| Literature DB >> 23070217 |
Jesper T Grønlund1, Alison Eyres, Sanjeev Kumar, Vicky Buchanan-Wollaston, Miriam L Gifford.
Abstract
After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves(1). However, the Arabidopsis leaf is a complex organ made up of many different cell types and several structures. At the same time, the growing leaf contains cells at different stages of development, with the cells furthest from the petiole being the first to stop expanding and undergo senescence(1). Different cells within the leaf are therefore dividing, elongating or differentiating; active, stressed or dead; and/or responding to stimuli in sub-sets of their cellular type at any one time. This makes genomic study of the leaf challenging: for example when analyzing expression data from whole leaves, signals from genetic networks operating in distinct cellular response zones or cell types will be confounded, resulting in an inaccurate profile being generated. To address this, several methods have been described which enable studies of cell specific gene expression. These include laser-capture microdissection (LCM)(2) or GFP expressing plants used for protoplast generation and subsequent fluorescence activated cell sorting (FACS)(3,4), the recently described INTACT system for nuclear precipitation(5) and immunoprecipitation of polysomes(6). FACS has been successfully used for a number of studies, including showing that the cell identity and distance from the root tip had a significant effect on the expression profiles of a large number of genes(3,7). FACS of GFP lines have also been used to demonstrate cell-specific transcriptional regulation during root nitrogen responses and lateral root development(8), salt stress(9) auxin distribution in the root(10) and to create a gene expression map of the Arabidopsis shoot apical meristem(11). Although FACS has previously been used to sort Arabidopsis leaf derived protoplasts based on autofluorescence(12,13), so far the use of FACS on Arabidopsis lines expressing GFP in the leaves has been very limited(4). In the following protocol we describe a method for obtaining Arabidopsis leaf protoplasts that are compatible with FACS while minimizing the impact of the protoplast generation regime. We demonstrate the method using the KC464 Arabidopsis line, which express GFP in the adaxial epidermis(14), the KC274 line, which express GFP in the vascular tissue(14) and the TP382 Arabidopsis line, which express a double GFP construct linked to a nuclear localization signal in the guard cells (data not shown; Figure 2). We are currently using this method to study both cell-type specific expression during development and stress, as well as heterogeneous cell populations at various stages of senescence.Entities:
Mesh:
Substances:
Year: 2012 PMID: 23070217 PMCID: PMC3490320 DOI: 10.3791/4214
Source DB: PubMed Journal: J Vis Exp ISSN: 1940-087X Impact factor: 1.355
|
|
|
|
|
|
| Whole leaf A Whole leaf B | 1 1 | - - | 8001 10525 | 4623*** 4572*** |
| Unsorted protoplasts A Unsorted protoplasts B | 5 5 | - - | 2433 2625 | 1152*** 3321*** |
| GFP1 A Rest1 A | 15 | 6039 (0.39%*) 55389 (6.40%*) | -** -** | 861 489 |
| GFP1 B Rest1 B | 15 | 10783 (0.63%*) 57040 (7.49%*) | -** -** | 537 420 |
| GFP2 Rest2 | 15 | 18337 (1.49%*) 62405 (73.49%*) | -** -** | 360 411 |
|
|
|
| mGFP5-ER.fw | GCCTGAGGGATACGTGCAGGAGA |
| mGFP5-ER.rv | TGGCGGGTCTTGAAGTTGGCT |
| ACT2.fw | GCCATCCAAGCTGTTCTCTC |
| ACT2.rv | GCCATCCAAGCTGTTCTCTC |