| Literature DB >> 22949819 |
Wei Gao1,2,3, He Zhao3, Ying Liu3, Ming-Rui Li3, Eliyas Nurmamat4, Lin-Feng Li3, Yue-Ying Ren1, Hong-Xing Xiao3.
Abstract
Clivia is a genus of great horticultural importance and has been widely cultivated as ornamental plants in all over the world. In order to assess the phylogenetic relationships and genetic diversity of the wild Clivia species and cultivars, we isolated AC-enriched repeats using FIASCO from a single clone each of C. miniata Regel. and Clivia nobilis Lindl. Of the fourteen repeats, 10 were polymorphic and 4 were monomorphic. The polymorphic marker loci were characterized using 61 Clivia accessions. The number of alleles ranged from two to six, observed heterozygosity ranged from 0.04 to 1.00 and expected heterozygosity ranged from 0.04 to 0.83. These microsatellite marker loci provide tools for future studies of Clivia species and cultivars.Entities:
Keywords: Clivia miniata; Clivia nobilis; genetics diversity; microsatellite
Mesh:
Year: 2012 PMID: 22949819 PMCID: PMC3431817 DOI: 10.3390/ijms13089609
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 6.208
Results of initial primer screening in Clivia miniata, Clivia nobilis and hybrids of the two species. Parameters shown for each pair of primers are the number of the samples (N), number of alleles (NA), observed heterozygosity (HO) and expected heterozygosity (HE).
| Hybrid ( | |||||||||
|---|---|---|---|---|---|---|---|---|---|
|
|
|
| |||||||
| Locus | |||||||||
| CM9 | 3 | 0.17 | 0.18 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| CM12 | 4 | 0.22 | 0.18 | 3 | 0.83 | 0.50 | 3 | 0.49 | 0.38 |
| CM54 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 | 0.22 | 0.00 |
| CM65 | 2 | 0.09 | 0.10 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| CM103 | 4 | 0.48 | 0.53 | 2 | 0.50 | 0.50 | 1 | 0.00 | 0.00 |
| CM137 | 2 | 0.04 | 0.04 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| CM289 | 3 | 0.44 | 0.65 | 2 | 0.50 | 0.50 | 4 | 0.42 | 0.38 |
| CM357 | 5 | 0.56 | 0.76 | 3 | 0.83 | 0.83 | 2 | 0.20 | 0.00 |
| CN68 | 4 | 0.23 | 0.16 | 1 | 0.00 | 0.00 | 3 | 0.30 | 0.00 |
| CN106 | 2 | 0.50 | 1.00 | 2 | 0.67 | 1.00 | 2 | 0.47 | 0.88 |
Characteristics of ten microsatellite markers based on 61 Clivia accessions. For each locus, the names, primer sequences [forward (F) and reverse(R)], repeat motif, size of the cloned allele, annealing temperature, number of alleles and GenBank accession number are shown.
| Locus | Primer sequences (5′–3′) | Repeat | Size (bp) | GenBank | ||
|---|---|---|---|---|---|---|
| CM9 | F: TTACCTCCTCCAACTCACAG | (TG)9 | 251 | 48 | 3 | JQ782265 |
| CM12 | F: CAACCTCAAGCTCAGTCTCA | (AC)6T(AC)2 | 230 | 47 | 4 | JQ782266 |
| CM54 | F: GAGCAACTCAGGAAGGGATG | (GT)16 | 194 | 46 | 2 | JQ782267 |
| CM65 | F: AGGGTGAGAGTGTAGGTGTG | (GT)4T(TG)4 | 190 | 48 | 2 | JQ782268 |
| CM103 | F: ACCCCTTACACAGACTACCA | (AC)15G(CA)21 | 313 | 47 | 4 | JQ782271 |
| CM137 | F: TTCTTGCCGACAATCCCGTA | (AC)6 | 288 | 47 | 2 | JQ782273 |
| CM289 | F: GGATATTATGTTGCCAAGCC | (TG)11 | 207 | 58 | 5 | JQ782275 |
| CM357 | F: GCGAATGATAATCGTGAACC | (GT)16 | 160 | 46 | 6 | JQ782276 |
| CN68 | F: TTCTGACTTACACCTACACA | (AC)17 | 167 | 47 | 5 | JQ782269 |
| CN106 | F: AACAGCAGGAAATTAGGGAG | (TG)16 | 195 | 48 | 2 | JQ782272 |