| Literature DB >> 23289855 |
Kang-Hoon Lee1, Debora Lim, Tajia Green, David Greenhalgh, Kiho Cho.
Abstract
BACKGROUND: Murine leukemia virus-type endogenous retroviruses (MuLV-ERVs) constitute ~10% of the mouse genome and are associated with various pathophysiologic processes. In this study, we examined whether MuLV-ERVs' response to burn-elicited stressors is specific for certain lymphocyte populations and/or locations of lymphoid organ.Entities:
Mesh:
Year: 2013 PMID: 23289855 PMCID: PMC3562510 DOI: 10.1186/1471-2172-14-2
Source DB: PubMed Journal: BMC Immunol ISSN: 1471-2172 Impact factor: 3.615
Figure 1MuLV-ERV expression in B- and T-cells derived from lymphoid organs of C57BL/6J mice. MuLV-ERV expression was examined in B- and T-cells isolated from the spleen, thymus, and seven different lymph nodes of female C57BL/6J mice without any treatment. A schematic drawing of a typical MuLV-ERV proviral structure indicates the relative locations of a set of primers used for amplification of the U3 regions. Differential MuLV-ERV expression patterns were observed in B- and T-cells derived from various lymphoid organs. LN (lymph node), SM (size marker).
Figure 2Post-burn alterations in the expression of MuLV-ERVs in B- and T-cells isolated from lymphoid organs of C57BL/6J mice. Post-burn (3 hours and 24 hours) changes in the expression of MuLV-ERVs were measured in the B- and T-cells isolated from nine different lymphoid organs. The results, which were presented as a fold change (burn/no burn) for the individual MuLV-ERV U3 bands (a, b, and c for B-cells; d, e, f, and g for T-cells), revealed a unique pattern for each experimental group (cell/organ/time). SPL (spleen), THY (thymus), LN (lymph node), AXI (axillary LN), ING (inguinal LN), MES (mesenteric LN), MAN (mandibular cervical LN), ACC (accessory mandibular cervical LN), SUP (superficial parotid cervical LN), DEE (deep cervical LN). A black arrow indicates unmeasured samples due to the low expression level. Error bars indicate standard error of the mean. * P < 0.05.
Figure 3Phylogenetic relatedness of 100 unique MuLV-ERV U3 sequences. Phylogenetic relatedness of the 100 unique MuLV-ERV U3 sequences was determined by a multiple alignment analysis. The MuLV-ERV U3 sequences in each branch were analyzed for their presence in a specific lymphocyte type (B- or T-cell) and/or stress condition (no burn or burn). Seven branches were formed, primarily based on the size of the U3 sequences. Number of sequences is in parentheses.
Sequence characteristics and putative tropism traits of seven MuLV-ERV U3 sequences representing the seven main phylogenetic branches
| I | B3H-TTH-1 | 603 | +/+ | + | + | + | +/+ | + | + | P-II |
| III | B3H-TIN-3 | 556 | +/+ | · | + | + | +/+ | + | + | P-I |
| III | B3H-TTH-7 | 440 | +/+ | + | + | +/+ | +/+ | + | · | X-II |
| IV | NB24H-TSC-3 | 433 | +/+ | · | +/+ | +/+ | + | + | · | X-II |
| V | B3H-TTH-6 | 392 | +/+ | + | + | +/+ | +/+ | + | · | X-I |
| VI | B3H-BME-9 | 361 | +/+ | · | · | +/+ | +/+ | + | · | · |
| VII | B3H-TTH-11 | 346 | +/+ | + | +/+ | · | +/+ | + | · | X-II |
Sequence characteristics: direct repeats (1/1*, 4/4*, 5/5*, and 6/6*), unique region (2), insertion of 190 nucleotides, and TATA box; +/+ (direct repeat), + (single copy), · (absence).
Figure 4Decreased population diversity of MuLV-ERV U3 sequences at 24 hours after burn. The U3 population diversity within each experimental group was measured [21] and the relevant values, indicating different diversity levels, were presented as nucleotide diversity and Tajima statistics scores. There was a marked decrease in the U3 population diversity at 24 hours after burn compared to no burn.
Differential transcription potentials of MuLV-ERV U3-promoter sequences
| ctttctt | 68 | / | 1 | |
| tctggatctat | 35 | / | 4 | |
| ctctttc | 31 | / | 3 | |
| gctctggtactttttcatcccttgcaaaat | 27 | / | 1 | |
| gcca | 28 | / | 1 | |
| tgag | 27 | / | 2 | |
| gtatttctcggtcattt | 19 | / | 0 | |
| caca | 22 | / | 0 | |
| ggg | 21 | / | 1 | |
| gttattcggggaacctg | 32 | / | 13 | |
| ctga | 35 | / | 8 | |
| acttttga | 33 | / | 10 | |
| taatct | 16 | / | 37 | |
| gttctaaa | 14 | / | 28 | |
| gagagggtctaat | 10 | / | 30 | |
| atgg | 8 | / | 18 | |
| acaatgt | 5 | / | 19 | |
| ttt | 6 | / | 16 | |
| gggtc | 8 | / | 16 | |
| gggtc | 7 | / | 17 | |
| gagagggtc | 7 | / | 16 | |
| 5 | / | 19 | ||
| cacaca | 7 | / | 16 | |
| atct | 6 | / | 16 | |
| aaggttca | 6 | / | 15 | |
| tagttc | 5 | / | 16 | |
| gaaagagtc | 5 | / | 15 | |
| cacag | 5 | / | 16 | |
Numbers indicate the occurrence frequency of specific TREs (transcription regulatory elements) within the 100 unique U3-promoter sequences. Please refer to (Additional file 3: Table S3) for the complete list of TRE abbreviations.
Genomic map and characteristics of putative MuLV-ERVs harboring the unique U3 sequences
| 1 | MuERV-49 | 1 | 133539144 | 133548197 | + | 9054 | Q | - | + | + | U/U | I,II,III, |
| 2 | MuERV-31 | 1 | 166153938 | 166159683 | + | 5746 | Q | + | - | - | U/T | I,II, |
| 3 | MuERV-30 | 1 | 184187251 | 184196231 | + | 8981 | Q | + | P | + | U/T | I,II, |
| 4 | MuERV-33 | 1 | 193757492 | 193766472 | + | 8981 | Q | + | P | - | U/T | I,II, |
| 5 | MuERV-35 | 2 | 57066823 | 57075803 | - | 8981 | Q | + | + | + | U/T | I,II, |
| 6 | MuERV-3 | 2 | 156182292 | 156189341 | - | 7050 | Q | + | - | + | U/U | III, |
| 7 | MuERV-48 | 3 | 66900000 | 66907716 | + | 7717 | Q | + | - | - | U/U | I,II,III, |
| 8 | MuERV-55 | 3 | 151986104 | 151995146 | + | 9043 | Q | + | + | + | U/U | I,II,III, |
| 9 | MuERV-29 | 4 | 101535762 | 101544743 | - | 8982 | Q | + | P | + | U/T | I,II, |
| 10 | MuERV-28 | 4 | 107818639 | 107827621 | - | 8983 | Q | + | + | + | U/T | I,II, |
| 11 | MuERV-2 | 4 | 132651872 | 132657538 | + | 5667 | Q | - | - | - | U/U | I,II,III, |
| 12 | MuERV-6 | 4 | 133715306 | 133720617 | + | 5312 | Q | + | - | - | U/U | I,II,III, |
| 13 | MuLV_ERV4-5* | 4 | 145686198 | 145694956 | - | 8759 | Q | + | + | + | U/U | this study |
| 14 | XMV9 | 4 | 146592937 | 146601658 | + | 8722 | Q | + | + | + | U/U | |
| 15 | L-3-9.5 | 5 | 23206397 | 23215063 | - | 8667 | P | + | + | + | U/U | I, |
| 16 | MuLV_ERV5-2* | 5 | 23721126 | 23727971 | - | 6846 | Q | + | - | + | U/U | this study |
| 17 | MuERV-27 | 5 | 33864636 | 33873616 | + | 8981 | Q | - | + | + | U/T | I,II, |
| 18 | MuERV-18 | 5 | 44525599 | 44534580 | + | 8982 | Q | - | + | + | U/T | I,II, |
| 19 | MuERV-19 | 5 | 77359541 | 77368522 | + | 8982 | Q | + | + | + | U/T | I,II, |
| 20 | MuERV-26 | 7 | 7022622 | 7031603 | - | 8982 | Q | P | - | - | U/T | I,II, |
| 21 | MuERV-24 | 7 | 30400226 | 30408924 | + | 8699 | Q | + | + | P | U/T | I,II, |
| 22 | MuERV-25 | 7 | 31473659 | 31482639 | + | 8981 | Q | + | P | - | U/T | I,II, |
| 23 | MuERV-34 | 7 | 123575623 | 123581296 | + | 5674 | Q | + | - | - | U/T | I,II, |
| 24 | MuERV-10 | 8 | 44397084 | 44405817 | - | 8734 | Q | + | + | + | U/T | I,II, |
| 25 | MuERV-11 | 8 | 87649754 | 87656141 | - | 6388 | Q | + | P | - | U/T | I,II, |
| 26 | MuERV-1 | 8 | 93410190 | 93415857 | + | 5668 | Q | - | - | - | U/U | I,II,III, |
| 27 | MuERV-12 | 8 | 122413465 | 122420940 | - | 7476 | Q | - | - | + | U/T | I,II, |
| 28 | MuERV-8 | 9 | 41713568 | 41720351 | - | 6784 | Q | - | + | + | U/U | I,II, |
| 29 | iLN(III)-1a | 9 | 62286981 | 62295739 | + | 8759 | Q | + | + | + | U/U | |
| 30 | K-4-11.10a | 10 | 8263933 | 8271066 | - | 7134 | Q | - | - | - | U/T | I |
| 31 | MuERV-53 | 10 | 22454084 | 22463128 | + | 9045 | Q | + | + | + | U/U | I,II,III, |
| 32 | MuERV-17 | 10 | 41156454 | 41165434 | + | 8981 | Q | + | + | + | U/T | I,II, |
| 33 | BM-a-2.11e | 11 | 5905655 | 5911518 | + | 5864 | Q | - | - | - | B/B | |
| 34 | MuERV-22 | 11 | 6649425 | 6658394 | - | 8970 | Q | + | - | + | U/T | I,II, |
| 35 | MuERV-23 | 11 | 820301 | 8829280 | + | 8980 | Q | + | + | + | U/T | I,II, |
| 36 | MuERV-50 | 11 | 60392151 | 60399510 | - | 7360 | Q | - | P | - | U/U | I,II,III, |
| 37 | MuERV-51 | 11 | 76362310 | 76371354 | + | 9045 | Q | + | + | + | U/U | I,II,III, |
| 38 | MuERV-38 | 11 | 88751494 | 88758280 | - | 6787 | Q | + | - | + | U/T | I,II, |
| 39 | MuERV-37 | 12 | 20704753 | 20710513 | + | 5761 | Q | - | - | - | U/T | I,II, |
| 40 | MuERV-16 | 12 | 55875211 | 55884192 | + | 8982 | Q | + | + | + | U/T | |
| 41 | MuERV-5 | 13 | 67985825 | 67994511 | - | 8687 | Q | + | + | + | U/U | I,II,III, |
| 42 | MuERV-21 | 13 | 99756230 | 99765210 | - | 8981 | Q | + | P | + | U/T | I,II, |
| 43 | MuERV-7 | 14 | 54912048 | 54917591 | - | 5544 | Q | + | - | - | U/U | |
| 44 | L-1-2.14 | 14 | 55149203 | 55157025 | - | 7823 | Q | P | + | + | U/U | I, |
| 45 | MuERV-15 | 15 | 76390247 | 76397432 | - | 7186 | Q | - | - | + | U/T | I,II, |
| 46 | U-1-5.16 | 16 | 76135288 | 76144269 | - | 8982 | Q | - | P | - | U/T | I, |
| 47 | MuERV-14 | 16 | 93697702 | 93706682 | - | 8981 | Q | - | + | + | U/T | I, |
| 48 | MuERV-20 | 18 | 82862943 | 82871822 | + | 8880 | Q | - | + | + | U/T | I,II, |
| 49 | MuERV-32 | 19 | 38449512 | 38456573 | + | 7062 | Q | - | P | - | U/T | I,II, |
| 50 | MuERV-9 | 19 | 61001210 | 61009936 | - | 8727 | Q | + | + | + | U/U | I,II, |
| 51 | MuERV-13 | X | 15051174 | 15060154 | + | 8981 | Q | + | P | + | U/T | I,II, |
Chr (chromosome), Ori (orientation), PBS (primer binding site), Q (tRNAglutamine), P (tRNAproline), ORF (open reading frame), + (intact/full-length), - (defective), U (both B- and T- cells; both no burn and burn), B (B-cell), T (T-cell), references I [14], II [33], III [31], IV [30] and V [32]. *MuLV-ERV newly identified in this study. The names of MuLV-ERVs, which have been reported in previous studies, are adapted from the relevant reference in bold.