Literature DB >> 23326234

Granzyme A produced by γ(9)δ(2) T cells induces human macrophages to inhibit growth of an intracellular pathogen.

Charles T Spencer1, Getahun Abate, Isaac G Sakala, Mei Xia, Steven M Truscott, Christopher S Eickhoff, Rebecca Linn, Azra Blazevic, Sunil S Metkar, Guangyong Peng, Christopher J Froelich, Daniel F Hoft.   

Abstract

Human γ(9)δ(2) T cells potently inhibit pathogenic microbes, including intracellular mycobacteria, but the key inhibitory mechanism(s) involved have not been identified. We report a novel mechanism involving the inhibition of intracellular mycobacteria by soluble granzyme A. γ(9)δ(2) T cells produced soluble factors that could pass through 0.45 µm membranes and inhibit intracellular mycobacteria in human monocytes cultured below transwell inserts. Neutralization of TNF-α in co-cultures of infected monocytes and γ(9)δ(2) T cells prevented inhibition, suggesting that TNF-α was the critical inhibitory factor produced by γ(9)δ(2) T cells. However, only siRNA- mediated knockdown of TNF-α in infected monocytes, but not in γ(9)δ(2) T cells, prevented mycobacterial growth inhibition. Investigations of other soluble factors produced by γ(9)δ(2) T cells identified a highly significant correlation between the levels of granzyme A produced and intracellular mycobacterial growth inhibition. Furthermore, purified granzyme A alone induced inhibition of intracellular mycobacteria, while knockdown of granzyme A in γ(9)δ(2) T cell clones blocked their inhibitory effects. The inhibitory mechanism was independent of autophagy, apoptosis, nitric oxide production, type I interferons, Fas/FasL and perforin. These results demonstrate a novel microbial defense mechanism involving granzyme A-mediated triggering of TNF-α production by monocytes leading to intracellular mycobacterial growth suppression. This pathway may provide a protective mechanism relevant for the development of new vaccines and/or immunotherapies for macrophage-resident chronic microbial infections.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23326234      PMCID: PMC3542113          DOI: 10.1371/journal.ppat.1003119

Source DB:  PubMed          Journal:  PLoS Pathog        ISSN: 1553-7366            Impact factor:   6.823


Introduction

While γ9δ2 T cells comprise only 3% to 5% of total human blood lymphocytes they can expand to high frequencies in vivo and develop effector functions protective against multiple major human pathogens [1], [2]. In addition, γ9δ2 T cells can be stimulated by non-peptidic phosphoantigens, potentially broadening the host capacity for immune recognition of invading pathogens [3]. Furthermore, γ9δ2 T cells can develop memory responses critical for long-term vaccine-induced protective immunity [4]–[6]. Although phosphoantigens (e.g.-isopentenyl pyrophosphate) can induce polyclonal γ9δ2 T cell activation and anti-tumor immunity, we have shown that these same activation conditions do not generate γ9δ2 T cells capable of inhibiting intracellular mycobacterial growth [7]. Thus, the relevant TB antigens inducing protective γ9δ2 T cells so far remain undefined. However, despite the failure of simple phosphoantigens to induce mycobacteria-inhibitory γ9δ2 T cells, effector memory γ9δ2 T cells expanded with live BCG or mycobacterial lysates can display potent effector functions relevant for protective TB immunity including production of Th1 cytokines and cytolytic activity after co-culture with mycobacteria-infected human monocytes [7]–[10]. The specific effector mechanisms most important for γ9δ2 T cell-mediated suppression of intracellular mycobacterial growth in vivo are not known. In the present work, we have identified a novel granzyme A-dependent, but perforin-independent mechanism utilized by mycobacteria-specific γ9δ2 T cells to inhibit the growth of intracellular mycobacteria. Co-culture of infected macrophages with either mycobacteria-specific γ9δ2 T cells or purified granzyme A resulted in the production of TNF-α by target macrophages and inhibition of intracellular mycobacterial growth without inducing apoptosis. These findings are consistent with recently published data demonstrating that soluble granzyme A can trigger the production of inflammatory cytokines, including TNF-α, by macrophages without inducing apoptosis [11]. However, our results are novel by showing for the first time that the inflammatory responses induced by granzyme A can lead to intracellular anti-microbial activity. Overall, these combined results indicate that granzyme A produced by γ9δ2 T cells can induce infected macrophages to produce TNF-α which by itself and/or in combination with other factors leads to intracellular control of mycobacterial replication. These results may provide an important new target for future vaccine development and/or lead to novel therapeutic strategies for combating chronic macrophage-resident microbial infections.

Materials and Methods

Human samples

PPD positive, HIV negative healthy volunteers were recruited following a Saint Louis University IRB approved protocol and consent process conducted according to the principles expressed in the Declaration of Helsinki. Written informed consent was provided by all study participants. Ficoll-Paque (GE Healthcare, Piscataway, NJ) was used to obtain PBMC from leukapheresed samples. Adherent monocytes were used for the generation of mature DC as previously described [12]. γ9δ2T cell lines were generated from primary BCG-expanded γ9δ2 T cells [7]. Antigen expanded γ9δ2 T cells were purified on day 7 with immunomagnetic beads and restimulated with BCG-infected macrophages (1∶1.2 ratio) then expanded by replenishing medium with 5 U/mL rhIL-2 every 3–4 days as needed. This stimulation/expansion protocol was repeated every 2 weeks for continued maintenance of the γ9δ2 T cell lines.

Reagents

IL-2 (Hoffmann-LaRoche Inc., Basel, Switzerland) was used to expand γ9δ2 T cell lines. Strontium chloride (Sigma Aldrich, St. Louis, MO) pre-treatment was used to induce degranulation [13]. Wortmannin and 3-Methyladenine (Sigma) were used to block autophagy [14], [15]. zVAD.fmk (BD Biosciences) was used to inhibit apoptosis [16]. The following neutralizing antibodies were used to block T cell effector functions: anti-FasL (clone NOK-1) and anti-TNF-α (clone MAb1) from BD Bioscience; anti-IFN-γ (clone 25718) from R&D Systems; and anti-Perforin (clone δG9) from Axxora, San Diego, CA. All antibodies used for flow cytometry were from BD Bioscience except anti-Granulysin from eBioscience (San Diego, CA). CFSE was from Molecular Probes (Eugene, OR). Phorbol myristate acetate (PMA, Sigma-Aldrich), ionomycin (Sigma-Aldrich) and Cytofix/Cytoperm kit (BD Biosciences) were used in the intracellular staining protocol. Soluble 4-hydroxy-but-2-enyl pyrophosphate (HMB-PP, Echelon Bioscience, Salt Lake City, UT) was used for stimulation of γ9δ2 T cells in some transwell conditions. Granzyme A was quantified with the Human Granzyme A CBA Flex Set (BD Biosciences), collected on a LSR II flow cytometer and analyzed with FCAP Array software (BD Biosciences). Native human granzyme A was isolated from NK92 cells, quantified by silver stain, shown not to be contaminated with granzyme B or M, and endotoxin depleted as previously described [17]. Briefly, the postnuclear fraction of centrifuged disrupted NK92 cells was spun at 14,500×g for 15 min to obtain the granule pellet. This was extracted 3 times by 0.5% Triton X-100 and each fraction subjected to cation-exchange chromatography. All gradient fractions were individually assayed for protein concentration and esterolytic activity. No contaminating proteins were observed by silver staining of the final native granzyme A preparation. In addition, the final native granzyme A preparation was shown to be free of granzyme B and M by Western blot. Any endotoxin contamination of purified granzyme A was removed using the EndoTrap-Blue kit (Cambrex Bioscience Walkersville Inc, Walkersville, MD). Protein concentration of the endotoxin free granzyme was determined by Coomassie stain. The efficiency of the EndoTrap-Blue kit was verified by applying LPS to the EndoTrap column examining the flow-through for residual endotoxin activity using the Kinetic QCL kit (Cambrex Bioscience Walkersville Inc,). Efficiency of endotoxin depletion was shown to be >98%.

Preparation of and monocyte infection by mycobacteria

BCG was grown in Middlebrook 7H9 media supplemented with 10% albumin, dextrose, catalase (ADC)+0.05% tween. Aliquoted stocks were frozen and the concentration determined after thawing. Thawed aliquots were sonicated to generate single-cell suspensions before dilution and infection of monocytes. Mycobacterium tuberculosis H37Rv (Mtb, from BEI Resources, Manassas, VA) was grown in Middlebrook 7H9 media containing ADC enrichment and 0.1% glycerol. Aliquoted stocks were frozen and the concentration determined after thawing. Thawed aliquots were vortexed for 5 minutes to disrupt clumps before dilution and infection of monocytes in the presence of 200 nM granzyme A. Plastic adherent PBMCs were either used fresh or differentiated for 6 days before infection with a mycobacterial multiplicity of infection (MOI) of 3 as previously described [18]. Following removal of extracellular mycobacteria, infected monocytes were either cultured in medium alone or with γ9δ2 T cells (E∶T 10∶1) or soluble granzyme A at the indicated concentrations.

Assay of γδ T cell-mediated inhibition of intracellular mycobacterial growth

Two densities of adherent monocyte targets (∼1.5×104 and ∼1.2×105/well) were used as previously described [18]. Briefly, BCG- or Mtb-infected (MOI = 3) monocytes were cultured for 3 days with γ9δ2 T cell lines at an effector to target ratio of 10∶1. In assays with lower density of monocytes, medium-rested PBMC (1.5×105/well) were added to support optimal intracellular mycobacterial growth as previously described [18]. Residual intracellular BCG were measured by incorporation of H3-uridine and colony forming unit (CFU) counting on 7H10 Middlebrook agar plates. Percentages of mycobacterial growth inhibition were determined as follows: % inhibition = 100 - [100×(CFU or DPM in the presence of γ9δ2 T cells/CFU or disintegrations per minute (DPM) in the absence of γ9δ2 T cells)]. In transwell experiments, additional BCG-infected macrophages (∼4×104) were seeded in the upper chambers of the transwell inserts (0.4 µm HTS-96 from Corning, Acton, MA or 8 well strips from Nunc, Rochester, NY). γ9δ2 T cells were added at a 10∶1 E∶T ratio either to the top or bottom layers of infected monocytes/macrophages and the bottom layers harvested 3 days later for viable BCG/Mtb quantification.

Construction and use of lentivirus expressing shRNA for knockdown experiments

siRNAs were purchased from Applied Biosystems (Foster City, CA) targeting TNF-α, IFN-γ, perforin, and GAPDH, and cloned into the pSilencer adeno 1.0 CMV shuttle plasmid (Applied Biosystems). To evaluate effectiveness of siRNA-induced knockdown, plasmid DNA was transfected into THP-1 monocytes (ATCC, Manassas, MO) using Nucleofection (Amaxxa, Walkersville, MD) (Fig. S1). Shuttle vectors and adenovirus backbone were co-transfected into 293T cells and viral particles purified using the Adeno-X purification system (Clontech, Mountain View, CA). Viral titers were determined in 293T cells. γ9δ2 T cells or macrophages were infected with siRNA-expressing adenovirus for 4 hours 1 day prior to co-culture. For silencing of Granzyme A, three siRNA sequences for human GzmA (NM_006144.3) were selected with use of computer-assisted programs. Oligonucleotides containing a siRNA sequence, 8 nucleotide spacers, and a polyT terminator sequence were annealed and then cloned into the HapI and XhoI sites of GFP-expressing pLentilox3.7 vector [19]. siRNA was under the control of a U6 promoter. After screening, only one siRNA generating construct (GzmA2-siRNA: GATTGGAATGAATATGGTTTG) effectively silenced GzmA expression in γ9δ2 T cells. 293T cells were transfected with 13 µg siRNA lentiviral DNA [19], 6 µg VSV-G plasmid DNA [19] and 9 µg packaging viral CMV delta 8.9 plasmid [19], for 8 hours using Lipofectamine 2000 (Invitrogen). Viral supernatants were harvested 2–3 days after transfection, filtered and centrifuged at 20,000 rpm for 2 h. Virus pellets were resuspended and viral titers were determined in 293T cells. For transduction of γ9δ2 T cells, T cells were pre-activated with OKT3 (2 µg/ml)-coated plates, mixed with lentiviral supernatant at an MOI of 20 in medium containing 8 µg/ml polybrene (Sigma), and centrifuged at 1100×g for 1 h at room temperature. Fresh medium was added to each well after 16 h and transduction was repeated two days later. Transduction efficiency was analyzed 3–4 days post-transduction (Fig. S5). Transduced cells and control T cells were then used in the mycobacterial growth inhibition assay.

Statistical analysis

Microsoft Excel, GraphPad Prism or StatSoft Statistica were used for analysis. Mann-Whitney U, ANOVA Friedman test with Dunn's multiple comparisons test or Wilcoxon matched-pairs tests were used as appropriate.

Results

Direct inhibition of intracellular mycobacterial growth by mycobacteria-specific γ9δ2 T cells is dependent on soluble factors including TNF-α

Addition of BCG-specific γ9δ2 T cell lines or clones (data not shown) to BCG-infected macrophages resulted in intracellular mycobacterial growth inhibition (Fig. 1; *p<0.05 by Wilcoxon matched pairs test, n = 5), as previously reported [7]. This inhibition did not require cell-to-cell contact as activated BCG-specific γ9δ2 T cells in the upper transwell chambers could suppress intracellular mycobacterial growth in monocytes plated in the lower chambers. However, stimulation with both BCG-infected macrophages and soluble 4-hydroxy-but-2-enyl pyrophosphate (HMB-PP) in the upper transwell chambers resulted in maximal inhibition of mycobacterial growth in the lower chambers (Fig. 1), probably due to optimal production of soluble inhibitory factors mediating inhibitory effects. These combined results show that the effector mechanism that inhibits intracellular mycobacteria does not require contact between the γ9δ2 T cells producing the soluble effector molecules and the target infected macrophages, although the triggering of the protective response is contact dependent. Effector molecules produced by γ9δ2 T cells placed above the transwell inserts can pass through the membrane and induce macrophages placed below the membrane to better control intracellular mycobacterial growth. However, the γ9δ2 T cells above the membrane must be stimulated by cell contact with APCs presenting BCG antigens or HMBPP to produce the soluble effector molecules that can pass through the membrane and induce the enhanced control of intracellular mycobacteria in macrophages below the membrane. In any case, it is clear that soluble molecules secreted by activated γ9δ2 T cells can inhibit the survival of intracellular mycobacteria.
Figure 1

TNF-α is critical for γ9δ2 T cell-mediated inhibition of intracellular mycobacterial growth.

A, γ9δ2 T cell lines significantly suppressed intracellular growth of mycobacteria (n = 5; *p<0.05 by Wilcoxon matched-pairs test). γ9δ2 T cells were co-cultured with BCG-infected macrophages for 3 d. Surviving bacteria were quantified by H3-uridine incorporation and compared with cultures absent of γ9δ2 T cells. B, The effector mechanism responsible for γ9δ2 T cell-mediated mycobacterial growth inhibition involves soluble factors. γ9δ2 T cells were stimulated in the top chambers of semi-permeable transwell membrane (0.4 µm pores) systems with BCG-infected macrophages and/or soluble HMB-PP. The levels of intracellular growth inhibition were assayed in the bottom chambers and compared to the levels of inhibition achieved by direct co-culture of γ9δ2 T cells with the bottom layer of BCG-infected macrophages (*p<0.05, n = 5 by Wilcoxon matched pairs tests compared with unstimulated γ9δ2 T cells separated by transwells; **p<0.02, n = 7 by Wilcoxon matched pairs tests compared with HMB-PP stimulated γδ T cells separated by transwells; ***p<0.003, n = 15 by Wilcoxon matched pairs tests compared with HMB-PP stimulated γδ T cells separated by transwells). C, Neutralization of TNF-α alone prevents γ9δ2 T cell-mediated inhibition while neutralization of IFN-γ alone did not (*p<0.02, n = 7 by Wilcoxon matched pairs tests compared with no antibody control; **p<0.02, n = 6 by Wilcoxon matched pairs tests compared with no antibody control; n.s. – not significantly different). γ9δ2 T cells were co-cultured with BCG-infected macrophages in the presence or absence of the indicated neutralizing antibody and the surviving bacteria quantified by H3-uridine incorporation. D, shRNA-mediated knockdown of TNF-α in macrophages, but not γ9δ2 T cells, eliminates γ9δ2 T cell-mediated mycobacterial growth inhibition. (*p<0.02, n = 7 by Wilcoxon matched pairs tests compared with adenovirus expressing the empty vector). γ9δ2 T cells were co-cultured with BCG-infected macrophages. Prior to co-culture, either the T cells or uninfected macrophages were infected with shRNA expressing Adenovirus. Surviving bacteria were quantified by H3-uridine incorporation.

TNF-α is critical for γ9δ2 T cell-mediated inhibition of intracellular mycobacterial growth.

A, γ9δ2 T cell lines significantly suppressed intracellular growth of mycobacteria (n = 5; *p<0.05 by Wilcoxon matched-pairs test). γ9δ2 T cells were co-cultured with BCG-infected macrophages for 3 d. Surviving bacteria were quantified by H3-uridine incorporation and compared with cultures absent of γ9δ2 T cells. B, The effector mechanism responsible for γ9δ2 T cell-mediated mycobacterial growth inhibition involves soluble factors. γ9δ2 T cells were stimulated in the top chambers of semi-permeable transwell membrane (0.4 µm pores) systems with BCG-infected macrophages and/or soluble HMB-PP. The levels of intracellular growth inhibition were assayed in the bottom chambers and compared to the levels of inhibition achieved by direct co-culture of γ9δ2 T cells with the bottom layer of BCG-infected macrophages (*p<0.05, n = 5 by Wilcoxon matched pairs tests compared with unstimulated γ9δ2 T cells separated by transwells; **p<0.02, n = 7 by Wilcoxon matched pairs tests compared with HMB-PP stimulated γδ T cells separated by transwells; ***p<0.003, n = 15 by Wilcoxon matched pairs tests compared with HMB-PP stimulated γδ T cells separated by transwells). C, Neutralization of TNF-α alone prevents γ9δ2 T cell-mediated inhibition while neutralization of IFN-γ alone did not (*p<0.02, n = 7 by Wilcoxon matched pairs tests compared with no antibody control; **p<0.02, n = 6 by Wilcoxon matched pairs tests compared with no antibody control; n.s. – not significantly different). γ9δ2 T cells were co-cultured with BCG-infected macrophages in the presence or absence of the indicated neutralizing antibody and the surviving bacteria quantified by H3-uridine incorporation. D, shRNA-mediated knockdown of TNF-α in macrophages, but not γ9δ2 T cells, eliminates γ9δ2 T cell-mediated mycobacterial growth inhibition. (*p<0.02, n = 7 by Wilcoxon matched pairs tests compared with adenovirus expressing the empty vector). γ9δ2 T cells were co-cultured with BCG-infected macrophages. Prior to co-culture, either the T cells or uninfected macrophages were infected with shRNA expressing Adenovirus. Surviving bacteria were quantified by H3-uridine incorporation. IFN-γ and TNF-α have previously been implicated in the control of mycobacterial infections. Therefore, we next studied the effects of neutralization of these cytokines on γ9δ2 T cell-mediated inhibition of intracellular mycobacteria. Neutralization of IFN-γ alone did not affect mycobacterial growth inhibition. In contrast, neutralization of TNF-α significantly reduced γ9δ2 T cell-mediated inhibitory effects (Fig. 1, S2; *p<0.03 by Wilcoxon matched pairs test, n = 7). These results demonstrate that TNF-α is critical for suppression of mycobacterial growth, consistent with the observed clinical effects of TNF-α blockade increasing the risks of TB disease reactivation. However, we were surprised to find in siRNA knockdown experiments that only the production of TNF-α by BCG-infected macrophages and not by γ9δ2 T cells was required for inhibition of intracellular mycobacterial growth (Fig. 1; *p = 0.018 by Wilcoxon matched pairs test for both siRNA sequences, n = 7). Further studies indicated that autophagy, apoptosis, cytolysis, IFN-β and nitric oxide production were not involved in γ9δ2 T cell-mediated inhibition of intracellular mycobacteria (Fig. S3, S4). Our combined results indicate that inhibitory γ9δ2 T cells produce soluble factors that by some novel pathway activate BCG-infected macrophages to produce TNF-α and inhibit intracellular mycobacterial growth.

Classical cell-to-cell contact mechanisms are not involved in γδ T cell inhibitory activity

We considered the possibility that cell-to-cell contact mechanisms may also be involved in mycobacterial suppression. Antibody blockade of the Fas/FasL interaction did not interfere with the ability of γ9δ2 T cells to inhibit intracellular mycobacterial growth (Fig. 2; *p = 0.23 by Wilcoxon matched pairs test, n = 7). Inactivation of the cytolytic granule pathway (known to destroy target cells engaged via the immunological synapse) in γ9δ2 T cells by strontium pre-treatment, completely eliminated the capacity of these cells to suppress intracellular mycobacterial growth (*p<0.05 by Wilcoxon matched pairs test, n = 5). However, a perforin-specific neutralizing antibody previously shown to inhibit cytolysis [9] did not reverse γ9δ2 T cell-mediated mycobacterial growth suppression (p = 0.28 by Wilcoxon matched pairs test, n = 3). Overall, these results suggest that the cytolytic granule cargo secreted by activated γ9δ2 T cells contain soluble factors which stimulate infected macrophages to inhibit intracellular mycobacterial growth even in the absence of perforin.
Figure 2

Classical effector mechanisms involving direct contact of γ9δ2 T cells with BCG-infected macrophages are not required for mycobacterial suppression.

γ9δ2 T cells were co-cultured with BCG-infected macrophages in the presence or absence of the indicated treatment and surviving bacteria quantified by H3-uridine incorporation. Blocking of Fas/FasL interactions did not prevent γ9δ2 T cell-mediated inhibition (p = 0.23, n = 7). In contrast, γ9δ2 T cells pre-treated for 16 hours with 25 mM strontium chloride were unable to mediate mycobacterial inhibition (*p<0.05, n = 5 by Wilcoxon matched pairs test compared with untreated γ9δ2 T cells). Despite strontium depletion indicating the importance of γ9δ2 T cell cytolytic granules for mycobacterial inhibitory effects, antibody neutralization of perforin had no effect (p = 0.28, n = 3).

Classical effector mechanisms involving direct contact of γ9δ2 T cells with BCG-infected macrophages are not required for mycobacterial suppression.

γ9δ2 T cells were co-cultured with BCG-infected macrophages in the presence or absence of the indicated treatment and surviving bacteria quantified by H3-uridine incorporation. Blocking of Fas/FasL interactions did not prevent γ9δ2 T cell-mediated inhibition (p = 0.23, n = 7). In contrast, γ9δ2 T cells pre-treated for 16 hours with 25 mM strontium chloride were unable to mediate mycobacterial inhibition (*p<0.05, n = 5 by Wilcoxon matched pairs test compared with untreated γ9δ2 T cells). Despite strontium depletion indicating the importance of γ9δ2 T cell cytolytic granules for mycobacterial inhibitory effects, antibody neutralization of perforin had no effect (p = 0.28, n = 3).

Mycobacteria-specific γ9δ2 T cells utilize granzyme A to trigger pro-inflammatory TNF-α

Granzyme A, a component of cytolytic granules, recently has been shown to induce numerous pro-inflammatory cytokines including TNF-α [11]. We hypothesized that granzyme A produced by γ9δ2 T cells (Fig. S5 A) may trigger macrophage TNF-α production and subsequent mycobacterial inhibition. Indeed, the levels of granzyme A in γ9δ2 T cell culture supernatants were found to be highly correlated with inhibition of intracellular mycobacteria (Fig. 3; r = 0.7564, p<0.0001). In contrast, the supernatant levels of granzyme B, another component of cytolytic granules, weakly correlated with levels of inhibition (data not shown, r = 0.2298). Furthermore, purified human granzyme A induced dose-dependent increases in TNF-α and IL-1β by BCG-infected macrophages (Fig. 3; p<0.05). More importantly, addition of highly purified, endotoxin-free granzyme A preparation alone to BCG-infected (Fig. 3) or M. tuberculosis H37Rv-infected (Fig. 3) macrophages resulted in highly significant inhibition of intracellular mycobacterial growth (p<0.03 by Wilcoxon matched pairs test, n = 6–12). Conversely, purified granzyme A had no direct effects on extracellular mycobacterial growth (data not shown). These data demonstrate for the first time that granzyme A alone can induce immunity protective against an intracellular pathogen.
Figure 3

Granzyme A secretion by γ9δ2 T cells mediates inhibition of intracellular mycobacteria by induction of inflammatory responses in mycobacteria-infected macrophages.

A, The levels of granzyme A produced by γ9δ2 T cells are directly and highly correlated with inhibition of intracellular mycobacterial growth (r = 0.7564; p<0.0001). Supernatant levels of granzyme A, measured by CBA, were correlated with the level of mycobacterial growth inhibition observed in γ9δ2 T cell co-cultures with BCG-infected macrophages. B, Purified granzyme A induces the production of pro-inflammatory cytokines TNF-α and IL-1β by BCG-infected macrophages (*p<0.05, n = 4; statistical comparisons performed using Friedman's test). The indicated concentrations of purified granzyme A were added to BCG-infected monocytes for 3 days and the levels of TNF-α and IL-1β in the culture supernatants determined by CBA. C-D, Purified granzyme A alone can induce inhibition of intracellular mycobacterial growth in the absence of perforin. The indicated concentrations of granzyme A were added to BCG-infected (C) or M. tuberculosis H37Rv-infected (D) co-cultures for 3 days and the surviving bacteria quantified by H3-uridine incorporation and CFU counting. (*p<0.03; n = 6–12 by Wilcoxon matched pairs test comparing levels of mycobacterial intracellular growth in cultures with and without added purified granzyme A). Purified granzyme A had no direct effects on extracellular mycobacterial growth (data not shown). E, siRNA knockdown of granzyme A in γ9δ2 T cells reduces the inhibitory activity of γ9δ2 T cells for mycobacterial growth (*p<0.05; n = 3 by one-way ANOVA comparing levels of intracellular mycobacterial growth inhibition in cultures with or without γ9δ2 T cells producing granzyme A). γ9δ2 T cells transduced with the indicated siRNA-lentivirus targeting GzmA or a negative control (NC) were co-cultured with BCG-infected macrophages for 3 days and surviving bacteria quantified by H3-uridine incorporation.

Granzyme A secretion by γ9δ2 T cells mediates inhibition of intracellular mycobacteria by induction of inflammatory responses in mycobacteria-infected macrophages.

A, The levels of granzyme A produced by γ9δ2 T cells are directly and highly correlated with inhibition of intracellular mycobacterial growth (r = 0.7564; p<0.0001). Supernatant levels of granzyme A, measured by CBA, were correlated with the level of mycobacterial growth inhibition observed in γ9δ2 T cell co-cultures with BCG-infected macrophages. B, Purified granzyme A induces the production of pro-inflammatory cytokines TNF-α and IL-1β by BCG-infected macrophages (*p<0.05, n = 4; statistical comparisons performed using Friedman's test). The indicated concentrations of purified granzyme A were added to BCG-infected monocytes for 3 days and the levels of TNF-α and IL-1β in the culture supernatants determined by CBA. C-D, Purified granzyme A alone can induce inhibition of intracellular mycobacterial growth in the absence of perforin. The indicated concentrations of granzyme A were added to BCG-infected (C) or M. tuberculosis H37Rv-infected (D) co-cultures for 3 days and the surviving bacteria quantified by H3-uridine incorporation and CFU counting. (*p<0.03; n = 6–12 by Wilcoxon matched pairs test comparing levels of mycobacterial intracellular growth in cultures with and without added purified granzyme A). Purified granzyme A had no direct effects on extracellular mycobacterial growth (data not shown). E, siRNA knockdown of granzyme A in γ9δ2 T cells reduces the inhibitory activity of γ9δ2 T cells for mycobacterial growth (*p<0.05; n = 3 by one-way ANOVA comparing levels of intracellular mycobacterial growth inhibition in cultures with or without γ9δ2 T cells producing granzyme A). γ9δ2 T cells transduced with the indicated siRNA-lentivirus targeting GzmA or a negative control (NC) were co-cultured with BCG-infected macrophages for 3 days and surviving bacteria quantified by H3-uridine incorporation. In order to demonstrate that γ9δ2 T cells utilize this mechanism to suppress intracellular mycobacterial growth, lentiviral vectors containing shRNA constructs were generated to express siRNAs targeting granzyme A. γ9δ2 T cell lines were transduced with GzmA targeting or negative control (NC) siRNA lentivirus prior to co-culture with BCG-infected macrophages. Transduction of γ9δ2 T cells with the siRNA targeting granzyme A resulted in 50% decreases in the intracellular levels of granzyme A (Fig. S5). Associated with the GzmA knockdown was a significant reversal of the inhibitory effects of γ9δ2 for mycobacterial intracellular growth (Fig. 3; p<0.05). These latter data confirm that granzyme A production represents a critical mechanism responsible for the ability of γ9δ2 T cells to inhibit intracellular mycobacterial growth. These data lead us to propose the following model for γ9δ2 T cell-mediated control of mycobacterial replication (Fig. 4). Mycobacteria-infected macrophages present pathogen-specific or induced self antigens to γ9δ2 T cells. Activated γ9δ2 T cells then secrete granzyme A which acts upon the macrophages to produce TNF-α. It is unclear as yet whether bystander uninfected macrophages are similarly triggered to produce TNF-α or whether TNF-α is soluble vs membrane bound. TNF-α then acts in an autocrine and/or paracrine mechanism to induce infected macrophages to control mycobacterial replication. The intracellular details by which TNF-α causes this repression require further investigation. It is also likely that intracellular molecular events in addition to TNF-α production are activated by granzyme A and contribute to the mycobacterial inhibitory effects.
Figure 4

Proposed model of granzyme A-mediated suppression of intracellular mycobacterial growth by γ9δ2 T cells.

Mycobacteria-infected macrophages present antigens to γ9δ2 T cells (1) which secrete granzyme A upon activation (2). Granzyme A in turn induces TNF-α production by infected and/or bystander macrophages (3) apparently independent of perforin. TNF-α activates intracellular mechanisms which alone or in concert with other unknown granzyme A-induced intracellular mechanisms suppress mycobacterial growth (4).

Proposed model of granzyme A-mediated suppression of intracellular mycobacterial growth by γ9δ2 T cells.

Mycobacteria-infected macrophages present antigens to γ9δ2 T cells (1) which secrete granzyme A upon activation (2). Granzyme A in turn induces TNF-α production by infected and/or bystander macrophages (3) apparently independent of perforin. TNF-α activates intracellular mechanisms which alone or in concert with other unknown granzyme A-induced intracellular mechanisms suppress mycobacterial growth (4).

Discussion

γ9δ2 T cells have certain unique characteristics potentially important for the development of new vaccines capable of inducing protective immunity against several important human pathogens. Antigen recognition by these cells is not MHC restricted [20]. Therefore, the same antigens could induce protective γ9δ2 T cell responses in individuals from diverse genetic backgrounds. In addition, γ9δ2 T cells tend to accumulate in mucosal epithelial tissues, including the lung, where they can serve as a potent first line of defense against pathogenic microbes – e.g. mycobacteria [21], [22]. These properties make γ9δ2 T cells well-suited as early responders to infection. Furthermore, unlike conventional αβ T cells, which respond to peptide antigens, γ9δ2 T cells are activated by naturally occurring prenyl pyrophosphate metabolites (e.g.- isopentenyl pyrophosphate, IPP, and HMB-PP) [23], [24] expressed by actively replicating mycobacteria and other pathogens [3]. Thus, the stimulation of γ9δ2 T cells with prenyl pyrophosphates could represent a novel vaccine strategy. However, the effector mechanisms utilized by γ9δ2 T cells to inhibit intracellular mycobacterial replication have been unclear. Therefore, we sought to identify the key effector pathways of mycobacteria-stimulated γ9δ2 T cells that specifically act to inhibit the intracellular growth of mycobacteria. Activated γ9δ2 T cells express numerous effector molecules including IFN-γ, TNF-α, perforin, granzyme and granulysin, all implicated in control of infectious microbes [8]–[10], [25]–[27]. Indeed, γ9δ2 T cells have been shown to be more potent producers of IFN-γ than CD4+ and CD8+ αβ T cells after re-stimulation in vitro with M. tuberculosis-infected APC [28], [29]. However, in addition to displaying cytotoxic activity, γ9δ2 T cells also stimulate other cell types to produce pro-inflammatory cytokines such as IFN-γ and TNF-α [30]–[33]. Our results provide further evidence indicating that γ9δ2 T cells both stimulate as well as express protective pro-inflammatory responses. To explore the importance of soluble effector molecules in γ9δ2 T cell-mediated mycobacterial control, we neutralized the biological activity of IFN-γ, TNF-α and perforin in co-cultures of mycobacteria-protective γ9δ2 T cells and infected macrophages. Only the neutralization of TNF-α blocked the ability of mycobacteria-protective γ9δ2 T cells to control mycobacterial growth. These results indicate that TNF-α is critical for the suppression of mycobacterial growth, an observation confirmed by the clinical effects of TNF-α blockade leading to reactivation of latent TB infection. However, as demonstrated by siRNA knockdown experiments, macrophages and not γ9δ2 T cells were found to be the critical source of TNF-α for inhibition of intracellular mycobacterial growth in BCG-infected co-cultures. The delivery of granzyme A to monocyte/macrophage cells, either as the isolated protein or by cytotoxic cells, has been shown to induce numerous pro-inflammatory cytokines including TNF-α [34]. Mycobacterial growth inhibition in our experiments strongly correlated with the levels of granzyme A in γ9δ2 T cell culture supernatants, while neutralization of perforin had no effect on mycobacterial growth inhibition. Our data support the hypothesis that granzyme A secreted by BCG-specific γ9δ2 T cells induces target macrophages to produce TNF-α which alone or in combination with unidentified factors inhibits intracellular mycobacterial growth. To our knowledge this is the first demonstration that the pro-inflammatory response elicited by granzyme A contributes to anti-pathogen host defense through microbial elimination. Furthermore, we present evidence that granzyme A triggers this protective response through a pathway that does not involve nitric oxide, type I interferons, autophagy and/or apoptosis (supplementary data). We believe that the mechanism responsible for how granzyme A induces inhibition of intracellular mycobacteria is complex. TNF-α production by the macrophage is clearly necessary; anti-TNF neutralizing antibody prevents γ9δ2 T cell inhibitory activity and macrophage TNF knockdown prevents inhibition of intracellular mycobacterial growth. However, TNF-α is a pleiotropic cytokine contributing to both protective immunity and pathologic responses depending upon concentration and duration of production (e.g. TB reactivation occurs after TNF-α blockade, while cachexia or extreme wasting is caused by chronic excessive TNF-α production). In addition, we have shown previously [18] that high levels of TNF production by macrophages can be a marker of uncontrolled intracellular mycobacterial growth, and others have reported similar phenomena. Therefore, we believe that granzyme A-mediated induction of intracellular mycobacteria involves more than TNF-α production. TNF is required for the protective response, but there is not a simple quantitative relationship between the levels of TNF induced and the magnitude of inhibition of intracellular mycobacterial growth. We are currently trying to identify the more complete molecular signature responsible for granzyme A-mediated protective responses active against intracellular mycobacteria using a microarray approach. Nevertheless, TNF-α production by infected or bystander macrophages may be necessary for the complete induction of γ9δ2 T cell effector functions mediating mycobacterial suppression [34]. Thus, future TB vaccine or therapeutic strategies should maximize the induction of mycobacteria-specific, granzyme A-producing γ9δ2 T cells and thereby favor the early and enhanced production of TNF-α in mycobacteria-infected and bystander macrophages in response to TB challenge. Efficacy of TNF-α knockdown by 2 small-hairpin RNA (shRNA) constructs. THP-1 cells were transformed with plasmids encoding shRNA constructs specific for mouse TNF-α (Ambion; clone 1 and 4) by electroporation. Following overnight culture to allow degradation of TNF-α mRNA, 1 µg/mL LPS was added to the cultures in order to stimulate the secretion of TNF-α. Cytokine concentration in the supernatant was determined by ELISA 48 hours later. (TIF) Click here for additional data file. αIFN-γ (MAB285) and αTNF-α (Mab1) are able to neutralize the biological activity of purified IFN-γ and TNF-α, respectively. The indicated cell lines were plated in 96 well plates and 10 µg/mL αTNF-α or αIFN-γ antibody added to the appropriate samples. A titration of recombinant human IFN-γ (A & B) or TNF-α (C & D) was added to stimulate the cells. The assays were cultured for 3–4 days and then pulsed with 0.5 µCi H3-thymidine overnight to measure the viability of the cell populations. (TIF) Click here for additional data file. TNF-α triggered by protective γ The cell-permeable general caspase inhibitor, zVAD.fmk, or autophagy inhibitors, 3-methyadenine and Wortmannin, were added to co-cultures of protective γ9δ2 T cells and infected macrophages. After 3 days of culture, the viability of intracellular mycobacteria was quantitated by H3-uridine incorporation. (TIF) Click here for additional data file. Protective γ 3 days after co-culture of BCG-infected macrophages alone or co-cultured with protective γ9δ2 T cells (left panel), soluble IFN-β was measured in culture supernatants by ELISA (middle panel) and soluble nitric oxide was measured in culture supernatants by Griess reaction (right panel). (TIF) Click here for additional data file. γ A) Intracellular levels of granzyme A in γ9δ2 T cells was determined by intracellular cytokine staining. B) The intracellular levels of granzyme A in γ9δ2 T cells transduced with lentivirus vectors containing shRNA constructs generating granzyme A targeting or negative control (NC) siRNA was determined as in A. Transduced γ9δ2 T cells expressed ∼50% less granzyme A protein than did untreated γ9δ2 T cells or γ9δ2 T cells transduced with a noncoding siRNA. (TIF) Click here for additional data file. for supplemental data. The experimental protocols used to generate data presented in the supplemental figures are reported herein. (DOCX) Click here for additional data file.
  34 in total

1.  Vgamma9/Vdelta2 T lymphocytes reduce the viability of intracellular Mycobacterium tuberculosis.

Authors:  F Dieli; M Troye-Blomberg; J Ivanyi; J J Fournié; M Bonneville; M A Peyrat; G Sireci; A Salerno
Journal:  Eur J Immunol       Date:  2000-05       Impact factor: 5.532

2.  Only a subset of phosphoantigen-responsive gamma9delta2 T cells mediate protective tuberculosis immunity.

Authors:  Charles T Spencer; Getahun Abate; Azra Blazevic; Daniel F Hoft
Journal:  J Immunol       Date:  2008-10-01       Impact factor: 5.422

3.  Fate of Mycobacterium tuberculosis within murine dendritic cells.

Authors:  K A Bodnar; N V Serbina; J L Flynn
Journal:  Infect Immun       Date:  2001-02       Impact factor: 3.441

4.  Structure of a human gammadelta T-cell antigen receptor.

Authors:  T J Allison; C C Winter; J J Fournié; M Bonneville; D N Garboczi
Journal:  Nature       Date:  2001-06-14       Impact factor: 49.962

5.  Granulysin-dependent killing of intracellular and extracellular Mycobacterium tuberculosis by Vgamma9/Vdelta2 T lymphocytes.

Authors:  F Dieli; M Troye-Blomberg; J Ivanyi; J J Fournié; A M Krensky; M Bonneville; M A Peyrat; N Caccamo; G Sireci; A Salerno
Journal:  J Infect Dis       Date:  2001-09-28       Impact factor: 5.226

6.  Live and inactivated influenza vaccines induce similar humoral responses, but only live vaccines induce diverse T-cell responses in young children.

Authors:  Daniel F Hoft; Elizabeth Babusis; Shewangizaw Worku; Charles T Spencer; Kathleen Lottenbach; Steven M Truscott; Getahun Abate; Isaac G Sakala; Kathryn M Edwards; C Buddy Creech; Michael A Gerber; David I Bernstein; Frances Newman; Irene Graham; Edwin L Anderson; Robert B Belshe
Journal:  J Infect Dis       Date:  2011-08-15       Impact factor: 5.226

7.  V gamma 9V delta 2 T cells impair intracellular multiplication of Brucella suis in autologous monocytes through soluble factor release and contact-dependent cytotoxic effect.

Authors:  F Ottones; J Dornand; A Naroeni; J P Liautard; J Favero
Journal:  J Immunol       Date:  2000-12-15       Impact factor: 5.422

8.  Human and mouse granzyme A induce a proinflammatory cytokine response.

Authors:  Sunil S Metkar; Cheikh Menaa; Julian Pardo; Baikun Wang; Reinhard Wallich; Marina Freudenberg; Stephen Kim; Srikumar M Raja; Lianfa Shi; Markus M Simon; Christopher J Froelich
Journal:  Immunity       Date:  2008-10-23       Impact factor: 31.745

9.  Central memory Vgamma9Vdelta2 T lymphocytes primed and expanded by bacillus Calmette-Guérin-infected dendritic cells kill mycobacterial-infected monocytes.

Authors:  Angelo Martino; Rita Casetti; Alessandra Sacchi; Fabrizio Poccia
Journal:  J Immunol       Date:  2007-09-01       Impact factor: 5.422

Review 10.  Human gamma delta T cells: candidates for the development of immunotherapeutic strategies.

Authors:  Susann Beetz; Lothar Marischen; Dieter Kabelitz; Daniela Wesch
Journal:  Immunol Res       Date:  2007       Impact factor: 4.505

View more
  50 in total

1.  Fetal public Vγ9Vδ2 T cells expand and gain potent cytotoxic functions early after birth.

Authors:  Maria Papadopoulou; Tanya Dimova; Muki Shey; Libby Briel; Helen Veldtsman; Nondumiso Khomba; Hadn Africa; Marcia Steyn; Willem A Hanekom; Thomas J Scriba; Elisa Nemes; David Vermijlen
Journal:  Proc Natl Acad Sci U S A       Date:  2020-07-14       Impact factor: 11.205

2.  Serine protease inhibition attenuates rIL-12-induced GZMA activity and proinflammatory events by modulating the Th2 profile from estrogen-treated mice.

Authors:  Ebru Karpuzoglu; Chad W Schmiedt; Julian Pardo; Megan Hansen; Tai L Guo; Steven D Holladay; Robert M Gogal
Journal:  Endocrinology       Date:  2014-05-19       Impact factor: 4.736

Review 3.  Quest for correlates of protection against tuberculosis.

Authors:  Kamlesh Bhatt; Sheetal Verma; Jerrold J Ellner; Padmini Salgame
Journal:  Clin Vaccine Immunol       Date:  2015-01-14

Review 4.  Immunology of Mycobacterium tuberculosis Infections.

Authors:  Jonathan Kevin Sia; Jyothi Rengarajan
Journal:  Microbiol Spectr       Date:  2019-07

5.  [Peripheral blood T cell TNF-α and IFN-γ production stimulated by low molecular peptide of Mycobacterium tuberculosis heat-resistant antigen for differential diagnosis between pulmonary tuberculosis and latent tuberculosis infection].

Authors:  Jie Tang; Ce Chen; Cheng Zha; Jian-Rong Chang; Qiang Fang; Zhao-Hua Wang; Bai-Qing Li
Journal:  Nan Fang Yi Ke Da Xue Xue Bao       Date:  2017-11-20

6.  Depletion of NK Cells Improves Cognitive Function in the Alzheimer Disease Mouse Model.

Authors:  Yuanyue Zhang; Ivan Ting Hin Fung; Poornima Sankar; Xiangyu Chen; Lisa S Robison; Longyun Ye; Shanti S D'Souza; Abigail E Salinero; Marcy L Kuentzel; Sridar V Chittur; Wenzheng Zhang; Kristen L Zuloaga; Qi Yang
Journal:  J Immunol       Date:  2020-06-05       Impact factor: 5.422

7.  Adoptive Transfer of Phosphoantigen-Specific γδ T Cell Subset Attenuates Mycobacterium tuberculosis Infection in Nonhuman Primates.

Authors:  Arwa Qaqish; Dan Huang; Crystal Y Chen; Zhuoran Zhang; Richard Wang; Shengpu Li; Enzhuoa Yang; Yang Lu; Michelle H Larsen; William R Jacobs; Lixia Qian; James Frencher; Ling Shen; Zheng W Chen
Journal:  J Immunol       Date:  2017-05-19       Impact factor: 5.422

8.  Granzyme K synergistically potentiates LPS-induced cytokine responses in human monocytes.

Authors:  Annette C Wensink; Vera Kemp; Job Fermie; M Isabel García Laorden; Tom van der Poll; C Erik Hack; Niels Bovenschen
Journal:  Proc Natl Acad Sci U S A       Date:  2014-04-07       Impact factor: 11.205

Review 9.  Protective immune responses of major Vγ2Vδ2 T-cell subset in M. tuberculosis infection.

Authors:  Zheng W Chen
Journal:  Curr Opin Immunol       Date:  2016-08-01       Impact factor: 7.486

10.  Development of vaccines to control the worldwide tuberculosis pandemic.

Authors:  Daniel F Hoft
Journal:  Mo Med       Date:  2014 Jul-Aug
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.