement products in human IgH genes showed that the VH replacement footprints preferentially encode charged amino acids into the IgH CDR3 regions [31]. Here, analysis of the identified VH replacement products from mouse IgH genes showed that 64% of the amino acids encoded by the identified VH replacement footprints contribute charged amino acids, including K, R, D, E, N, and Q. Such frequency is significantly higher than the overall frequency of charged amino acids in the N1 regions (p<0.0001) (Fig. 3A). Moreover, the frequencies of charged amino acids, including E, K, and R, encoded by the identified VH replacement footprints are significantly higher than those encoded by the N1 regions of non-VH replacement products (p<0.0001) (Fig. 3B). The preferential contribution of charged amino acids by the VH replacement footprints seems to be predetermined by the sequences at the 3′ end of VH germline genes following the cRSS sites. The frequencies of charged amino acids encoded by the 3′ ends of VH germline gene, including K, R, D, E, N, and Q, are significantly higher than those encoded by the DH germline genes (p<0.0001) (Fig. 3C). In non-functional IgH genes, the identified VH replacement footprints also preferentially encode charged amino acids, although the usages of different charged residues are slightly different from those in the functional VH replacement products (Fig. 3D). Such results are consistent with previous findings that the VH replacement footprints identified in human or mouse VH replacement products preferentially encoded charged residues [31], [39].
Figure 3

VH replacement footprints preferentially contribute charged amino acids to the CDR3 regions.

(A) The frequencies of charged amino acids encoded by the identified pentameric VH replacement footprints or the N1 regions of non-VH replacement products were compared. Detailed amino acid sequences of the IgH CDR3 regions are listed in Table S6. (B) The frequencies of individual amino acid encoded by the identified VH replacement footprints or the N1 regions of non-VH replacement products were compared. n, amino acids encoded by the identified VH replacement footprints or the N1 regions of non-VH replacement products. (C) The frequencies of individual amino acid encoded by the 3′ end of VH germline genes and DH regions were compared. n, amino acids encoded by the VH gene 3′ ends or DH regions. (D) Usages of different amino acids encoded by the identified VH replacement footprints in functional VH replacement products and non-functional VH replacement products. n, amino acids encoded by the identified VH replacement footprints. Statistical significance was determined using a two-tailed Chi square test with Yate’s correction. n, number of amino acid residues encoded by indicated sequences. p<0.05 (*) is considered significant and p<0.0001 (**) is considered extremely significant.

VH replacement footprints preferentially contribute charged amino acids to the CDR3 regions.

(A) The frequencies of charged amino acids encoded by the identified pentameric VH replacement footprints or the N1 regions of non-VH replacement products were compared. Detailed amino acid sequences of the IgH CDR3 regions are listed in Table S6. (B) The frequencies of individual amino acid encoded by the identified VH replacement footprints or the N1 regions of non-VH replacement products were compared. n, amino acids encoded by the identified VH replacement footprints or the N1 regions of non-VH replacement products. (C) The frequencies of individual amino acid encoded by the 3′ end of VH germline genes and DH regions were compared. n, amino acids encoded by the VH gene 3′ ends or DH regions. (D) Usages of different amino acids encoded by the identified VH replacement footprints in functional VH replacement products and non-functional VH replacement products. n, amino acids encoded by the identified VH replacement footprints. Statistical significance was determined using a two-tailed Chi square test with Yate’s correction. n, number of amino acid residues encoded by indicated sequences. p<0.05 (*) is considered significant and p<0.0001 (**) is considered extremely significant.

The 3-mer VH Replacement Footprints are Less Likely Contribute Charged Amino Acids to the CDR3 Regions

VH replacement was considered as a receptor editing process to change non-functional IgH rearrangements or IgH genes encoding autoantibodies [29], [41]. Finding that the 5-mer VH replacement footprints preferentially encoded charged amino acids, especially R and K residues, is contrast to the original goal of VH replacement to eliminate autoreactive IgH genes. Because charged residues within the IgH CDR3 might contribute to autoreactivity. Interestingly, when we analyzed the amino acids encoded by the identified 3-mer VH replacement footprints, the usages of charged residues, including R, K, and E, are significantly reduced; meantime, the usages of several neutral residues, including H, L, and Y, are significantly increased (Fig. 4A). These results showed that shorter VH replacement footprints are less likely to encode charged residues.
Figure 4

Comparison of the amino acids encoded by VH replacement footprints and the IgH CDR3 lengths of VH replacement products.

(A) The usages of different amino acids encoded by VH replacement footprints with 5, 4, or 3 nucleotides were compared. n, number of amino acid residues encoded by the identified VH replacement footprints with different lengths. Statistical significance was determined using a two-tailed Chi square test with Yate’s correction. p<0.05 (*) is considered significant and p<0.0001 (**) is considered extremely significant. (B) Comparison of the IgH CDR3 lengths of VH replacement products containing the 5-mer or the 3-mer VH replacement products with the CDR3 length of the total functional IgH genes. n, number of IgH sequences or VH replacement products with 3- or 5-mer VH replacement footprints. Statistical significance was determined using unpaired t test. p<0.05 (*) is considered significant and p<0.0001 (**) is considered extremely significant.

Comparison of the amino acids encoded by VH replacement footprints and the IgH CDR3 lengths of VH replacement products.

(A) The usages of different amino acids encoded by VH replacement footprints with 5, 4, or 3 nucleotides were compared. n, number of amino acid residues encoded by the identified VH replacement footprints with different lengths. Statistical significance was determined using a two-tailed Chi square test with Yate’s correction. p<0.05 (*) is considered significant and p<0.0001 (**) is considered extremely significant. (B) Comparison of the IgH CDR3 lengths of VH replacement products containing the 5-mer or the 3-mer VH replacement products with the CDR3 length of the total functional IgH genes. n, number of IgH sequences or VH replacement products with 3- or 5-mer VH replacement footprints. Statistical significance was determined using unpaired t test. p<0.05 (*) is considered significant and p<0.0001 (**) is considered extremely significant.

VH Replacement Products have Longer CDR3 Lengths

During VH replacement products, a short stretch of nucleotides from previously rearranged VH genes were left within the newly generated VH-DJH junctions [31]. Comparison of the IgH CDR3 lengths of the identified VH replacement products showed that the average CDR3 length of VH replacement products with 5-mer footprints is significantly longer than that of VH replacement products with 3-mer footprints; the average CDR3 length of VH replacement products with 3-mer footprints is significantly longer than that of the total functional IgH genes in the NCBI database (p<0.0001, unpaired t test) (Fig. 4B). These results indicate that elongation of IgH CDR3 region is one of the intrinsic features of VH replacement.

Selection of VH Replacement Footprints Encoding Positively Charged Residues in Autoantibodies

The preferential contribution of charged amino acids by VH replacement footprints is likely predetermined by the 3′ end sequences of VH germline genes. Based on the 3′ end sequences of VH germline genes, VH replacement footprints can contribute almost equal numbers of positively or negatively charged residues (Fig. 5A). Indeed, in the identified VH replacement products from IgH genes derived from BALB/c or C57BL/6 mice, the frequencies of positively and negatively charged amino acids encoded by the VH replacement products are similar (Fig. 5A). However, in the identified VH replacement products in IgH genes from autoimmune prone mice, including MRL/lpr and Sle1/Sle3 mice, the frequencies of positively charged residues encoded by the VH replacement footprints are significantly higher than that in the control mice. Meantime, the frequencies of negatively charged residues encoded by the VH replacement footprints are significantly lower than that in the control mice (Fig. 5A). The frequencies of negatively charged residues encoded by the identified VH replacement footprints are significantly lower in IgH genes derived from C56BL/6/lpr mice and in IgH genes encoding anti-DNA or ANA antibodies (Fig. 5A). Detailed analysis of the functional versus non-functional IgH genes derived from MRL/lpr mice showed that the frequencies of positively charged residues encoded by the identified VH replacement footprints were elevated in functional but not in non-functional IgH genes (Fig. 5B). These results indicate that the positively charged residues encoded by VH replacement products were positively selected in these autoimmune prone mice.
Figure 5

The enriched VH replacement products identified in different strains of autoimmune prone mice or IgH genes encoding autoantibodies have been positively selected during autoimmune responses.

(A) Analysis of the frequencies of positively charged versus negatively charged amino acids encoded by the 3′ end VH genes and the identified VH replacement footprints from different strains of mice or IgH genes encoding autoantibodies. Statistical significance was determined using a two-tailed Chi square test with Yate’s correction. p<0.05 (*) is considered significant. (B) Comparison of the amino acids encoded by the identified VH replacement footprints in MRL/lpr mice. n, numbers of amino acids encoded by the identified VH replacement footprints. (C) Mutation status analysis of identified VH replacement products and non-VH replacement products from different subgroups of IgH genes.

The enriched VH replacement products identified in different strains of autoimmune prone mice or IgH genes encoding autoantibodies have been positively selected during autoimmune responses.

(A) Analysis of the frequencies of positively charged versus negatively charged amino acids encoded by the 3′ end VH genes and the identified VH replacement footprints from different strains of mice or IgH genes encoding autoantibodies. Statistical significance was determined using a two-tailed Chi square test with Yate’s correction. p<0.05 (*) is considered significant. (B) Comparison of the amino acids encoded by the identified VH replacement footprints in MRL/lpr mice. n, numbers of amino acids encoded by the identified VH replacement footprints. (C) Mutation status analysis of identified VH replacement products and non-VH replacement products from different subgroups of IgH genes.

The Identified VH Replacement Products are Mutated

The accumulation of VH replacement products in IgH genes derived from different strains of autoimmune prone mice and IgH genes encoding different autoantibodies suggested that VH replacement products contribute to the generation of autoantibodies in mice. Analyses of the mutation status of these identified VH replacement products showed that the enriched VH replacement products in autoimmune prone mice or IgH genes encoding anti-DNA or ANA autoantibodies are mutated (Fig. 5C), indicating that these VH replacement products are positively selected in these autoimmune prone mice.

Discussion

In the current report, we analyzed 17,179 mouse IgH gene sequences available from the NCBI database and provided a comprehensive view of the VH, DH, and JH gene usages of these mouse IgH genes. Based on the identification of the pentameric VH replacement footprints in the N1 regions, we estimated that the frequency of VH replacement products in the 11309 unique mouse IgH gene sequences with identifiable DH genes is 5.29%. Such result indicates a significant contribution of VH replacement products to the diversification of murine antibody repertoire. This result is consistent with the previously estimated frequencies of VH replacement products in human and mouse IgH genes [31], [39]. It should be pointed out that such estimation is based on the identification of VH replacement footprints with a minimal length of 5 nucleotides. In comparison to human VH germline genes, many mouse VH germline genes have fewer nucleotides following the cRSS sites. Out of the 150 functional mouse VH germline genes with cRSS sites, 60 of them have only 5 nucleotides following the cRSS sites. If there is any exo-nuclease activity to remove one nucleotide at either the 3′ or the 5′ end of the VH replacement footprint during primary VH to DJH recombination or VH replacement recombination, respectively, the remaining VH replacement footprints will have less than 5 nucleotides and cannot be identified from this analysis. Based on this consideration, assigning VH replacement footprints with 4 or 3 nucleotides might be a reasonable and accurate method to identify potential VH replacement products in mouse IgH genes. If we consider the 4- or 3-mer VH replacement footprints at the N1 regions to assign VH replacement products, the frequencies of VH replacement products in the mouse IgH gene sequences should be 16% or 32%, respectively. It has been shown previously that in mice carrying two non-functional alleles of IgH genes, VH replacement occurs efficiently to generate almost normal number of B cells with a diversified repertoire [32], [33]. All these functional IgH genes in this mouse are generated through VH replacement. However, only about 20% of the IgH gene sequences contain potential VH replacement footprints (>3 mer). The other 80% of IgH gene sequences have no identifiable VH replacement footprints [32], [33]. This result indicates that most of the VH replacement footprints are deleted during VH replacement recombination. Thus, even if using the minimal length of VH replacement footprints with 4 or 3 nucleotides, we may still under-estimate the actual frequency of VH replacement products in the murine IgH repertoire. Theoretically, 66.7% of the IgH rearrangements generated during V(D)J recombination will be out of reading frame and cannot produce functional IgH proteins; about 44% of the pro B cells undergoing V(D)J recombination should carry non-functional rearrangements on both IgH alleles. If VH replacement can efficiently rescue these pro B cells, at least 44% of the expressed IgH genes should be generated by VH replacement. We should also point out that this sequence analysis based approach in identification of VH replacement footprints may have false positive calls. Theoretically, there are no VH replacement footprints in the N2 regions. In some of the IgH sequences, we identified similar 3, 4, or 5 mer VH replacement footprint motifs in the N2 regions, although the frequencies of such motifs in the N2 regions are significantly lower than those in the N1 regions. The presence of such VH replacement footprint motifs in the N2 regions could be due to random nucleotide addition during V(D)J recombination. In this regard, a low frequency of identified footprints might be false positive. If we use the 5-mer VH replacement footprints to assign VH replacement products, the frequencies of VH replacement products in IgH genes derived from BALB/C or C57BL/6 mice are about 5% or 3.2%, respectively, which may represent the basal level of VH replacement product in these two strains of mice. Interestingly, the frequencies of VH replacement products are significantly elevated in IgH genes derived from different strains of autoimmune prone mice, including MRL/Lpr and Sle1/Sle3 mice. It has been well demonstrated that these mice spontaneously produce anti-DNA or anti-ANA antibodies and develop lupus like symptom [42]–[49]. Indeed, VH replacement products are significantly elevated in IgH genes encoding anti-DNA antibodies or ANA autoantibodies derived from mice with lupus glomerular nephritis. These results suggested a potential contribution of VH replacement products to the generation of autoantibodies. When we consider the 4- or 3-mer VH replacement footprints to assign VH replacement products, the frequencies of VH replacement products are elevated in all the sub-categories of IgH genes. Nevertheless, the frequencies of VH replacement products in IgH genes derived from different strains of autoimmune prone mice and IgH genes encoding anti-DNA and ANA antibodies are significantly higher than that in the BALB/c mice. Due to the location of the cRSS, VH replacement will leave a short stretch of VH replacement footprints to elongate the IgH CDR3 region [31], [41]. Strikingly, the identified pentameric VH replacement footprints preferentially encode charged amino acids in the newly formed CDR3 regions. Such features are commonly found in VH replacement products identified from human and mouse IgH genes [31], [39] and highly conserved in all the jawed vertebrates [50]. IgH genes with long CDR3 and charged residues are frequently encoding autoantibodies or anti-viral antibodies [51]. Here, our results showed that the frequencies of VH replacement products are significantly elevated in IgH genes encoding anti-DNA and ANA autoantibodies in mouse. Theoretically, the VH replacement footprints can encode either positively or negatively charged residues. Analysis of the amino acids encoded by the identified VH replacement products from different strains of autoimmune prone mice and IgH genes encoding autoantibodies showed that the frequencies of positively charged residues encoded by VH replacement footprints are significantly elevated; while the frequencies of negatively charged residues encoded by VH replacement footprints are significantly reduced. Previous studies have shown that positively charged residue like Arg within the IgH CDR3 is critical for DNA binding [52]–[54]. These results suggested that the identified VH replacement products from autoimmune prone mice have been positively selected. Such notion is also supported by the accumulated mutations in these identified VH replacement products. VH replacement was originally recognized as a receptor editing process to change either non-functional IgH genes or IgH genes encoding autoreactive antibodies [20], [55]. The enrichment of VH replacement products in IgH genes from different strains of autoimmune prone mice and in IgH genes encoding autoantibodies are surprising findings from this study. Currently, it is not clear why VH replacement products are accumulated in autoimmune prone mice. Like any recombination process, VH replacement is a random process that can generate non-functional IgH genes or IgH genes encoding autoreactive antibodies. Previous studies have shown that VH replacement products generated through replacing the knocked-in anti-DNA IgH genes can produce high affinity anti-DNA antibodies during chronic graft-versus-host (cGVH) response [56]. Theoretically, after VH replacement recombination, the newly generated IgH genes should be subjected to strict negative selection again to eliminate B cells expressing autoreactive BCRs. The observed accumulation of VH replacement products in autoimmune prone mice could be due to the defective negative selection processes in these mice. In autoimmune prone mice, the newly generated VH replacement products encoding autoreactive antibodies cannot be efficiently eliminated, but are rather positively selected and contribute to the generation of autoantibodies. To this extend, the different strains of autoimmune prone mice will be excellent experimental models to dissect how the VH replacement products are selected and enriched during early B cell development. Our analyses of the amino acid residues encoded by the identified VH replacement footprints also uncovered an interesting finding that short VH replacement footprints, especially the 3-mer footprints, encode less charged residues. These results suggested that if the VH replacement footprints were trimmed down to 3-mer during either primary or secondary recombination, they will be less likely to contribute charged amino acids into the IgH CDR3 regions. Given the fact that 33.55% of IgH genes contain 3-mer VH replacement footprints at their N1 regions, it is reasonable to conclude that the majority of these VH replacement products successfully edited the IgH genes without introducing of extra charged residues into the newly formed CDR3 regions. The observed accumulation of VH replacement products based on the identification of 5-mer footprints in the N1 regions in IgH genes derived from autoimmune prone mice may represent the failed VH replacement attempts either due to defects in negative selection or defects in trimming down the VH replacement footprints during primary or secondary recombination. Such findings raised several interesting questions that require further studies. In conclusion, analysis of large number of mouse IgH gene sequences from the NCBI database provides a comprehensive view of the IgH repertoire of the available mouse IgH genes in the NCBI database and reveals a significant contribution of VH replacement products to the diversification of mouse IgH repertoire. Identification of enriched VH replacement products in IgH genes derived from different strains of autoimmune prone mice and IgH genes encoding autoantibodies indicated that abnormal regulation of VH replacement may contribute to the generation of autoreactive antibodies.

Materials and Methods

Mouse IgH Sequences

Entrez IDs of mouse IgH sequences were provided by Igblast (http://www.ncbi.nlm.nih.gov/projects/igblast/) on May 07, 2011, which were used to download GenBank records of the sequences from NCBI. There were total 17,179 mouse IgH gene sequences retrieved at that time. The IDs of these IgH genes and their VH, DH, and JH gene assignments are included in Table S1. After assignment of the potential germline VH, DH, JH genes, clonally redundant sequences were stripped out based on their identical CDR3 regions. The resulting 11,308 unique sequences were further analyzed. Clonally related sequences with mutations within their CDR3 regions still remain. The 17179 mouse IgH sequences were derived from 861 published studies (Table S2). There were 1, 2, 4, 4, and 6 publications that contributed more than 500, 400–499, 300–399,200–299, and 100–199 sequences, respectively; 127 publications contributed 11–99 sequences; 717 publications contributed 10 or less than 10 sequences.

The VHRFA Program

We developed a Java-based VHRFA program to incorporate assignments of the VH, DH, and JH germline gene segments using the V-QUEST program (http://www.imgt.org/IMGT_vquest), identification of VH replacement footprints with different lengths, analysis of amino acids encoded by the identified VH replacement footprints, calculation of the amino acid usage encoded by the identified VH replacement footprints, and correlation of the identified VH replacement products with different keywords and publications associated with the sequences in the NCBI database.

VH, DH, and JH Germline Gene Assignment

Mouse IgH sequences in the GenBank format were converted to FASTA format and submitted to IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/share/textes/) for assign potential germline VH, DH, JH genes, allowing 1 mutation at the 3′ end of VH genes and at the 5′ end of JH genes. All the IgH gene sequences were analyzed in batches containing 50 sequences each batch and the results were downloaded to a local computer as Excel files. These processes were conducted using the VHRFA program.

Identification of VH Replacement Footprint

All the rest steps were conducted on a local computer by the VHRFA program. First, a library file was generated, which contains all the potential VH replacement footprints derived from functional VH germline reference genes from the IMGT database (Table S3). Basically, the 3′ end segments following the cRSS sites from functional mouse VH genes were sliced into different groups with 3, 4, 5, 6, 7, 8, 9, 10, and 11 nucleotides in length (Table S4). The VHRFA program will use this library to search the N1 (VH-DH junction (N1) or DH-JH junction (N2, as negative control) regions of the IgH genes to identify matched footprint motifs. For each IgH gene, the VHRFA program started by searching the longest footprint motifs (11 mer) from the 5′ to 3′ of the DNA sequences and then goes to search footprints with one nucleotide shorter. The identified footprints were listed if it does not overlap with any previously identified footprint within this region. For examples, the end results of footprint analyses of with specified 5 mer included all the footprints with 5, 6, 7, 8, 9, 10, and 11 mer from the VH replacement footprint library. The end result was exported as a CVS file that contains the gene ID, functionality, VH, DH, JH gene assignment, VH replacement footprint in N1 (N1 signatures) or N2 (N2 signatures), together with other information from the original Excel file provided by the IMGT V-QUEST program. The identified footprints were shown in parenthesis within the N1 or N2 region sequences.

Analysis of the Amino Acid Encoded by VH Replacement Footprints, Keyword and Publication Linked to Each Gene, and Mutation

After identification of the VH replacement footprints within the N1 regions, the VHRFA program further analyzed the amino acids encoded by the VH replacement footprints and the usages of different amino acid. Each result was exported as an individual Excel file. The VHRFA program can also analyze the original GenBank file to correlate the keywords and publication information with each IgH gene sequence. Basically, the VHRFA program parses the source GenBank file for keywords in the KEYWORDS and FEATURES sections of each entry sequence and output the keyword list in correlation with the sequence IDs, VDJ assignments, N1 footprints, and N2 footprints. Through this analysis, we can determine the distribution of VH replacement products in different diseases. For mutation analysis, the VHRFA program only calculated the mutation rate of IgH VH genes with >80% similarities to the assigned germline VH genes.

Statistical Analysis

Statistical significance was determined by using either the two tailed Chi-square test with Yates’ correction or non paired student t test. Significant difference was determined if the p value <0.05. Analyses of mouse IgH genes and identification of VH replacement products. (XLSX) Click here for additional data file. Number of sequences from each publication. (XLSX) Click here for additional data file. Mouse VH genes containing the TACTGTG cRSS. (DOCX) Click here for additional data file. Potential mouse VH replacement footprint motifs with different length. (DOCX) Click here for additional data file. Identification of 4-mer VH replacement footprint motifs in mouse IgH sequences. (DOCX) Click here for additional data file. Identification of VH replacement products in IgH genes correlating with different keywords. (DOCX) Click here for additional data file.
  56 in total

1.  Contribution of Vh gene replacement to the primary B cell repertoire.

Authors:  Zhixin Zhang; Michael Zemlin; Yui-Hsi Wang; Delicia Munfus; Leslie E Huye; Harry W Findley; S Louis Bridges; David B Roth; Peter D Burrows; Max D Cooper
Journal:  Immunity       Date:  2003-07       Impact factor: 31.745

2.  Antibody repertoires generated by VH replacement and direct VH to JH joining.

Authors:  Sergei B Koralov; Tatiana I Novobrantseva; Jessica Königsmann; Andreas Ehlich; Klaus Rajewsky
Journal:  Immunity       Date:  2006-07       Impact factor: 31.745

Review 3.  V(D)J recombination: mechanisms of initiation.

Authors:  David G Schatz; Patrick C Swanson
Journal:  Annu Rev Genet       Date:  2011-08-19       Impact factor: 16.830

4.  Recombination between an expressed immunoglobulin heavy-chain gene and a germline variable gene segment in a Ly 1+ B-cell lymphoma.

Authors:  R Kleinfield; R R Hardy; D Tarlinton; J Dangl; L A Herzenberg; M Weigert
Journal:  Nature       Date:  1986 Aug 28-Sep 3       Impact factor: 49.962

5.  Plasma cells and nonplasma B cells express differing IgE repertoires in allergic sensitization.

Authors:  Tobias Rogosch; Sebastian Kerzel; Larisa Sikula; Katrin Gentil; Michael Liebetruth; Karl-Peter Schlingmann; Rolf F Maier; Michael Zemlin
Journal:  J Immunol       Date:  2010-04-02       Impact factor: 5.422

Review 6.  The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses.

Authors:  S M Lewis
Journal:  Adv Immunol       Date:  1994       Impact factor: 3.543

7.  Editing disease-associated autoantibodies.

Authors:  C Chen; E L Prak; M Weigert
Journal:  Immunity       Date:  1997-01       Impact factor: 31.745

8.  The V(D)J recombination activating gene, RAG-1.

Authors:  D G Schatz; M A Oettinger; D Baltimore
Journal:  Cell       Date:  1989-12-22       Impact factor: 41.582

9.  Cationic residues in pathogenic anti-DNA autoantibodies arise by mutations of a germ-line gene that belongs to a large VH gene subfamily.

Authors:  T L O'Keefe; S K Datta; T Imanishi-Kari
Journal:  Eur J Immunol       Date:  1992-03       Impact factor: 5.532

10.  Phylogenetic conservation of the 3' cryptic recombination signal sequence (3'cRSS) in the VH genes of jawed vertebrates.

Authors:  Yi Sun; Zhancai Liu; Zhaoyong Li; Zhengxing Lian; Yaofeng Zhao
Journal:  Front Immunol       Date:  2012-12-20       Impact factor: 7.561

View more
  7 in total

1.  Heavy-chain receptor editing unbound.

Authors:  Garnett Kelsoe
Journal:  Proc Natl Acad Sci U S A       Date:  2015-02-17       Impact factor: 11.205

2.  VH replacement in primary immunoglobulin repertoire diversification.

Authors:  Amy Sun; Tatiana I Novobrantseva; Maryaline Coffre; Susannah L Hewitt; Kari Jensen; Jane A Skok; Klaus Rajewsky; Sergei B Koralov
Journal:  Proc Natl Acad Sci U S A       Date:  2015-01-21       Impact factor: 11.205

3.  Regulation of VH replacement by B cell receptor-mediated signaling in human immature B cells.

Authors:  Jing Liu; Miles D Lange; Sang Yong Hong; Wanqin Xie; Kerui Xu; Lin Huang; Yangsheng Yu; Götz R A Ehrhardt; Michael Zemlin; Peter D Burrows; Kaihong Su; Robert H Carter; Zhixin Zhang
Journal:  J Immunol       Date:  2013-04-29       Impact factor: 5.422

4.  Characterization of a new V gene replacement in the absence of activation-induced cytidine deaminase and its contribution to human B-cell receptor diversity.

Authors:  Hakim Ouled-Haddou; Hussein Ghamlouch; Aline Regnier; Stephanie Trudel; Didier Herent; Marie-Paule Lefranc; Jean Pierre Marolleau; Brigitte Gubler
Journal:  Immunology       Date:  2014-02       Impact factor: 7.397

5.  Circulating Plasmablasts from Chronically Human Immunodeficiency Virus-Infected Individuals Predominantly Produce Polyreactive/Autoreactive Antibodies.

Authors:  Hongyan Liao; Yangsheng Yu; Song Li; Yinshi Yue; Chuanmin Tao; Kaihong Su; Zhixin Zhang
Journal:  Front Immunol       Date:  2017-12-06       Impact factor: 7.561

6.  VH Replacement Footprint Analyzer-I, a Java-Based Computer Program for Analyses of Immunoglobulin Heavy Chain Genes and Potential VH Replacement Products in Human and Mouse.

Authors:  Lin Huang; Miles D Lange; Zhixin Zhang
Journal:  Front Immunol       Date:  2014-02-10       Impact factor: 7.561

7.  Accumulation of VH Replacement Products in IgH Genes Derived from Autoimmune Diseases and Anti-Viral Responses in Human.

Authors:  Miles D Lange; Lin Huang; Yangsheng Yu; Song Li; Hongyan Liao; Michael Zemlin; Kaihong Su; Zhixin Zhang
Journal:  Front Immunol       Date:  2014-07-22       Impact factor: 7.561

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.