Contribution of toll-like receptor 9 gene single-nucleotide polymorphism to systemic lupus erythematosus.

There are several studies on the association of TLR9 polymorphisms with systemic lupus erythematosus (SLE) in different ethnicities; however, the results are inconsistent. Therefore, we studied the distribution of the TLR9 C > T (rs352140) polymorphism in patients with SLE (n = 254) and controls (n = 521) in a Polish population. We did not observe significant differences in the prevalence of the TLR9 C > T genotype and alleles between patients with SLE and controls. However, we found a contribution of the T/T and T/C genotypes to renal [OR = 2.949 (95 % CI = 1.523-5.711, p = 0.001), (p corr = 0.017)] and immunologic disorders [OR = 2.938 (95 % CI 1.500-5.755, p = 0.0012), (p corr = 0.0204)] in SLE patients. Moreover, we observed a significant association between the TLR9 T/T and T/C genotypes and the presence of anti-dsDNA Ab [OR = 3.682 (1.647-8.230, p = 0.001), (p corr = 0.017)]. Our studies suggest that the TLR9 C > T (rs352140) polymorphism might contribute to renal and immunologic disorders and to the presence of anti-dsDNA Ab.

Introduction

Systemic lupus erythematosus (SLE) is a progressive and chronic autoimmune disorder in which the immune system cannot distinguish between the body’s own tissues and foreign antigens, producing antibodies (Ab) to self-antigens [1]. Flare-ups of SLE can be initiated by disparate environmental factors, such as exposure to ultraviolet light, drugs, chemicals, as well as viral and bacterial infections [2, 3]. The underlying cause of SLE is elusive; however, it is well established that both environmental and genetic factors are involved in this disease [3-7]. Genome-wide association studies have revealed many SLE prone genes and the contribution of some of these genes to the risk of SLE have been studied in different ethnicities [7]. One of these genes is the toll-like receptor 9 (TLR9) gene located in susceptibility regions for SLE [7].

TLR9 plays an elementary role in pathogen recognition and activation of innate immunity [8-10]. This receptor recognizes unmethylated cytosine–phosphate–guanine (CpG) dinucleotide motifs located in bacterial, viral and fungal DNA [8-12]. The TLR9 gene is expressed in macrophages and dendritic cells, and TLR9 has been shown to be present almost exclusively in endosomes [8, 13–15].

It has been demonstrated that TLR9 is involved in the development of autoimmunity in SLE patients [16-18]. Stimulation of TLR9 in the endosomes by host DNA leads to plasmacytoid dendritic cell activation and type I interferon biosynthesis, which is implicated in lupus pathophysiology [19]. TLR9 activation also promotes the production of IgG2a and IgG2b autoantibodies recognizing host DNA, which further develop autoimmunity pathology [20]. The role of TLR9 in autoimmunity was also demonstrated by Leadbetter et al. [21], who indicated that DNA-containing complexes interacting with TLR9 may activate both autoreactive B cells and other antigen presenting cells.

There are several studies on the contribution of TLR9 polymorphisms to the risk of SLE in different ethnicities; however, the results are inconsistent [22-27]. The four TLR9 single-nucleotide polymorphisms rs187084, rs5743836, rs352139 and rs352140 in Caucasians are located in the same block of linkage disequilibrium (LD) HapMap CEU data (http://hapmap.ncbi.nlm.nih.gov/). Therefore, we aimed to study whether TLR9 C > T (rs352140) can be a genetic risk factor of SLE in the Polish population. Because SLE is a heterogeneous disorder, we also evaluated the contribution of this polymorphism to different clinical symptoms of SLE.

Patients and methods

Patients and controls

Data for two hundred and fifty-four women fulfilling the American College of Rheumatology Classification criteria for SLE [28, 29] were collected in a random manner for the study at the Institute of Rheumatology in Warsaw, Poland. Controls included five hundred and twenty-one unrelated healthy volunteers and healthy women selected during medical examination at the Institute of Mother and Child, Warsaw. Women with SLE and controls were of Polish Caucasian origin and of a similar age. The mean age of SLE patients at diagnosis was 36 ± 9 years and of controls 35 ± 8 years. All participating subjects provided written consent. The study procedures were approved by the Local Ethical Committee of Poznań University of Medical Sciences.

Genotyping

DNA was isolated from peripheral leucocytes using a standard salting out procedure. Identification of the TLR9 C > T (rs352140) polymorphic variant was performed by polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). PCR was conducted employing primer pair 5′ GCAGCACCCTCAACTTCACC 3′and 5′ GGCTGTGGATGTTGTTGTGG 3′. The PCR-amplified fragments of TLR9 that were 360 bp in length were isolated and digested with the endonuclease BstUI (CG/CG) New England BioLabs (Ipswich, USA). The TLR9 C allele was cleaved into 227 bp and 133 bp fragments, whereas the TLR9 T allele remained uncut. DNA fragments were separated by electrophoresis on 3 % agarose gel and visualized by ethidium bromide staining. The TLR9 C > T polymorphism was confirmed by repeated PCR–RFLP. Moreover, the restriction analysis was confirmed by commercial sequencing analysis.

Statistical analysis

The distribution of genotypes in patients and controls was examined for deviation from Hardy–Weinberg equilibrium using exact and log likelihood ratio Chi-squared (χ2) tests (http://ihg.gsf.de/cgi-bin/hw/hwa1.pl). The polymorphism was tested for association with SLE incidence using the χ2 test for trend (p trend). The χ2 test was employed to examine differences in genotypic and allelic distribution between patients and controls, and a p value <0.05 was considered statistically significant. The odds ratio (OR) and 95 % confidence intervals (95 % CI) were calculated. Contribution of the TLR9 C > T polymorphism to clinical manifestations and the production of autoantibodies were determined by χ2 test. The Bonferroni correction for multiple comparisons was used and both p values, before (p) and after correction (p corr), were determined.

Results

Distribution of the TLR9 C > T (rs352140) polymorphism in SLE patients and healthy individuals

Prevalence of the TLR9 C > T genotypes did not exhibit significant deviation from Hardy–Weinberg equilibrium between patients and controls. We observed a similar frequency of the TLR9 T/T genotype in patients with SLE and healthy individuals, and OR for SLE patients with the T/T versus T/C and C/C genotypes was 1.079 (95 % CI = 0.7592–1.534, p = 0.6713) (Table 1). The frequency of the TLR9 T/T and C/T genotypes was not statistically increased in patients with SLE than in controls OR = 1.414 (95 % CI = 0.9847–2.029, p = 0.0598) (Table 1). We also observed a non-significant increase in the TLR9 T allele in patients compared to healthy individuals OR = 1.164 (95 % CI = 0.9412–1.439, p = 0.1610) (Table 1). The p value of the χ2 test of the trend observed for the TLR9 C > T polymorphism was also not significant (p trend = 0.1531) (Table 1).

Table 1

Prevalence of the TLR9 C > T (rs352140) polymorphism in SLE patients and controls

TLR9 C > T (rs352140)	SLE n = 254	Controls n = 521	OR	95 %CI	p valued	p trend
Genotype frequency						0.1531
C/C	52 (0.21)	139 (0.27)
C/T	140 (0.55)	262 (0.50)
T/T	62 (0.24)	120 (0.23)	1.079a	(0.7592–1.534)a	0.6713a
C/T + T/T	202 (0.79)	382 (0.73)	1.414b	(0.9847–2.029)b	0.0598b
Minor allele frequency
T	0.52	0.48	1.164c	0.9412–1.439c	0.1610c

The odds ratio (OR) was calculated for patients

a (T/T vs C/T and C/C genotype), b (T/T and C/T vs C/C genotype). We also determined the OR for the patients’ minor allele; c (T allele vs C allele); d χ2 test

Association of the TLR9 C > T (rs352140) polymorphism with clinical manifestations and production of autoantibodies in patients with SLE.

We observed a contribution of the T/T and T/C genotypes to renal OR = 2.949 (95 % CI = 1.523–5.711, p = 0.001), (p corr = 0.017) and immunologic disorders OR = 2.938 (95 % CI 1.500–5.755, p = 0.0012), (p corr = 0.0204) in SLE patients (Table 2). Moreover, we observed a significant association between the TLR9 T/T and T/C genotypes and the presence of anti-dsDNA Ab OR = 3.682 (1.647–8.230, p = 0.001), (p corr = 0.017) (Table 3).

Table 2

Distribution of the TLR9 C > T (rs352140) polymorphism among SLE patients with different clinical manifestations

Characteristic	Genotype distribution			Odds ratio (95 % CI), p c
	C/C (52)a	C/T (140)a	T/T (62)a
Malar rash	29	77	33
Discoid rash	16	43	18
Phototosensitivity	26	64	28
Oral or nasopharyngeal	23	53	26
Arthritis	14	33	15
Serositis	10	25	11
Renal	15	76	34	2.949 (1.523–5.711, p = 0.001)b
Neurologic	12	27	13
Hematologic	19	47	21
Immunologicd	14	76	29	2.938 (1.500–5.755, p = 0.0012)b
ANA	52	140	62

aRepresents the absolute number of positive patients for C/C, C/T and T/T genotypes, respectively. Comparison of genotypes b (T/T or C/T vs C/C genotype) between patients with and patients without a particular manifestation was performed by c χ2 test. d Include presence of anti-DNA Ab or anti-Smith Ab or antiphospholipid Ab

Table 3

Effect of the TLR9 C > T (rs352140) polymorphism on the presence of various autoantibodies in patients with SLE

Autoantibodies	Genotype distribution			Odds ratio (95 % CI), p c
	C/C (52)a	T/C (140)a	T/T (62)a
Anti-dsDNA	8	58	23	3.682 (1.647–8.230, p = 0.001)b
Anti-Smith	4	13	6
Anti-snRNP	10	28	13
Anti-Ro	9	24	11
Anti-La	8	20	8
Anti-Scl-70	10	27	12

aRepresents the absolute number of positive patients for C/C, C/T and T/T. Genotype comparison b (T/T and T/C vs C/C genotype) between patients with and patients without an autoantibody was performed by c χ 2 test

Discussion

Some studies have demonstrated increased TLR9 expression in B cells from patients with SLE [30, 31]. Papadimitraki et al. [30] reported an increased proportion of peripheral blood memory B cells and plasma cells expressing TLR9, which correlated with the presence of anti-dsDNA Ab in patients with active SLE. Another study revealed that the level of TLR9 mRNA in B cells was increased in SLE patients, and TLR9 expression on CD20+ B cells correlated with SLE activity and CH50 [31]. This may suggest that genetic variations of TLR9 that affect their expression may have an effect on SLE development and clinical manifestation of this disease.

We did not observe a contribution of the TLR9 C > T (rs352140) polymorphism to the risk of SLE in a Polish population. Recent studies conducted by Huang et al. (2011) suggested that the TLR9 −1486 T/C (rs187084) polymorphism, located in the LD block with rs352140, is related to SLE in Taiwanese patients. [22]. In addition to this finding, Xu et al. [23] demonstrated a significant association of rs352140 gene variants with the susceptibility to SLE in a Chinese population. Additionally, the TLR9 G allele at position +1174 of TLR9 (rs352139) conferred an increased risk for SLE in a Japanese population [24]. The contributions of rs5743836 to SLE have been observed in individuals of European descent from Southern Brazil; however, this was not confirmed in Caucasian American individuals [25, 32]. TLR9 polymorphisms were not significantly associated with the susceptibility to SLE and related phenotypes in Korean patients with SLE [26]. Furthermore, Zhou et al. [27] did not find a significant contribution of the rs352140 polymorphism to SLE development in a Chinese Han population.

In our study, the TRL9 T/T and T/C genotypes exhibited a significantly increased risk of developing renal disease in patients with SLE. The significant association between the rs352140 gene variant and lupus nephritis was also observed in a Chinese Han population [27]. We also observed that the TRL9 T/T and T/C genotypes were significantly associated with immunologic disorders and the presence of anti-dsDNA Ab in patients with SLE. To date, an increased frequency of the TRL9 rs5743836 C allele has been observed in patients of European descent from Southern Brazil bearing the Anti-SSa/Ro Ab [25].

These differences in the effect of the TRL9 polymorphisms on SLE development and clinical manifestations in various populations may be due to racial heterogeneity, the size of the studied groups, or population exposure to disparate environmental factors.

The function of +1174 G/A of TLR9 rs187084 located in the LD block with rs352140 has been studied by Tao et al. [24], who demonstrated that the +1174 G variant may down-regulate TLR9 expression. Moreover, they indicated that TLR9 rs187084 may contribute to differences in the B cell response to autoantigens and the production of autoantibodies [24].

Recently, the role of TLR9 expression in the production of anti-dsDNA Ab was confirmed by Chen et al. [33], who performed knockdown of TLR9 by siRNA in B cells, resulting in a reduction of anti-dsDNA Ab levels and amelioration of the disease in SLE murine model. Recent studies also suggest that the changes in TLR9 expression may have an effect on renal disease development in SLE [34, 35]. Machida et al. [34] demonstrated that injured podocytes express TLR9 in active lupus nephrites accompanied by proteinuria and elevated anti-dsDNA Ab. In addition to this finding, Anders et al. [35] revealed that activation of TLR9 by CpG oligonucleotides in MRL-Fas (lpr) mice induces anti-dsDNA Ab production and renal disease.

Our study may suggest that renal disease and immunologic disorders, along with the presence of anti-dsDNA Ab, in SLE patients may be associated with the TRL9 (rs352140) T gene variant. However, to confirm the role of the rs352140 polymorphism in SLE, this study should be replicated in a larger and independent cohort.