Surface proteins of the obligate intracellular bacterium Rickettsia typhi, the agent of murine or endemic typhus fever, comprise an important interface for host-pathogen interactions including adherence, invasion and survival in the host cytoplasm. In this report, we present analyses of the surface exposed proteins of R. typhi based on a suite of predictive algorithms complemented by experimental surface-labeling with thiol-cleavable sulfo-NHS-SS-biotin and identification of labeled peptides by LC MS/MS. Further, we focus on proteins belonging to the surface cell antigen (Sca) autotransporter (AT) family which are known to be involved in rickettsial infection of mammalian cells. Each species of Rickettsia has a different complement of sca genes in various states; R. typhi, has genes sca1 thru sca5. In silico analyses indicate divergence of the Sca paralogs across the four Rickettsia groups and concur with previous evidence of positive selection. Transcripts for each sca were detected during infection of L929 cells and four of the five Sca proteins were detected in the surface proteome analysis. We observed that each R. typhi Sca protein is expressed during in vitro infections and selected Sca proteins were expressed during in vivo infections. Using biotin-affinity pull down assays, negative staining electron microscopy, and flow cytometry, we demonstrate that the Sca proteins in R. typhi are localized to the surface of the bacteria. All Scas were detected during infection of L929 cells by immunogold electron microscopy. Immunofluorescence assays demonstrate that Scas 1-3 and 5 are expressed in the spleens of infected Sprague-Dawley rats and Scas 3, 4 and 5 are expressed in cat fleas (Ctenocephalides felis). Sca proteins may be crucial in the recognition and invasion of different host cell types. In short, continuous expression of all Scas may ensure that rickettsiae are primed i) to infect mammalian cells should the flea bite a host, ii) to remain infectious when extracellular and iii) to infect the flea midgut when ingested with a blood meal. Each Sca protein may be important for survival of R. typhi and the lack of host restricted expression may indicate a strategy of preparedness for infection of a new host.
Surface proteins of the obligate intracellular bacterium Rickettsia typhi, the agent of murine or endemic typhus fever, comprise an important interface for host-pathogen interactions including adherence, invasion and survival in the host cytoplasm. In this report, we present analyses of the surface exposed proteins of R. typhi based on a suite of predictive algorithms complemented by experimental surface-labeling with thiol-cleavable sulfo-NHS-SS-biotin and identification of labeled peptides by LC MS/MS. Further, we focus on proteins belonging to the surface cell antigen (Sca) autotransporter (AT) family which are known to be involved in rickettsial infection of mammalian cells. Each species of Rickettsia has a different complement of sca genes in various states; R. typhi, has genes sca1 thru sca5. In silico analyses indicate divergence of the Sca paralogs across the four Rickettsia groups and concur with previous evidence of positive selection. Transcripts for each sca were detected during infection of L929 cells and four of the five Sca proteins were detected in the surface proteome analysis. We observed that each R. typhi Sca protein is expressed during in vitro infections and selected Sca proteins were expressed during in vivo infections. Using biotin-affinity pull down assays, negative staining electron microscopy, and flow cytometry, we demonstrate that the Sca proteins in R. typhi are localized to the surface of the bacteria. All Scas were detected during infection of L929 cells by immunogold electron microscopy. Immunofluorescence assays demonstrate that Scas 1-3 and 5 are expressed in the spleens of infected Sprague-Dawley rats and Scas 3, 4 and 5 are expressed in cat fleas (Ctenocephalides felis). Sca proteins may be crucial in the recognition and invasion of different host cell types. In short, continuous expression of all Scas may ensure that rickettsiae are primed i) to infect mammalian cells should the flea bite a host, ii) to remain infectious when extracellular and iii) to infect the flea midgut when ingested with a blood meal. Each Sca protein may be important for survival of R. typhi and the lack of host restricted expression may indicate a strategy of preparedness for infection of a new host.
Rickettsia (Rickettsiales: Rickettsiaceae) are Gram-negative, obligate intracellular bacteria that are maintained in enzootic cycles involving both hematophagous arthropod vectors and vertebrate hosts [1]. Rickettsiae are the causative agents of significant human diseases such as Rocky Mountain spotted fever (R. rickettsii) and epidemic typhus (R. prowazekii). Classically, the members of the genus Rickettsia have been divided into two groups: the tick-transmitted spotted fever group (SFG) and the insect-transmitted typhus group (TG) based on their antigenic and molecular profiles. However, these groups share some antigenic proteins such as outer membrane protein B (OmpB) and 17 kDa lipoprotein [2]. The tick-transmitted SFG currently includes over 16 species, several of which are known human pathogens (R. rickettsii, R. conorii, and R. sibirica). The louse and flea transmitted TG rickettsia contain the pathogenic species R. prowazekii and R. typhi (causative agent of murine typhus). Extensive phylogenetic and comparative genomic analyses have resulted in the proposal of the ancestral group (AG) and transitional group (TRG) rickettsia and these include species with mild or unknown pathogenicity as well as broad arthropod host ranges [3], [4], [5].Despite the recent advances made in rickettsial molecular biology and genomics, their determinants of pathogenicity still remain undefined. Because of the involvement of rickettsial Omps in cell surface recognition, initial binding of bacteria to host cells, invasion processes [6], [7] as well as their immunogenicity and utility as vaccine candidates, this group of proteins has been a target of interest [8], [9], [10], [11]. Bacterial surface-exposed proteins are involved in an array of processes including sensing the environment, protection from environmental stresses, adherence to and invasion of host cells, cell growth and interaction with the immune system. For intracellular bacteria, surface exposed proteins interact with host cytoplasmic or organelle proteins [12], [13]. Characterizing the surface composition of rickettsiae allows for identification of factors required for successful colonization of mammalian and arthropod hosts.The family of rickettsial autotransporters (ATs) are referred to as surface cell antigen (Sca) proteins [14]. A previous computation analysis identified 17 orthologs Sca0 (OmpA), Sca1-Sca4, Sca5 (OmpB), Sca6-Sca16) distributed throughout nine complete rickettsial genome sequences [15]. These genomes as well as those subsequently sequenced, each encode a unique repertoire of sca orthologs that are present in different functional states (i.e. complete, fragmented or split). Furthermore, while the AT domains are well conserved within orthologs and to a lesser degree across paralogs, much less amino acid identity is observed among the passenger domains [15]. Experimental studies have detected expression of Sca0, Sca5 and Sca4 by various methods [16], [17], [18], however, only Sca0, Sca5 and more recently Sca1 and Sca2 of R. conorii have been shown to function as adhesins [6], [19], [20], [21]. The internal repeat motifs within the passenger domains are proposed to render each protein an adhesin and contribute specificity to host receptors [15]. For R. conorii Sca5, these repeats may contribute to its specificity for the DNA protein kinase Ku70 on the surface of host cells [22]. More recently, Sca2 in R. parkeri has been characterized as a formin-like mediator of actin-based motility [23] indicating that some of the Scas have intracellular functions and may interact with host proteins to promote rickettsial survival.R. typhi, the focal organism of this study, contains 5 sca orthologs in its genome – sca1, sca2, sca3, sca4 and sca5. As in other species studied, Sca5 likely mediates adherence and invasion of R. typhi to host cells, however little is known about the expression and function of the other Sca orthologs during R. typhi infection in either mammalian or arthropod hosts. A better understanding of the expression and distribution of the Scas during R. typhi transmission and infection is crucial in order to appreciate the function of these proteins. This study is a comparative analysis that was undertaken to elucidate the transcriptional and protein expression profiles of the R. typhi Sca family in vitro (tissue culture) and in vivo (rat and flea infections). This study addresses our hypothesis that R. typhi Sca expression is time and host dependent.
Results
Surface proteome analysis of R. typhi str. Wilmington
Surface proteins of intracellular bacteria mediate interactions required for their pathogenesis and survival. Defining the surface proteome of R. typhi provides a better understanding of the potential interactions at the host-pathogen interface. Using CoBaltDB [24] and pSORTb v. 3.0 [25], several signal peptide and subcellular localization algorithms were employed to generate predictions of secreted and outer membrane proteins among the 838 ORFs in R. typhi. Of the 838 ORFs, 140 were predicted to be secreted by at least one of the four algorithms employed (Figure 1). Further, 25 proteins had no detectable secretion signals but were predicted to be localized to the membrane or extracellular to bacteria (Table S1, proteins highlighted in yellow). Only the SOSUI-GramN [26] and PSORTb v. 3.0 [27] algorithms identified proteins localized to the cytoplasmic membrane, inner membrane or outer membrane (Tables S1 and S2).
Figure 1
Venn diagram of the number of proteins predicted to be secreted by the indicated algorithms.
The entire R. typhi str. Wilmington proteome was submitted to SignalP, LipoP, Phobius and SecretomeP servers as outlined in the Materials & Methods section. Results from each program were compiled and the numbers of proteins predicted by each program individually or in all possible combinations were tabulated and are indicated in the above Venn diagram.
Venn diagram of the number of proteins predicted to be secreted by the indicated algorithms.
The entire R. typhi str. Wilmington proteome was submitted to SignalP, LipoP, Phobius and SecretomeP servers as outlined in the Materials & Methods section. Results from each program were compiled and the numbers of proteins predicted by each program individually or in all possible combinations were tabulated and are indicated in the above Venn diagram.In a previous study, putative secretion signals R. typhi ORFs were tested for the ability to facilitate secretion to the periplasm via a sec-translocon dependent mechanism in E. coli
[28]. We further analyzed all R. typhi str. Wilmington ORFs using the SecretomeP method [29] which identifies non-classically secreted proteins using a sequence-derived feature based approach and was trained on proteins experimentally identified on the bacterial surface but not predicted to be secreted by SignalP algorithms. Based on the SecretomeP method, 26 of the proteins with classical secretion signals also have signals for non-classical secretion methods (Figure 1 and Table S1, proteins highlighted in green). Fifty-four proteins were predicted to have only non-classical signals (Figure 1 and Table S2).Only a fraction of the proteins predicted to be secreted were identified in the surface proteome analysis. A total of 68 proteins were detected (Table S3), 27 of which are predicted to be secreted (to the periplasm via the Sec translocon as determined by SignalP) or surface-exposed (in the outer membrane or extracellular to bacteria as determined by SOSUIGramN and pSORTb) by at least one of the algorithms used. Fifteen of the proteins are predicted to have secretion signal peptides as determined by SignalP NN and/or HMM algorithms. pSORTb v. 3.0 [25] predicted three proteins to be localized to the outer membrane [RT0565 and RT0699(Sca5)] or be extracellular (RT0522). SOSUIGramN localized 11 proteins to either the outer membrane (RT0521, RT0744 and RT0805) or extracellular [RT0052(Sca2), RT0699(Sca5), etc.] to bacteria (Table S3 cells shaded grey). LipoP, Phobius and SecretomeP were the only algorithms to predict signal sequences for one (RT0117), two (RT0222 and RT0584) and five (RT0138, RT0176, RT0362, RT0485 and RT0638) proteins, respectively (Tables S3). The predicted signal peptides for 11 of these 68 proteins were previously tested for Sec-translocon dependent secretion into the periplasm using an alkaline phosphatase (PhoA) gene fusion system (see footnotes Table S3) and 10 of them were found to mediate secretion [28]. Proteins predicted by the SecretomeP method may be present in the outer membrane as a result of Sec-independent secretion mechanisms. Most of the peptides identified are predicted to be cytoplasmic or have unknown localizations with few of them predicted to be localized to the surface of the bacterium as determined by pSORTb and SOSUIGramN. The expression of cytoplasmic proteins on the surface of bacteria is not uncommon. Of the proteins identified in this study, 18 have homologs that have been shown to be surface exposed in other rickettsial species [30], [31], [32], [33], other Gram-negative bacteria [34], [35], [36] and Gram-positive bacteria [37]. Additionally, 14 of the proteins are annotated as hypothetical and only 5 of the 14 have predicted signal peptides detected by at least one of the algorithms further suggesting that rickettsial proteins may have novel secretion signals.The identification of most of the Sca proteins on the surface was largely consistent with the localization predictions (Table S1). Specifically, both pSORTb algorithms, LipoP, Phobius and SecretomeP predicted the presence of signal peptides for Sca1-3 and Sca5. SOSUI-GramN and pSORTb also localized each of these proteins as extracellular to the bacteria or to the outer membrane. SecretomeP was the only program to predict a signal sequence within Sca4 (Table S2); it is also predicted to be localized to the cytoplasm by the SOSUI-GramN and pSORTb algorithms.
In silico characterization of R. typhi Sca proteins
Sequence analysis of Sca1-Sca5 of R. typhi indicates that all five proteins are full length and contain characteristics typical of other Scas from rickettsiae (Figure 2A). Repeat regions were predicted within only three of the five proteins (Sca2, Sca3 and Sca4). Consistent with a sequence analysis of Sca2 from R. parkeri
[23], Sca2 of R. typhi contains a proline-rich tract and a series of five WH2 domains; however, the position of these motifs within the passenger domain of R. typhi (as well as R. bellii, R. prowazekii and one of the two R. akari proteins) differs greatly from R. parkeri and the other orthologs of SFG Rickettsiae (Text S2). In general, the passenger domains from Sca1, Sca2, Sca3, and the full Sca4 protein differ in sequence length, percent amino acid identity, and number of repeat regions across the 16 analyzed Rickettsia taxa (Figure 2B). While the distribution of the Sca paralogs across these 16 taxa somewhat correlates with the four rickettsia groups, only the R. felis genome encodes a full-length ortholog for each of the five R. typhi Scas (Text S2 and Figure S1), which like R. typhi, is vectored principally by fleas.
Figure 2
Characteristics of rickettsial surface cell antigens (Scas).
A) Schema depicting the major features of R. typhi Sca1 (RT0015, YP_066986), Sca2 (RT0052, YP_067021), Sca3 (RT0438, YP_067397), Sca4 (RT0485, YP_067439), and Sca5 (RT0699, YP_067640). N-terminal circles depict predicted (SignalP) and/or experimentally-supported (PhoA fusion assay) sec dependent signal sequences. Divergent repeat regions [77] and other identified motifs are colored coded for Sca2, Sca3 and Sca4. B) Comparative analysis of Sca1-Sca5 across 16 rickettsia genomes. Dashed box encloses the R. typhi Scas. Phylogeny at left is based on whole genome analysis [82], with rickettsial groups as follows: red, ancestral group; aquamarine, typhus group; blue, transitional group, brown, spotted fever group. Principal host vectors (tick, flea, louse, mite) for each taxon are illustrated. Green boxes depict passenger domains (as illustrated in A) associated with an AT domain, with the length of each passenger given in amino acids. Skull and crossbones represent pseduogenes. Black boxes depict sca gene fragments encoded within the R. prowazekii str. Madrid E genome (all of which have a conserved downstream ORF encoding an AT domain). Accession numbers for all sequences are provided in Figure S1.
Characteristics of rickettsial surface cell antigens (Scas).
A) Schema depicting the major features of R. typhiSca1 (RT0015, YP_066986), Sca2 (RT0052, YP_067021), Sca3 (RT0438, YP_067397), Sca4 (RT0485, YP_067439), and Sca5 (RT0699, YP_067640). N-terminal circles depict predicted (SignalP) and/or experimentally-supported (PhoA fusion assay) sec dependent signal sequences. Divergent repeat regions [77] and other identified motifs are colored coded for Sca2, Sca3 and Sca4. B) Comparative analysis of Sca1-Sca5 across 16 rickettsia genomes. Dashed box encloses the R. typhi Scas. Phylogeny at left is based on whole genome analysis [82], with rickettsial groups as follows: red, ancestral group; aquamarine, typhus group; blue, transitional group, brown, spotted fever group. Principal host vectors (tick, flea, louse, mite) for each taxon are illustrated. Green boxes depict passenger domains (as illustrated in A) associated with an AT domain, with the length of each passenger given in amino acids. Skull and crossbones represent pseduogenes. Black boxes depict sca gene fragments encoded within the R. prowazekii str. Madrid E genome (all of which have a conserved downstream ORF encoding an AT domain). Accession numbers for all sequences are provided in Figure S1.
Sca gene transcription during in vitro R. typhi growth and in vivo protein expression
We investigated possible differential transcription of sca genes during L929 cell infection. Of the five sca genes annotated in the R. typhi str. Wilmington genome, only sca4 and sca5 were known to be expressed at the transcript level before this study. All five sca gene transcripts were detected in total RNA extracted from L929 fibroblasts infected for 0–120 hours (Figure 3A). This complements data from a previous study in which sca2, sca4 and sca5 were identified in a genome-wide screen for temperature-shifted genes in vitro
[38]. In general, a decrease in expression was observed within 1 h of infection and median expression levels near to or above initial infection were observed by 120 h (Figure 3A). Rickettsiae were actively growing over the course of the experiment (Figure 3B).
Figure 3
Expression analysis by real-time RT-PCR of Sca genes during L929 cell infection and immunofluorescence assays of Sca protein expression in C. felis and rat spleens.
RNA was extracted from R. typhi infected L929 cells at different time points as described and analyzed by multiplex real-time qPCR for expression of Sca, rpsL and GAPDH genes. A) Transcript abundance of each Sca gene was normalized to rpsL transcript abundance and B) rickettsial burden (rpsL: GAPDH) confirmed increased infection over time. The results represent data from 3 experiments with each gene analyzed in duplicate. C) Cat fleas were housed in an artificial dog and fed uninfected or R. typhi infected whole sheep's blood for 48 h.; they were then fed uninfected blood for 8 days. Capsules were placed at −20°C to immobilize fleas before placing them in 3% PFA overnight. Fleas were embedded in OCT media, frozen and cryosectioned. Sections were labeled with anti-R. typhi rat immune serum (Alexa488-conjugated anti-rat secondary Ab – green), anti-serum to the sca protein indicated on the left (Alexa594-conjugated anti-rabbit secondary Ab – red) and mounted in VectaShield medium with DAPI (blue) to counterstain DNA. Arrowheads point to examples of positively stained rickettsiae. Bar = 5 µm. D) Spleens were harvested from 9 day infected female Sprague-Dawley rats and fixed and embedded as described. Sections (5 µm) were stained with AlexaFluor 532-labeled anti-R. typhi rat immune serum (red), AlexaFluor 350-labeled anti-serum to the sca protein indicated on the left (blue) and propidium iodide (green) to counterstain DNA (not shown). Sections were mounted in VectaShield medium. Arrowheads indicate examples of positively labeled rickettsiae.
Expression analysis by real-time RT-PCR of Sca genes during L929 cell infection and immunofluorescence assays of Sca protein expression in C. felis and rat spleens.
RNA was extracted from R. typhi infected L929 cells at different time points as described and analyzed by multiplex real-time qPCR for expression of Sca, rpsL and GAPDH genes. A) Transcript abundance of each Sca gene was normalized to rpsL transcript abundance and B) rickettsial burden (rpsL: GAPDH) confirmed increased infection over time. The results represent data from 3 experiments with each gene analyzed in duplicate. C) Cat fleas were housed in an artificial dog and fed uninfected or R. typhi infected whole sheep's blood for 48 h.; they were then fed uninfected blood for 8 days. Capsules were placed at −20°C to immobilize fleas before placing them in 3% PFA overnight. Fleas were embedded in OCT media, frozen and cryosectioned. Sections were labeled with anti-R. typhirat immune serum (Alexa488-conjugated anti-rat secondary Ab – green), anti-serum to the sca protein indicated on the left (Alexa594-conjugated anti-rabbit secondary Ab – red) and mounted in VectaShield medium with DAPI (blue) to counterstain DNA. Arrowheads point to examples of positively stained rickettsiae. Bar = 5 µm. D) Spleens were harvested from 9 day infected female Sprague-Dawley rats and fixed and embedded as described. Sections (5 µm) were stained with AlexaFluor 532-labeled anti-R. typhirat immune serum (red), AlexaFluor 350-labeled anti-serum to the sca protein indicated on the left (blue) and propidium iodide (green) to counterstain DNA (not shown). Sections were mounted in VectaShield medium. Arrowheads indicate examples of positively labeled rickettsiae.Initial analysis using the OperonDB algorithm predicted that sca3, sca4 and sca5 genes had a probability of co-occurring in the same operon with a confidence of at least 73 (Table S4); however, analysis using the updated algorithm resulted in greatly reduced probabilities that any of these sca genes was located within an operon. However, sca3, sca4, and sca5 are each positioned downstream of other open reading frames (Figure 4A). Therefore, we hypothesized that each gene cluster was an operon and that each sca was co-transcribed with the upstream genes.
Figure 4
Transcriptional analysis of putative sca operons by RT-PCR.
RNA was extracted from 72 h-infected L929 fibroblasts and RT-PCR with primers designed to amplify the regions indicated in (A). A) Schematic of putative sca operons. Blue bars indicate regions successfully amplified, red bars indicate regions that could not be amplified. B) RT-PCR amplification of regions between ORFs in putative sca operons. Left panel – lanes 2 thru 4 – RT-PCR amplification of the 400 bp region within the encoded passenger domain of sca3 used in time course analyses ; lanes 5 thru 7 – amplification of Lon-sca3 co-transcript. Right panel: lanes 2 thru 4 – amplification of sca4 region used in time course analyses; lanes 5 thru 7 – amplification of tlcD-sca4 transcript. C) Analysis of sca5 operon; labels indicate genes spanned by primers. RT – reverse transcriptase reaction, NRT – no reverse transcriptase, D – DNA control.
Transcriptional analysis of putative sca operons by RT-PCR.
RNA was extracted from 72 h-infected L929 fibroblasts and RT-PCR with primers designed to amplify the regions indicated in (A). A) Schematic of putative sca operons. Blue bars indicate regions successfully amplified, red bars indicate regions that could not be amplified. B) RT-PCR amplification of regions between ORFs in putative sca operons. Left panel – lanes 2 thru 4 – RT-PCR amplification of the 400 bp region within the encoded passenger domain of sca3 used in time course analyses ; lanes 5 thru 7 – amplification of Lon-sca3 co-transcript. Right panel: lanes 2 thru 4 – amplification of sca4 region used in time course analyses; lanes 5 thru 7 – amplification of tlcD-sca4 transcript. C) Analysis of sca5 operon; labels indicate genes spanned by primers. RT – reverse transcriptase reaction, NRT – no reverse transcriptase, D – DNA control.We tested the above hypothesis, despite the low prediction probabilities, using RT-PCR to amplify the indicated regions (Figure 4A). Co-transcription of Sca3 with the gene encoding the protease Lon and Sca4 with one of four ATP/ADP translocases, tlcD, were detected (Figure 4B) indicating that both of these genes comprise a transcriptional unit with their nearby genes respectively. Co-transcription data for the putative Sca5 operon is less conclusive. We were unable to detect a full transcript spanning the ihfA to Sca5 genes (data not shown) and therefore designed primers to amplify 5 different regions that would span the entire putative operon. Transcripts of Sca5-spoTd and spoTd-RT0701, are detected suggesting that these 3 genes are co-transcribed. While an amplicon for RT0701-RT0702 is detected, a transcript spanning RT0702 and spoTd could not be amplified (Figure 4C). Multiple primer combinations were tested for the former combination without success.To investigate Sca protein expression we generated a rabbit polyclonal antibody (pAb) against a peptide within the passenger domain of each Sca. Specificity of the serum directed to each Sca was confirmed by immunoblot against lysates from uninfected and infected L929 cells (Figure S2) and sections of infected and uninfected L929 cells (Figure S3 and S4). Sca5 staining is observed in the cytoplasm and the outer membrane on many rickettsiae (Figure S3). Some labeling of host cell chromatin was also observed. Although staining is weak, Sca 1 is observed in the rickettsial cytoplasm and in association with the membrane of rickettsiae. Staining is also observed on the outer membrane (Figure S3), the host cell cytoplasm and chromatin (data not shown). Sca2 and Sca3 staining is observed on the outer membrane, host chromatin or cytoplasm of very few rickettsiae (Figure S3). Sca4 staining shows a similar pattern to the other Scas with labeling of the outer membrane, periphery and rickettsial cytoplasm (Figure S3).To investigate possible variability of Sca expression within organisms that maintain the infection in an enzootic cycle we infected rats and cat fleas. Rats serve as a primary reservoir for murine typhus in urban environments. Infection is self-limiting, however, splenic dissemination occurs a week into infection [39]. The cat flea, C. felis, is suspected of being one of the primary vectors of R. typhi transmission to small mammals and humans in the United States [40]. No staining was observed in sections from uninfected fleas or uninfected rat spleens (Figures S5 and S6). Scas3-5 are expressed in rickettsiae in various organs of 14-day infected fleas including the midgut and developing eggs (Figure 3C); staining for Scas 1 and 2 were not conclusive. Positive staining was distinctly detected for Scas1 and 5 by immunofluorescence staining of cryosections of spleens from 9-day infected Sprague Dawley rats (Figure 3D) indicating that they are expressed during mammalian infection. However, staining for Sca4 was diffuse and not clearly detected (data not shown).
Sca protein expression on the surface of R. typhi
Expression of the Scas on whole rickettsiae was investigated using flow cytometry and negative stain IEM of whole rickettsiae. For flow cytometry, rickettsiae were stained with antibodies prior to fixation to avoid permeabilization so that only surface-bound Scas were detected. While the majority of rickettsiae only stained positive for the anti-R. typhi sera, a small proportion (1.58–3.82%) also stained positive for the respective Sca protein (Figure S7A). Non-specific staining of rickettsia and any co-purified host components was minimal (Figure S7B). To confirm surface expression of the Sca proteins, whole rickettsiae placed onto grids were labeled with anti-Sca sera followed by colloidal gold conjugated anti-rabbit IgG secondary antibody. Immunogold labeling for each Sca protein is observed on the surface of negatively stained, intact rickettsia with clusters of gold particles indicating positive staining (Figure 5).
Figure 5
Immunogold electron microscopy of Sca expression on intact, negative stained R. typhi.
A suspension of rickettsiae was placed on grids and allowed to dry. Samples were labeled with antibodies against a Sca protein A) Sca1, B) Sca2, C) Sca3, D) Sca4 and E) Sca5 and negatively stained for contrast. Bar = 0.25 um.
Immunogold electron microscopy of Sca expression on intact, negative stained R. typhi.
A suspension of rickettsiae was placed on grids and allowed to dry. Samples were labeled with antibodies against a Sca protein A) Sca1, B) Sca2, C) Sca3, D) Sca4 and E) Sca5 and negatively stained for contrast. Bar = 0.25 um.
Discussion
Surface proteins of obligate intracellular bacteria comprise a crucial interface for pathogen-host interactions by mediating the initial attachment and infection of host cells and subsequent contact with host cytosolic proteins to promote bacterial survival and replication through the subversion of host processes. In this report, we investigated the surface proteome of R. typhi str. Wilmington, first by bioinformatic analyses to predict subcellular localizations and the presence of classical and non-classical secretion signals, then by selective labeling and purification of surface proteins for identification. We consequently focused on characterizing the Sca family of autotransporters.Outer membrane proteins (OMPs) are immunodominant in rickettsial infections and immunization with these antigens has been shown to confer protection from lethal challenge in animal models [8], [9], [10], [11], [41]. Similarly, the Major Surface Proteins (MSPs) of Anaplasma spp. and the Outer Membrane Proteins (OMPs) of Ehrlichia spp. are also identified as immunogenic rickettsial proteins [31], [32], [42]. Rickettsial OMPs form the basis for antigenic relationships between and within phylogenetic groups and allow for some cross-protection from infection by multiple species. A major basis for the antigenic similarity of Rickettsia spp. is the presence of the complete gene for the 120 kDa outer membrane protein B (Sca5) in all species [15]. Bioinformatic analyses place Sca5 and the similar protein OmpA, which is not encoded in the genomes of TG Rickettsia, into the superfamily of proteins known as the type V secretion system (TVSS) or autotransporter family [43].Many of the proteins identified on the surface of R. typhi (Table S3) have homologs that were similarly identified on the surface of other rickettsiae or other families of Gram-negative bacteria. These include the chaperone proteins GroEL and DnaK and enzymes pyruvate decarboxylase and fumarase (Table S3). Furthermore, proteins experimentally determined to be surface localized were identified in this study but many currently have no assigned function (i.e. hypothetical proteins) in the context of rickettsial infection. Homologs of proteins predicted to be cytoplasmic but experimentally localized to the surface and cytoplasm of other Gram-negative and Gram-positive bacteria [34], [36], [44] are detected on the surface of rickettsiae in this study [30], [31], [33]. Little is known about the significance of such proteins on the bacterial surface or the mechanism(s) by which they are targeted to the surface. However, it is becoming understood that such proteins have alternative functions when surface-exposed and have thus been termed moonlighting proteins [45] For example, when at the bacterial surface, the chaperone protein DnaK of Mycobacterium tuberculosis has been shown to bind plasminogen, stimulate chemokine synthesis in dendritic cells and compete with the human immunodeficiency virus (HIV) coreceptor chemokine receptor 5 (CCR5) [46], [47], [48]. Elongation factor-Tu (EF-Tu) and the E1 beta subunit of the pyruvate dehydrogenase (Pdh) of M. pneumoniae has been shown to bind fibronectin [49] and a fungal dihydrolipoamide dehydrogenase, the E3 subunit of Pdh, has been characterized as an acetyltransferase both when not in the cytoplasmic environment [50].Few rickettsial surface-exposed proteins have been investigated; however, certain Sca proteins have been localized to the bacterial surface [23] or inferred to be located there based on antibody inhibition of infection or conference of adhesive and invasive properties to recombinant E. coli
[19], [20], [51]. We were able to detect the recently characterized RT0522 conserved hypothetical protein, which encodes a phospholipase A2 homolog that was found to be secreted from the bacterium into the host cytosol [52]. Most of the algorithms used in this study detected no signal peptide in RT0522 and predicted it to be localized to the cytoplasm; however pSORTb v3.0 predicted it to be extracellular. This may be evidence that other hypothetical proteins identified on the surface but predicted by consensus to be cytoplasmic and lacking detectable signal peptides, may in fact have extracellular functions as effector proteins. It is also an indication that the algorithms, such as SubcellPredict, SLPLocal and SubLoc v.1 [53], [54], [55] (data not shown), which are trained on free-living model Gram-negative and Gram-positive bacteria, may not accurately identify the signals and motifs utilized by rickettsiae to target proteins to the surface. Discrepancies between the number of predicted outer membrane or extracellular proteins and the number actually identified may be due to low abundance of some peptides and or inaccessibility to the biotinylation reagent. It is predicted that Sca5 comprises the S-layer of rickettsiae and constitutes 15% of the total protein mass [56], [57] and might block many potential interactions. The properties of the labeling reagent must also be taken into account. The N-hydroxysulfosuccinimide (NHS) group of Sulfo-NHS-SS-biotin specifically reacts with the ε-amine of lysine residues and the reactions also proceed at a wide range of temperatures. A more comprehensive analysis of the surface proteome might be compiled by performing reactions across the range of temperatures and using similar biotinylated reagents with spacer arms of differing lengths and reactivity with different groups.The Sca family of autotransporters drew our focus because their primary involvement in adherence and invasion is becoming more apparent but predicted functional domains within a few of them point to other roles [20], [51], [58]. Multi-functional autotransporters are not uncommon and further characterization of this family may define distinct extracellular and intracellular roles. For instance, R. parkeri Sca2 is observed to act as an actin-assembly mediator that mimics the eukaryotic formin proteins. Furthermore, it is the first bacterial protein to be identified to functionally and perhaps structurally mimic a domain that was previously thought to be solely eukaryotic [23]. Interestingly, this is the second instance of a rickettsial protein containing a domain with a nearly strict eukaryotic distribution. Similarly, the Sec7-domain-containing proteins (RalF) encoded within Rickettsia and Legionella species are unknown from other prokaryotes [59].As stated above, all of the Scas in R. typhi were identified on the surface when considering the biotin labeling (Table S3), negative staining electron microscopy (Figure 5) and flow cytometry data collectively (Figure S7). All Sca proteins except Sca4 were predicted to have signal peptides and be localized to the outer membrane or be extracellular (Tables S1 and S2). The prediction of a signal peptide in Sca4 by SecretomeP supports evidence that the first 200 bp of Sca4 encode sufficient information to direct secretion of a phoA fusion peptide across the inner membrane into the periplasm (unpublished data). Further, Sca4 is known to generate an antibody response to infection [60] and others have shown, as we have here, that Sca4 is under positive selection [15]. It has been posited that Sca4 and the similarly AT domain-less Sca9 may be exported through the AT domain of another Sca. However a quick analysis for possible signals based on homology among the Scas returned no supporting data for this hypothesis. Further investigation of the function and secretion mechanism of Sca4 is necessary.Phylogeny estimation of Sca1, Sca2, Sca4, and Sca5 proteins resulted in trees that all differ from the Rickettsia species tree (Figure S1). This is not unexpected, as phylogenies based on single rickettsial genes and proteins rarely agree with those estimated from multiple molecules [61]. Notwithstanding, the Scas are large proteins and contain many variable sites, which should provide enough information for robust phylogeny estimation. However, the extracellular location of the passenger domains likely orchestrates selective pressures on these proteins that render them evolutionarily divergent from the species historical trajectory. Indeed, previous studies have identified positively selected sites within the Sca passenger domains [15], [62]. For Sca1, Sca2 and Sca5, we estimated separate trees based on the passenger domain and AT domain to determine conflicting phylogenetic signals within these domains (Figure 6A–C). In each case, the trees estimated for the AT domain were much more consistent with the rickettsial species tree (Figure 1B), while the trees generated from the passenger domains clearly illustrate Sca protein diversification inconsistent with rickettsial species phylogeny.
Figure 6
Evolution of rickettsial surface cell antigens (Scas).
All datasets were aligned with MUSCLE v3.6 [74], [75] and analyzed under maximum likelihood using RAxML [76] (see text for details). Branch support was assessed with 1000 bootstrap pseudoreplications, with values in intervals of 10 (>50% only) depicted with colored circles that are explained at the bottom left. Taxon color scheme according to major rickettsia group is explained in the Figure 2 legend. (A–C) Comparison of the phylogenies estimated for the passenger (left) and AT domains (right) for (A) Sca1, (B) Sca2 and (C) Sca5. For each tree, numbers above the line depict the total number of positions for each domain alignment, with numbers under the line representing the total number of informative sites within the alignment. The phylogenies of the AT domain better corroborate the rickettsia species tree (see Figure 2), thus the position of the taxa correspond with these trees. The taxa in the trees generated from the passenger domain are connected to their corresponding partner in the AT domain trees via dashed lines, with orange illustrating the major differences between the domain-generated trees. (D) Phylogeny estimation of an expanded set of rickettsial Sca4 proteins. The yellow box encloses the only known plasmid-encoded Sca4 proteins: pREIS1 and pREIS3 from REIS, rRPR from R. peacockii
[83]. The gray arrow illustrates the replacement of the phylogram portion of the tree with the corresponding cladogram to account for the minimal divergence across the majority of SFG Rickettsia Sca4 proteins.
Evolution of rickettsial surface cell antigens (Scas).
All datasets were aligned with MUSCLE v3.6 [74], [75] and analyzed under maximum likelihood using RAxML [76] (see text for details). Branch support was assessed with 1000 bootstrap pseudoreplications, with values in intervals of 10 (>50% only) depicted with colored circles that are explained at the bottom left. Taxon color scheme according to major rickettsia group is explained in the Figure 2 legend. (A–C) Comparison of the phylogenies estimated for the passenger (left) and AT domains (right) for (A) Sca1, (B) Sca2 and (C) Sca5. For each tree, numbers above the line depict the total number of positions for each domain alignment, with numbers under the line representing the total number of informative sites within the alignment. The phylogenies of the AT domain better corroborate the rickettsia species tree (see Figure 2), thus the position of the taxa correspond with these trees. The taxa in the trees generated from the passenger domain are connected to their corresponding partner in the AT domain trees via dashed lines, with orange illustrating the major differences between the domain-generated trees. (D) Phylogeny estimation of an expanded set of rickettsial Sca4 proteins. The yellow box encloses the only known plasmid-encoded Sca4 proteins: pREIS1 and pREIS3 from REIS, rRPR from R. peacockii
[83]. The gray arrow illustrates the replacement of the phylogram portion of the tree with the corresponding cladogram to account for the minimal divergence across the majority of SFG Rickettsia Sca4 proteins.Recombination between Sca orthologs from different species has also been demonstrated to play a role in the diversification of these proteins [62]. While recombination has been observed experimentally in Rickettsia
[63], [64], its contribution to rickettsial diversity is currently not fully understood. Notwithstanding, all rickettsia genomes encode enzymes involved in homologous recombination [65], so it is likely that active recombination occurs across species and strains. Insight into how recombination may shape Sca protein evolution is provided by a phylogeny estimation of an expanded set of Sca4 proteins (Figure 6D). Without an AT domain, contrasting phylogenetic signals within Sca4 proteins could not be determined as for the other Scas described above. However, the identification of an ancestral lineage of plasmid encoded Sca4 (Figure 6D, yellow box) proteins illustrates the inclusion of these proteins in the rickettsial mobilome (all the mobile genetic elements in the genome), allowing for the dissemination of Sca variants via lateral gene transfer (LGT). Other studies have reported the presence of Sca ORFs and fragments present on diverse rickettsial plasmids [66], [67] further supporting the role of LGT as a facilitator of mosaicism via recombination across divergent Sca orthologs (and possibly paralogs). Like the phylogenies estimated from the other Scas, the Sca4 tree does not corroborate the rickettsial species tree, and it is likely that all Scas are subject to positive selection and recombination. These selective forces, which are counter to the evolutionary history of rickettsia, are problematic for inferring species relatedness [62]. Thus, despite their usefulness as rickettsia-specific diagnostic markers, as well as their increasing accumulation from published studies, the Scas should be avoided for phylogenetic inference and classificatory purposes.Transcriptional analysis in non-phagocytic cells demonstrates that sca transcription is sustained during infection (Figure 3A). Although we are unable to correlate sca transcription with protein levels at present, the constitutive expression of all sca genes points toward essential functions. Moreover, the co-transcriptional analyses (Figure 4) suggest that scas and the genes that are co-transcribed may function in the same processes or are part of regulatory mechanisms important for their expression. The inability to detect ihfA-RT0702 and RT0702-spoTd transcripts while detecting RT0702-RT0701 and RT0701-spoTd transcripts in the proposed sca5-ihfA operon indicates that the consecutive genes are not expressed at the same level. It is becoming understood that the concept of multiple successive genes under the control of a single promoter - that is operons - does not inherently mean that all genes are equally expressed [68]. This phenomenon, termed operon polarity, may be explained by the presence of internal transcription terminators, the activity of small RNAs (sRNAs) or by riboswitches within operons that modulate transcription in response to metabolite binding [69].We attempted to detect all of the Sca proteins for R. typhi in the spleen tissue, however, in these experiments we consistently observe expression for Scas 1 and 5. This may be specific to the rat we used in this particular experiment or the time point we chose to assay (9 days). Given animal to animal variation as well as time-dependent expression of many rickettsial proteins, we do not exclude the possibility that the remaining Scas play an important role during mammalian infection. While we show that the proteins are expressed in vivo (Figure 3B–C), we are unable to quantitatively assess this expression and correlate it with different stages of growth or infection. However, the immunogold labeling of host cell cytoplasm and chromatin may suggest translocation of the rickettsial proteins to the cytosol. Probing infected cells with pre-immune sera or uninfected cells and tissues with Sca immune sera show no cross-reactivity with host cell components. Proteins may be expressed but not required for infection of a particular host or cell type. Rather, the bacteria will be prepared, upon exiting a cell, to infect an endothelial cell or the flea midgut epithelium. Further characterization of these proteins and identification of interacting host proteins will determine where and how these proteins function and their importance in infection of mammalian and arthropod hosts.
Materials and Methods
Ethics statement
This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee (IACUC protocol no. 1108009) of the University of Maryland, Baltimore (assurance number A3200-01).
Growth, maintenance and isolation of R. typhi
Rickettsiae were grown and maintained as previously described [38]. Low passage mouse fibroblast cells (L929, ATCC CCL1, ATCC, Manassas, VA) were grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 5% FBS at 37°C and 5% CO2 in 150 cm2 vented lid flasks. When the cells were 80% confluent they were infected with R. typhi str. Wilmington at a multiplicity of infection (MOI) of 10. To harvest rickettsiae, infected L929 cells were scraped into the media then sonicated at setting 6.5 twice for 30 seconds using a Sonic Dismembranator (Fisher Scientific, Pittsburgh, PA). The lysates were centrifuged at 1000× g for 5 min to remove large host cell material. The supernatant was centrifuged at 14,000× g for 10 min and the pellets, containing rickettsiae, resuspended in 1 mL SPG buffer (218 mM sucrose, 3.76 mM KH2PO4, 7.1 mM K2HPO4, 4.9 mM potassium glutamate). The rickettsiae were placed over a 20% OptiPrep Density Gradient medium:SPG bed (Sigma-Aldrich, St. Louis, MO) and centrifuged at 14,000× g for 10 min. The pellets were washed twice in SPG buffer and centrifuged at 14,000× g; rickettsiae were quantified using the BacLight Live/Dead assay (Molecular Probes, Eugene, OR) as per the manufacturer's instructions and stored at −80°C. For flow cytometry, infected host cells were scraped into the media, centrifuged at 14,000× g for 10 min then resuspended in 5 ml SPG buffer. Suspended host cells were ruptured by passage through a 27-gauge needle three times to disrupt host cell membranes while maintaining rickettsial membrane integrity and lysates were centrifuged at 1000× g for 5 min. Supernatants were placed over a 20% OptiPrep:SPG bed and centrifuged as above. Bacterial pellets were resuspended in 100 µl SPG.
Biotinylation of surface proteins and NeutrAvidin affinity purification of labeled proteins
Sub-confluent monolayers of L929 fibroblasts were grown in 150 cm2 vented-lid flasks and infected with renografin-purified rickettsiae at an MOI of 10 for 48 h when most cells are heavily infected. Two flasks were used for each treatment. Rickettsiae were partially purified as described above, washed three times in ice-cold PBS (pH 8.0) and pelleted using centrifugation at 8,000× g for 3 min at 4°C. Pellets were resuspended in 960 µl of PBS with 80 µl of 10 mM EZ-Link Sulfo-NHS-SS-Biotin (Pierce Thermo Scientific, Rockford, IL) and incubated on ice for 30 min. As a negative control, rickettsiae were resuspended in PBS only to assess background affinity purification. As a control for background host material, a mock partial purification was performed on uninfected L929s, and the resulting pellets were labeled as described above. Free biotin was quenched by washing rickettsiae once in 50 mM Tris-HCl (pH 7.5–8.0) followed by two washes in ice-cold PBS and resuspended in RIPA buffer (25 mM Tris-HCl [pH 7.6], 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate) supplemented with 1X Halt Protease Inhibitors (Pierce Thermo Scientific). Rickettsiae were lysed by bead beating with ≤106 µm glass beads (Sigma-Aldrich, St. Louis, MO). Beads were removed by centrifugation at 500× g for 3 min and cell debris pelleted by centrifugation at 16,000× g for 10 min. Supernatants were stored at −80°C until needed.Labeled proteins were purified by affinity purification over columns containing NeutrAvidin Agarose resin (Pierce Thermo Scientific) as previously described [42] with modifications. Briefly, columns were equilibrated with three column volumes of wash buffer A (25 mM Tris-HCl pH 7.6, 0.15 M NaCl, 0.5% NP-40, 0.5% sodium deoxycholate, 0.05% SDS). Biotinylated samples were allowed to enter the resin bed and incubated at room temperature for 10 min. Unbound proteins were washed away with two column volumes of buffer B-1 (25 mM Tris-HCl pH 7.6, 0.65 M NaCl, 0.1% NP-40), then one volume of buffer B-2 (25 mM Tris-HCl pH 7.6, 1.15 M NaCl, 0.1% NP-40) followed by one volume of Tris-HCl buffer (25 mM Tris-HCl, 0.15 M NaCl). Washes were collected in 0.5 ml fractions and stored on ice. Captured proteins were eluted with two volumes of 5% β-mercaptoethanol-PBS. The eluates were pooled and total protein determined using a BCA assay (Pierce Thermo Scientific). Eluates were concentrated by filtration using Amicon-Ultra prior to addition of 2X SDS sample buffer (Invitrogen, Carlsbad, CA) then stored at −80°C.
Proteomic and bioinformatic analyses
NeutraAvidin (Pierce Thermo Scientific) affinity purified proteins were separated on 4–20% Tris-glycine gels (Invitrogen) and stained for total protein visualization using PS-Blue (BridgePath Scientific, Frederick, MD). Proteins from several regions were identified using LC-MS/MS at the University of Maryland Baltimore Proteomics Core Facility as described fully in the supplementary methods. Briefly, Coomassie-stained protein bands were excised, dehydrated, digested and de-salted in preparation for LC MS/MS. MS/MS spectra were searched against a uniprot mouse database (uniprot release number 2010_05; 64,389 sequences) and a Rickettsia typhi database (uniprot release number 2010_05; 1,676 sequences) using Sorcerer-SEQUEST (SageN Research, Milpitas, CA). The quality of peptide and protein assignments was assessed using PeptideProphet and ProteinProphet. Proteins with probabilities ≥0.9 were accepted as true positive identifications. Proteins identified by one unique peptide were manually verified. Identified proteins were then analyzed for signal sequences and motifs that predict subcellular localization. Signal peptides were detected using the SignalP 3.0 and LipoP 1.0 servers which predict the presence and location of signal peptide cleavage sites in peptide sequences [70], [71]. SignalP predictions are based on a combination of artificial neural networks (NN) and hidden Markov models (HMM) while LipoP predictions distinguish between lipoprotein signal peptides, other signal peptides and N-terminal membrane helices. The Phobius server [72] was also utilized primarily for the prediction of signal peptides in an amino acid sequence. To predict subcellular localization predictions for peptides identified on the surface, we employed the pSORTb v3.0.2 server and the predictive program SOSUI-GramN [25], [26], [27]. Pre-computed genome results were downloaded from the pSORTb server, which uses several analytical methods for predicting a final localization including prediction of extracellular proteins. The R. typhi predicted proteome was submitted to the SOSUI-GramN software which uses only physicochemical factors of the total sequence and the N- and C-terminal signal sequence to predict protein localizations in Gram-negative bacteria. The SecretomeP 2.0 server [29] was utilized to generate predictions of protein secretion not initiated by signal peptides (i.e. non-classically secreted proteins). This algorithm also integrates information on post-translational and localization aspects of the protein from other feature prediction servers. CoBaltDB [24], a comprehensive database that compiles prediction outputs from multiple sources regarding complete prokaryotic proteomes, was also utilized for comparison of subcellular localization predictions.
Comparative analysis of rickettsial Sca proteins
Orthologs of the five Scas encoded with the R. typhi genome were extracted from the PATRIC web site [73]. Initially, only protein sequences from 16 completely sequenced rickettsia genomes were included: R. bellii str. RML369-C; R. bellii str. OSU 85 389; R. canadensis str. McKiel; R. typhi str. Wilmington; R. prowazekii str. Madrid E; R. prowazekii str. Rp22; R. felis str. URRWXCal2; R. akari str. Hartford; Rickettsia endosymbiont of Ixodes scapularis (REIS); R. massilae str. MTU5; R. peacockii str. Rustic; R. rickettsii str. Sheila Smith; R. rickettsii str. Iowa; R. conorii str. Malish 7; R. sibirica str. 246; R. africae str. ESF-5. Except for split ORFs in R. prowazekii genomes, pseudogenes (as detected using tblastn searches across all genomes) were not included in the analyses. Sequences for each Sca orthologous group were aligned using MUSCLE v3.6 [74], [75] with default parameters (full annotated alignments are available in Supplement 1). Phylogenies were estimated for Sca1, Sca2, Sca4, and Sca5 under maximum likelihood using RAxML [76] (Figure S2). A gamma model of rate heterogeneity was used with estimation of the proportion of invariable sites. Branch support was evaluated from 1000 bootstrap pseudoreplications. For Sca1, Sca2, Sca3, and Sca5, the alignments were divided into the passenger domain and AT domain. Phylogenies of each domain from Sca1, Sca2 and Sca5 were estimated. For Sca4, sequences from additional rickettsial species (and plasmids) were included in a larger analysis, with alignment and phylogeny estimation as described above. Repeat regions within Sca4 and the passenger domains of Sca1, Sca2, Sca3, and Sca5 were predicted using HHrepID [77].
L929 cell infection time course, RNA extraction and cDNA synthesis
Sub-confluent monolayers of L929 cells in 6-well plates were infected with an MOI of 10 R. typhi str. Wilmington for 0, 5, 15 or 30 min and 1, 8, 24, 48 and 120 h. Rickettsiae-infected cells were washed briefly with cold PBS and immediately disrupted with the lysis buffer, Buffer RLT, the first step in the total RNA extraction procedure using the AllPrep DNA/RNA kit (Qiagen, Valencia, CA). Total RNA was DNase-treated with the RNase-Free DNase Set (Qiagen) then cleaned up and concentrated with the RNeasy MinElute Cleanup kit (Qiagen). DNA removal was confirmed using the SuperScriptIII One-step RT-PCR with Platinum Taq kit (Invitrogen, Carlsbad, CA) and cDNA was made using the SuperScriptIII First-Strand Synthesis SuperMix for qRT-PCR kit (Invitrogen).
Real-time quantitative PCR
Expression of the Sca genes was analyzed as previously described [78] with some modifications. Briefly, gene expression was detected using LUX primers (Invitrogen) in a multiplex format. Primers for rpsL, GAPDH and one of the Sca genes were included in each PCR reaction for amplification using the Platinum Quantitative PCR SuperMix-UDG kit (Invitrogen). Reactions were performed in duplicate on a MX3005P Stratagene real-time thermal cycler. Primer pairs were designed using the D-LUX Designer (Invitrogen) and chosen based on a melting temperature of 55°C and optimal amplicon size of 90–200 bp. Primer pairs used in this study are listed in Table 1. Cycling conditions were as follows: one cycle of 50°C for 1 h; one cycle of 95°C for 10 min; and 40 cycles of 95°C for 30 s, 60°C for 1 min, and 72°C for 30 s followed by a disassociation cycle of 95°C for 1 min, a 30-s hold at 55°C, and a ramp up at 0.1°C/s to 95°C for a 30-s hold. Data were imported and analyzed as described in Ceraul et al 2007. Cycle thresholds above 45 were excluded from analysis and the results from three experiments were combined and the median normalized expression values were calculated.
Table 1
Primers designed for real-time quantitative PCR analysis of sca genes, rpsL and mouse GAPDH expression during R. typhi infection of mouse fibroblast cells and co-transcription of genes in putative sca operons.
Target/primer name
Sequence
Direction
Label
Real-time qRT-PCR analysis of infection time course in L929 cells
rpsL/AZ5250
AGGTTCCTGACCTTCCTGGTGT
FWD
None
RT rpsL_340RL†
CGTTCGTGGCACCATAACGTGAAcG
REV
JOE
mGAPDH/GAPDH-mouse_204FL†
CGTGACCAGTATGACTCCACTCAcG
FWD
FAM
mGAPDH/AZ5987
CTGGAAGATGGTGATGGGCTTC
REV
None
sca1/AZ5915
AGGTATGGGAAGTCACGAGATGG
FWD
None
sca1/R. typhi sca1_3078RL*
cggaaGACTTTAGTACCTAAAATTCcG
REV
Alexa594
sca2/R. typhi sca2_1827FL*
cggtgGGCAGAATTATTTATCACcG
FWD
Alexa594
sca2/AZ5918
GAGCGGAAGTGCCCAGATTT
REV
None
sca3/AZ5920
TAGGACAAATAGGAACGCCACAAA
FWD
None
sca3/R. typhi sca3_3123RL*†
cggaaTAATACCACCTCCAGTTCcG
REV
Alexa594
sca4/R. typhi sca4_703FL*†
cggcCCTATAAAACTTGATAAAGCcG
FWD
Alexa594
sca4/AZ5922
GTGGTTTACCATTTGGCCCTTC
REV
None
sca5/R. typhi sca5_751FL*†
cggcTAATACTACTCCTGATGCcG
FWD
Alexa594
sca5/AZ5924
AATTTACCAGTACCGTCTCTTCCA
REV
None
Co-transcription RT-PCR analyses
Lon-sca3 R3/AZ6423
TGGCTGTGCTTTGTTTACTACTATT
FWD
N/A
Lon-sca3 R3/AZ6424
TTTGACTTACTTCAACACCACCAAA
REV
N/A
sca4-tlcD/AZ6502
GCGATAACAATAGGTGCTATTCAA
FWD
N/A
sca4-tlcD/AZ6503
ATCTTGATTACTCAAAAAAGCACGG
REV
N/A
Sca5-spoTd/AZ6504
GCTTTGGATGTAGTTAAGAATTCTC
FWD
N/A
Sca5-spoTd/AZ6505
AGCAGTAATAACCGAATTTGTAGC
REV
N/A
spoTd-RT0701/AZ6506
TCCTGCGACTTTATCCAAAA
FWD
N/A
spoTd-RT0701/AZ6507
AACTATAATCCTACATGCGATCAAG
REV
N/A
RT0702-spoTd/AZ7162
ACATAGATCTTTAGATTTAACTATAATC
FWD
N/A
RT0702-spoTd/AZ7163
ATGACAAACAATAAGCTCACAAA
REV
N/A
RT0702-RT0701/AZ7164
AGTTACTTTCTCTTCTTGTAACC
FWD
N/A
RT0702-RT0701/AZ7165
ATGACAAACAATAAGCTCAC
REV
N/A
RT0701-ihfA/AZ6510
ATGACTATTACAAAAAACAAAA
FWD
N/A
The lowercase letters on the 5′ end are included for hairpin formation.
The 3′ lowercase letter is the labeled base.
The lowercase letters on the 5′ end are included for hairpin formation.The 3′ lowercase letter is the labeled base.
Multiple antigen peptide synthesis, antibody production, purification and immunoblotting
Polyclonal antibodies were raised against predicted immunogenic peptides from each of the Sca proteins. Complete protein sequences for Sca proteins 1–4 (accession numbers YP_066986, YP_067021, YP_067397 and YP_067439 respectively) were submitted to Custom Peptide/Antibody Services (Invitrogen) for peptide design based on antigenicity, residue accessibility and hydrophilicity predictions. The following peptide sequences were chosen for use in the custom antibody PolyQuik rabbit protocol (Invitrogen): Sca1 - 753
NYNKGEKNYDSDFK
767 (Sca1753–767), Sca2 – 496
LNNQNVQDENNKEW
509 (Sca2496–509), Sca3 – 314
IKGINNEEERLNLK
327 (Sca3314–327), Sca4 – 263
HYEEGPNGKPQLKE
276 (Sca4263–276). All peptides were within the predicted passenger domains of the proteins and were conjugated to form multiple antigen peptides (MAPs) for enhanced immunogenicity. For Sca5, the peptide sequence 651
NDGSVHLTHNTYLI
665 (Sca5651–665) was chosen based on the immunogenicity of the R. prowazekii and R. conorii Sca5 homologs [79], [80]. The Sca5 peptide was also conjugated to form a MAP and used in the Premium Rabbit Protocol (Invitrogen). For all downstream applications, polyclonal rabbit and R. typhi-immune rat sera were purified using the Melon Gel IgG Spin Purification Kit (Pierce Thermo Scientific). The purified sera were eluted at a 10-fold dilution and subsequent dilutions are given with respect to undiluted sera.For immunoblots to determine antibody specificity, pellets of uninfected or R. typhi infected L929 cells were solubilized in 2X LDS loading buffer (Invitrogen) with a reducing agent and boiled for 10 min at 100°C. Samples were run on NuPAGE 4–12% Bis-Tris gels in MOPS buffer or, when blotting for Sca3, 3–8% Tris-Acetate gels in Tris-Acetate buffer (Invitrogen) then transferred to PVDF membranes which were processed following a standard immunoblotting protocol. Membranes were probed with anti-Sca sera diluted 1∶250 and developed with SuperSignal West Pico Chemiluminescent Substrate (Pierce Thermo Scientific).
Rat infections
Infections of 6-week old female laboratory white rats, Rattus norvegicusSprague-Dawley (Charles River Laboratories Inc., Wilmington, MA) were carried out under BSL3 conditions. Rats received intradermal injections of 0.5 mL DMEM supplemented with 15% FBS containing 1×103
R. typhi at the base of the tail. Control rats were injected with media only. Rats were euthanized on day 9 and organs were harvested, cut into pieces (≈0.5 cm3) and placed in fixation buffer [0.05 M phosphate buffer, 0.1 M lysine, 2 mg/mL sodium periodate, 1% paraformaldehyde (PFA)] overnight. The fixation buffer was replaced with a solution of 10% sucrose in phosphate buffer and incubated for 30 minutes at 4°C with occasional shaking; this step was repeated with 20 and 30% sucrose solutions. Tissue samples were embedded in Tissue-Tek Optimal Cutting Temperature (OCT) Compound (Sakura Finetek USA, Inc., Torrance, CA), frozen in a liquid nitrogen/isopentane bath and stored at −80°C. Sections (2–3 µm) were prepared using a Leica CM1900 Cryostat (Leica Microsystems Inc., Bannockburn, IL) and stained as described below.
Flea infections
Infections of membrane-adapted C. felis (HESKA Corp., Loveland, CO) fleas were performed in a feeding apparatus under BSL3 conditions. Fifty fleas were placed into membrane feeding capsules and provided either 4 mL of uninfected or infected whole sheep's blood in a feeding reservoir. For an infection, renografin-purified R. typhi was added to blood for a concentration of 2.5×105 rickettsiae per mL. On day 3, uninfected blood was added to the existing blood in all of the feeding reservoirs. Fleas were harvested at days 3, 5, 10 and 14 post-infection and placed in either 4% PFA or 4F1G fixative (4% PFA, 1% glutaraldehyde, 0.1 M PIPES, 0.1 M sucrose, 2 mM CaCl2) for electron microscopy overnight at 4°C. Fleas fixed in 4% PFA were embedded in Tissue-Tek OCT Compound and frozen at −80°C prior to sectioning; 3–5 µm sections were prepared using a Leica CM1900 Cryostat.
Flow cytometry analysis of Sca surface expression
OptiPrep-purified rickettsiae were incubated with mixtures of anti-R. typhirat immune serum (1∶250) and anti-Sca rabbit serum (1∶50) with end over end mixing for 1 hour. Controls containing no primary antibodies, anti-R. typhi serum only or pre-immune rabbit serum only were also prepared. Bacteria were washed twice with 200 µl PBS then resuspended in the appropriate secondary antibody mixtures (Alexa Fluor 488-conjugated donkey anti-rat 1∶500, Alexa Fluor 647-conjugated donkey anti-rabbit 1∶500, Alexa Fluor 647-conjugated donkey anti-rat 1∶500) and incubated for 30 min with mixing. Bacteria were washed and resuspended in 100 ul of 4% paraformaldehyde in PBS and incubated for 20 min with mixing then washed again prior to being resuspended in 500 µl PBS for flow cytometry analysis. Samples were analyzed on a BD FACSCanto II instrument (BD Biosciences, San Jose, CA) using the 488 nm (to detect A488-conjugated anti-R. typhi immune serum staining) and 633 nm (to detect A647-conjugated anti-Sca antibody staining) lasers. Rickettsiae stained with anti-R. typhi serum and either A488-conjugated anti-rat or A647-conjugated anti-rat secondary antibodies served as positively stained controls. Flow cytometry analyses were performed at the University of Maryland Greenbaum Cancer Center Shared Flow Cytometry Facility.
Immuno-electron microscopy of L929 cells and purified rickettsiae
For electron microscopy, 48 h infected L929 cells were washed three times with PBS then fixed for at least one hour in PFGPA.1 fixative (2.5% formaldehyde, 0.1% glutaraldehyde, 0.03% picric acid (trinitrophenol), 0.03% CaCl2, 0.05 M cacodylate buffer pH 7.3–7.4). After washing in 0.1 M cacodylate buffer cells were scraped off the plastic, pelleted and processed as previously described [81]. Briefly, the pellets were stained en bloc with 2% aqueous uranyl acetate, dehydrated in 50% then 75% ethanol and embedded in LR White resin medium grade (Structure Probe, West Chester, PA). Ultrathin sections were cut on a Leica Reichert Ultracut S ultramicrotome and collected onto Formvar-carbon coated nickel grids (Electron Microscoy Sciences [EMS], Hatfield, PA). The grids were incubated in a wet chamber sequentially on drops of blocking buffer (0.1% BSA and 0.01 M glycine in 0.05 M Tris-buffered saline [TBS]), then on primary antibody with appropriate dilution in 1% BSA in 0.05 M TBS (diluting buffer) for 1 hr at room temperature and then overnight at 4°C. Primary antibodies were used at a 1∶50 dilution. After washing in blocking buffer, grids were incubated with a goat anti-rabbit IgG secondary antibody conjugated to 15 nm colloidal gold particles (Aurion, EMS), diluted 1∶20 in diluting buffer for 1 hr at room temperature. After washing in TBS and distilled water grids were fixed in 2% aqueous glutaraldehyde, washed, stained with uranyl acetate and lead citrate and examined in a Philips 201 or Philips CM-100 Electron microscope at 60 kV.Surface labeling of whole rickettsiae for imaging by immuno-electron microscopy was performed as follows. 107 purified rickettsiae were washed in 1X PBS and suspended in 4F1G fixative for 15 min. Rickettsiae were washed and resuspended in 10 mM HEPES; 20 µl drops were placed on Formvar-carbon coated nickel grids. Samples were blocked with 5% BSA, 0.1% CWFS (cold water fish skin) gelatin in HEPES for 15 min at room temperature. Antiserum to each Sca was diluted in 1% BSA, 0.1% CWFS gelatin diluting buffer for 1 hour at room temperature and then 4°C overnight. Grids were washed three times with 1X HEPES followed by incubation with goat anti-rabbit IgG secondary antibody conjugated to 15 nm colloidal gold particles (Aurion), diluted 1∶20 in diluting buffer for 1 hr at room temperature. Samples were fixed with 1% paraformaldehyde for 5 min at room temperature then washed three times with ddH2O for 5 min per wash. Finally, rickettsiae were negatively stained by incubation with 1% ammonium molybdate for 15 min at room temperature. Grids were viewed as noted above.
Immunofluorescence assays of rat spleen and C. felis
Staining was performed at biosafety level 2. For staining of rat tissues, antisera were directly labeled with either an Alexa Fluor 350 dye (Sca antisera) or Alexa Fluor 532 dye (anti-R. typhi serum) (Molecular Probes). Prior to staining, rat sections were treated with a 100 µg/ml solution of DNase-free RNase (Roche, Indianapolis, IN) in 2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0) for 20 minutes at 37°C. Sections were washed briefly three times with 2X SSC, blocked with 5% BSA-2X SSC for 15 min then incubated with Alexa Fluor 350-conjugated rabbit anti-Sca antibody and Alexa Fluor 532-conjugated rat immune serum to whole R. typhi diluted 1∶100 and 1∶250 respectively in 2X SSC. Slides were placed in a humidifying chamber for 30 min at 37°C. Slides were mounted with VectaShield fluorescent mounting medium (Vector Laboratories, Burlingame, CA) for observation. For flea sections, the samples were blocked with 5% BSA-PBS then sequentially incubated with an anti-Sca serum followed by rat immune serum to whole R. typhi. Positive staining was assessed using Alexa Fluor 594donkey anti-rabbit IgG and Alexa Fluor 488donkey anti-rat IgG secondary antibodies (Molecular Probes) each diluted 1∶500 in 1% BSA-PBS for 30 min at 37°C. Slides were mounted with VectaShield fluorescent mounting medium with DAPI (Vector Laboratories).
Accession numbers not listed in the respective figure legends are as follows
YP_067439: Rickettsia typhi str. Wilmington; ADE30028: Rickettsia prowazekii Rp22, AF163010_1: Rickettsia sp. IRS 4; AF155056_1: Rickettsia sp. Bar29; AAZ83584: Rickettsia asiatica; YP_001499380: Rickettsia massiliae MTU5; AAZ95593: Rickettsia tamurae; Q9AJ81: Rickettsia rhipicephali; Q9AJ79: Rickettsia japonica YH; YP_002916099: Rickettsia peacockii str. Rustic; AEK74699: Rickettsia heilongjiangensis 054; ABQ02467: Rickettsia sp. IG-1; AF163004_1: Rickettsia honei; ABD34821: Rickettsia raoultii; ACT33310: Candidatus Rickettsia tasmanensis; AF163009_1: Rickettsia Helvetica; ADH15759: Rickettsia aeschlimannii; NP_360304: Rickettsia conorii str. Malish 7; YP_002845259: Rickettsia africae ESF-5; ABQ02470: Rickettsia sp. TwKM01; ZP_00141907: Rickettsia sibirica 246; Q9AJ80: Rickettsia slovaca;AF163007_1: Rickettsia sp. A-167; YP_001650046: Rickettsia rickettsii str. Iowa; YP_001494783: Rickettsia rickettsii str. ‘Sheila Smith’; AF155058_1: Israeli tick typhus rickettsia; Q9AJ75: Rickettsia parkeri; AF163002_1: Rickettsia montanensis; AAZ78251: Rickettsia mongolotimonae; AF163001_1: Rickettsia sp. S; AAP92486: Rickettsia sp. BJ-90; YP_246741: Rickettsia felis URRWXCal2; YP_001493505: Rickettsia akari str. Hartford; Q9AJ64: Rickettsia australis; ACF20370: Candidatus Rickettsia barbariae; ADD12071: Candidatus Rickettsia andeanae; YP_001492306: Rickettsia canadensis str. McKiel; ADV19198: Candidatus Rickettsia goldwasserii; ZP_04699447: Rickettsia endosymbiont of Ixodes scapularis; YP_537939: Rickettsia bellii RML369-C; YP_001496362: Rickettsia bellii OSU 85–389; NP_220875, NP_220874: Rickettsia prowazekii str. Madrid E; ZP_04698207: Rickettsia endosymbiont of Ixodes scapularis; YP_002922015: Rickettsia peacockii str. Rustic; ZP_04698322: Rickettsia endosymbiont of Ixodes scapularis.The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Allergy and Infectious Diseases or the National Institutes of Health.Phylogenetic analysis of rickettsial surface cell antigens (Scas). For each analysis, sequences were aligned using MUSCLE v3.6 [1], [2] (default parameters). Phylogenetic trees were estimated in PAUP* v4.0b10 (Altivec) under parsimony [7], implementing 500 random sequence additions with 100 trees saved per replication. Branch support was assessed via 1000 pseudoreplications. GenBank accession numbers are provided for each sequence. (A–D) Phylogenies estimated for Sca sequences encoded within 16 Rickettsia genomes. (A) Sca1. (B) Sca2. (C) Sca4. (D) Sca5. (E–H). Phylogenies estimated for an expanded set of Sca sequences containing the majority of the passenger and AT domain. (E) Sca1. (F) Sca2. (G) Sca4. (H) Sca5.(EPS)Click here for additional data file.Immunoblotting of Sca proteins in uninfected and infected L929 cell fractions. L929 cells were infected with R. typhi for 4 days as described or left uninfected. Cells were washed and harvested for partial purification of rickettsiae and the resulting fractions separated by SDS-PAGE and processed for immunoblotting. Antiserum to each Sca (indicated above each blot) was used for probing. M – Marker, L – Uninfected L929 cells, RT – partially purified R. typhi. Arrows indicate bands corresponding to the predicted size range of the Sca protein blotted for.(EPS)Click here for additional data file.Immunogold post-embedding electron microscopy of Sca expression in
grown in L929 cells. Bar = 0.5 um. A) Sca5/ompB is localized in the host cell cytoplasm and in the outer membrane of rickettsiae (arrows); B) Sca1 displays weak labeling in the host cell cytoplasm and in the outer membrane of rickettsiae (arrows); C) Sca2 labeling at the outer membrane (arrow); D) Sca3 labeling mostly at the rickettsial outer membrane (arrows); E) Sca4 labeling in the rickettsial cytoplasm, at its periphery and on the outer membrane (arrows).(TIF)Click here for additional data file.Immunogold post-embedding electron microscopy of Sca expression in uninfected L929 cells. Bar = 0.25 um. Uninfected L929 cells were left uninfected and processed for immunogold electron microscopy as described in the methods. Sections were labeled with antibodies against the Sca protein indicated in the black box within each image.(EPS)Click here for additional data file.Immunofluorescence assays of Sca expression in uninfected
. Cat fleas were housed in an artificial feeding unit and fed uninfected whole sheep's blood for 14 days. Capsules were placed at −20°C to immobilize fleas before placing them in 3% PFA overnight. Fleas were embedded in OCT medium, frozen and cryosectioned. Sections were labeled with anti-R. typhirat immune serum (Alexa488-labeled anti-rat secondary Ab – green), anti-serum to the Sca protein indicated on the left (Alexa594-labeled anti-rabbit secondary Ab – red) and mounted in VectaShield medium with DAPI (blue) to counterstain DNA.(TIF)Click here for additional data file.Immunofluorescence assays of Sca expression in uninfected rats. Spleens were harvested from 9 day uninfected female Sprague-Dawley rats and fixed and embedded as described. Sections were labeled with anti-R. typhirat immune serum (Alexa532-conjugated - red), anti-serum to the Sca protein indicated on the left (Alexa350-conjugated - blue) and stained with propidium iodide (green) to counterstain DNA then mounted in VectaShield medium.(TIF)Click here for additional data file.Flow cytometry assays. A) Rickettsiae were gently purified and stained with anti-R. typhi immune sera and either anti-rat AlexaFluor 488 or AlexaFluor 647-conjugated anti-rat secondary Ab to determine the parameters for positive staining. B) Rickettsiae were gently purified and stained with anti-R. typhi immune serum (A488-conjugated anti-rat secondary Ab) and anti-Sca sera (A647-conjugated anti-rabbit secondary Ab) and analyzed by flow cytometry. Rickettsiae stained with both labels appear in the upper right quadrant. Each treatment was analyzed in triplicate and the data shown is representative of three experiments. C) Uninfected cells were taken through the purification process and the resulting pellet stained as indicated to assess the background contribution of host components to the analyses.(TIF)Click here for additional data file.Signal peptide and subcellular localization predictions for classically secreted, membrane and surface-exposed proteins. Each ORF in the R. typhi predicted proteome was analyzed for signal peptides using SignalP 3.0, LipoP 1.0 and Phobius servers. Subcellular localization predictions were identified using pre-compute genome results from the pSORTb v3.0.2 server and the predictive program SOSUI-GramN.(XLS)Click here for additional data file.Proteins predicted to be secreted by only the SecretomeP method. Predictions for proteins secreted by non-classical methods were made using the SecretomeP 2.0 server.(XLS)Click here for additional data file.Surface-exposed proteins of
str. Wilmington identified by LC/MS/MS. Proteins were run on SDS-PAGE gels and analyzed as described in the methods and section and Text S1. The presence of signal peptides and predicted subcellular localizations are included.(XLS)Click here for additional data file.Prediction of co-transcription of
genes. The OperonDB algorithm (http://operondb.cbcb.umd.edu/cgi-bin/operondb/operons.cgi) was utilized to determine the probability of each sca gene being transcribed with genes immediately upstream or downstream from them.(DOC)Click here for additional data file.Supporting information – methods and references. Details on the processing of Coomassie-stained protein bands for LC-MS/MS analysis and the software used for protein identifications are outlined in file Text S1. References for supporting figures are also included in this Supporting Information file.(DOC)Click here for additional data file.Multiple sequence alignment of rickettsial surface cell antigens (Scas). For each analysis, sequences were aligned using MUSCLE v3.6 [1], [2] (default parameters). Alignments were not manually adjusted. Sca1-5 alignments are noted above each alignment. All R. typhi sequences are bolded. Each alignment contains two rows above the sequences. Top row, alignment coordinates (at left) and sequence features, which are described further in Figure 2 of the text. Repeat regions are depicted with an ‘R’, with each individual repeat underlined for R. typhi as predicted with HHrepID [3]. Bottom row, vertical bars noting every tenth position within the alignments. Putative signal sequences, as predicted with SignalP v.3.0 [4], are colored green. AT domains, as provided in the R. typhi genome annotation [5], are colored dark blue. For the Sca2 alignment further coloring in the N-terminal region depicts conserved features previously described (see Figure S4 of Haglund et al.
[6]). Additionally, all Pro residues are colored red, with the Pro-rich tract of R. typhi distinguished from the different Pro-rich tract of SFG and SFG-like Sca2 sequences. GenBank accession numbers are provided for each sequence in the trees shown in Figure S2.(DOC)Click here for additional data file.
Authors: Michael P McLeod; Xiang Qin; Sandor E Karpathy; Jason Gioia; Sarah K Highlander; George E Fox; Thomas Z McNeill; Huaiyang Jiang; Donna Muzny; Leni S Jacob; Alicia C Hawes; Erica Sodergren; Rachel Gill; Jennifer Hume; Maggie Morgan; Guangwei Fan; Anita G Amin; Richard A Gibbs; Chao Hong; Xue-Jie Yu; David H Walker; George M Weinstock Journal: J Bacteriol Date: 2004-09 Impact factor: 3.490
Authors: Gerald D Baldridge; Nicole Y Burkhardt; Marcelo B Labruna; Richard C Pacheco; Christopher D Paddock; Philip C Williamson; Peggy M Billingsley; Roderick F Felsheim; Timothy J Kurtti; Ulrike G Munderloh Journal: Appl Environ Microbiol Date: 2010-01-22 Impact factor: 4.792
Authors: Gerald D Baldridge; Nicole Y Burkhardt; Roderick F Felsheim; Timothy J Kurtti; Ulrike G Munderloh Journal: Appl Environ Microbiol Date: 2007-12-07 Impact factor: 4.792
Authors: Walairat Pornwiroon; Apichai Bourchookarn; Christopher D Paddock; Kevin R Macaluso Journal: Infect Immun Date: 2009-09-21 Impact factor: 3.441
Authors: Joseph J Gillespie; Isabelle Q H Phan; Timothy P Driscoll; Mark L Guillotte; Stephanie S Lehman; Kristen E Rennoll-Bankert; Sandhya Subramanian; Magda Beier-Sexton; Peter J Myler; M Sayeedur Rahman; Abdu F Azad Journal: Pathog Dis Date: 2016-06-14 Impact factor: 3.166
Authors: Joseph J Gillespie; Simran J Kaur; M Sayeedur Rahman; Kristen Rennoll-Bankert; Khandra T Sears; Magda Beier-Sexton; Abdu F Azad Journal: FEMS Microbiol Rev Date: 2014-12-04 Impact factor: 16.408
Authors: Rebecca L Lamason; Effie Bastounis; Natasha M Kafai; Ricardo Serrano; Juan C Del Álamo; Julie A Theriot; Matthew D Welch Journal: Cell Date: 2016-10-20 Impact factor: 41.582
Authors: M Sayeedur Rahman; Joseph J Gillespie; Simran Jeet Kaur; Khandra T Sears; Shane M Ceraul; Magda Beier-Sexton; Abdu F Azad Journal: PLoS Pathog Date: 2013-06-20 Impact factor: 6.823
Authors: Kristen E Rennoll-Bankert; M Sayeedur Rahman; Joseph J Gillespie; Mark L Guillotte; Simran J Kaur; Stephanie S Lehman; Magda Beier-Sexton; Abdu F Azad Journal: PLoS Pathog Date: 2015-08-20 Impact factor: 6.823