Literature DB >> 22867028

Virulence profile of different phylogenetic groups of locally isolated community acquired uropathogenic E. coli from Faisalabad region of Pakistan.

Saira Bashir1, Abdul Haque, Yasra Sarwar, Aamir Ali, Muhammad Irfan Anwar.   

Abstract

BACKGROUND: Uropathogenic E.coli (UPEC) are among major pathogens causing urinary tract infections. Virulence factors are mainly responsible for the severity of these emerging infections. This study was planned to investigate the distribution of virulence genes and cytotoxic effects of UPEC isolates with reference to phylogenetic groups (B2, B1, D and A) to understand the presence and impact of virulence factors in the severity of infection in Faisalabad region of Pakistan.
METHODS: In this study phylogenetic analysis, virulence gene identification and cytotoxicity of 59 uropathogenic E.coli isolates obtained from non-hospitalized patients was studied.
RESULTS: Among 59 isolates, phylogenetic group B2 (50%) was most dominant followed by groups A, B1 (19% each) and D (12%). Isolates present in group D showed highest presence of virulence genes. The prevalence hlyA (37%) was highest followed by sfaDE (27%), papC (24%), cnf1 (20%), eaeA (19%) and afaBC3 (14%). Highly hemolytic and highly verotoxic isolates mainly belonged to group D and B2. We also found two isolates with simultaneous presence of three fimbrial adhesin genes present on pap, afa, and sfa operons. This has not been reported before and underlines the dynamic nature of these UPEC isolates.
CONCLUSIONS: It was concluded that in local UPEC isolates from non-hospitalized patients, group B2 was more prevalent. However, group D isolates were most versatile as all were equipped with virulence genes and showed highest level of cytotoxicity.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22867028      PMCID: PMC3475034          DOI: 10.1186/1476-0711-11-23

Source DB:  PubMed          Journal:  Ann Clin Microbiol Antimicrob        ISSN: 1476-0711            Impact factor:   3.944


Background

Uropathogenic E. coli (UPEC) are among the major pathogens causing urinary tract infections (UTIs). Phylogenetic studies have revealed that these bacteria are not of very diverse origin and fall into four main groups (A, B1, B2, and D) [1,2] nowadays. Phylogenetic analysis is usually done by targeting three genetic markers chuA, yjaA genes and DNA fragment TSPE4.C2 [2]. This method has been found satisfactory and endorsed by other workers [3]. Virulent strains of E. coli mainly belong to phylogenetic groups B2 and D, while less virulent and commensal strains belong to phylogenetic groups B1 and A [2-7]. UPEC typically attach to epithelial cells with A-fimbrial adhesins (afa), P-fimbrial adhesins (pap), and S-fimbrial adhesins (sfa) [8-11]. Intimin, an attachment and membrane damaging pathogenicity factor, plays a vital role in virulence [12]. These virulence factors help bacteria to attach the epithelial cell lining of urinary tract and causes infection. Hemolytic and cytotoxic necrotizing factors are also important virulence factors. The cnf1 is produced by 40% of uropathogenic E. coli isolates [13]. Most bacterial toxins cause initial cytopathic effects but only cytotoxins like cnf can lead to death of cultured cells [14]. In vitro alpha hemolysins and cytotoxic necrotizing factors have cytotoxicity towards different cells including Chinese hamster ovary, Vero and HeLa monolayers [15,16]. UTIs are very common in Pakistan and UPEC are the most frequent pathogens. Although a number of studies on this subject have been carried in various parts of the world, such data is not available from Pakistan. We felt that there was a need to characterize the local isolates of UPEC especially because no reports are currently available from this region.

Materials and methods

Collection, identification and storage of UPEC

Urine samples from non-hospitalized suspected cases of urinary tract infections were collected from various clinical laboratories of Faisalabad region. For isolation of E. coli, these samples were directly inoculated on MacConkey agar (Merck, Germany) plates. After overnight incubation at 37°C, lactose-fermenting colonies were identified as E. coli by characteristic morphology and inoculation on Triple Sugar Iron (TSI) agar (Merck, Germany) slants. The isolates were kept as stocks at −20°C in 50% glycerol stocks for long term storage.

DNA Extraction and PCR based confirmation of E. coli isolates

Each isolate was inoculated in 5 ml of Tripticase Soy Broth (TSB). After overnight incubation at 37°C, DNA was extracted by conventional phenol chloroform method and quantified according to Sambrook et al.[17]. For confirmation of E. coli, PCR was performed by targeting uidA gene by following conditions described by Heninger et al.[18]. Primers are listed in Table 1.
Table 1

Oligonucleotide primers

GenesPrimer sequences (5/to 3/)Amplicon size (bp)References
chuA
GACGAACCAACGGTCAGGAT
279
[2]
 
TGCCGCCAGTACCAAAGACA
 
 
yjaA
TGAAGTGTCAGGAGACGCTG
211
[2]
 
ATGGAGAATGCGTTCCTCAAC
 
 
TspE4.C2
GAGTAATGTCGGGGCATTCA
152
[2]
 
CGCGCCAACAAAGTATTACG 
 
 
uidA
ATCACCGTGGTGACGCATGTCGC
486
[18]
 
CACCACGATGCCAT GTTCATCTGC
 
 
cnf1
GGCGACAAATGCAGTATTGCTTGG
552
[19]
 
GACGTTGGTTGCGGTAATTTTGGG
 
 
papC
GACGGCTGTACTGCAGGGTGTGGCG
328
[20]
 
ATATCCTTTCTGCAGGGATGCAATA
 
 
sfaDE
CTCCGGAGAACTGGGTGCATCTTAC
408
[20]
 
CGGAGGAGTAATTACAAACCTGGCA
 
 
afaBC3
CATCAAGCTGTTTGTTCGTCCGCCG
793
[20]
 
GCTGGGCAGCAAACTGATAACTCTC
 
 
eaeA
GACCCGGCACAAGCATAAGC
384
[21]
 CCACCTGCAGCAACAAGAGG  
Oligonucleotide primers

Phylogenetic analysis

A triplex PCR was performed to segregate each isolate into one of the four main phylogenetic groups (A, B1, B2 and D) by targeting two marker genes (chuA and yjaA) and a DNA fragment TSPE4.C2 [2]. PCR conditions were same as described by Clermont et al.[2]. Primers are listed in Table 1.

Targeted virulence related genes

There are many virulence genes associated with UPEC. We selected six most reported virulence genes. Among toxin encoding genes, hlyA gene was targeted for hemolysin and cnf1 gene [19] for cytotoxic necrotizing factor. S-fimbrial adhesin is specific for terminal sialyl galactoside residues present on human erythrocytes; sfaDE gene [20] which is located on S-fimbrial gene cluster and is responsible for transport and assembling of fimbrial subunit was included, as well as papC gene [20] that is responsible for pyelonephritis associated adhesion, and afaBC3 gene [20] that is located on afa3 operon and is responsible for A-fimbrial adhesins. Yet another adhesin, intimin (encoded by eaeA gene) which has special significance in E. coli pathogenicity, was also included [21-23].

Multiplex PCR for virulence related genes

Multiplex PCR was performed for each isolate for the identification of virulence related genes. Each 100μL multiplex PCR reaction mixture contained 1X PCR buffer (50 mM KCl, 10 mM Tris HCl; pH 8.3), 2.5 mM MgCl2, 100 nmol of each dNTP’s, 100 pmol of each primer, 5 U of recombinant Taq polymerase, (Fermentas, USA) and 2 μL of DNA template. Primers are listed in Table 1. The thermal cycler (MasterCycler; Eppondorf, Hamburg, Germany) conditions were as follows: 94°C for 5 min followed by 30 cycles of 94°C for 1 min, 56°C for 1 min and 72°C for 1 min and final extension of 5 min at 72°C. The PCR products were separated by electrophoresis on 2% (w/v) agarose gel and photographed by using Eagle Eye (Strategene, USA).

Restriction analysis of virulence genes

PCR products of the virulence genes were subjected to restriction analysis for confirmation. The sequences of the genes were taken from NCBI GenBank using primer base sequences. The accession numbers of the genes are as follows: papC (Y00529), sfaDE (X16664), afaBC3 (X76688), hlyA (AB032930), eaeA (AF043226), cnf1 (U42629). These genes were restricted with HaeIII, Hinf1, Pst1, EcoR1 and Tail enzymes respectively. Restriction conditions were similar in all cases. Each 30 μL reaction mixture contained 1 μL of restriction enzyme, 8 μL of PCR product, 3 μL of specific enzyme buffer and 18 μL of sterilized dH2O. Overnight incubation was done at 37°C and the restriction products were separated on 2% agarose gel.

Hemolysis assays

Hemolysin (hlyA) gene positive isolates were selected for studying hemolytic activity by using the method described by Haque et al.[24] with modifications. Human erythrocytes were used instead of rabbit erythrocytes and filtered supernatant of overnight culture of UPEC was double diluted with 0.9% NaCl in a 96 well microdilution plate. Rest of the procedure was as previously reported. Hemolytic unit was calculated by plotting dilution factor against transmittance. One hemolytic unit is the dose of hemolysin that causes 50% hemolysis.

Vero cell lines and Toxicity assay

The cytotoxic effects of UPEC toxins (cytotoxic necrotizing factor and hemolysin) were studied by invading Vero cells. The Vero cell lines were grown in DMEM (MP Biomedical, USA), fetal calf serum 5-10%, gentamicin (1μL/mL) and amphotericin (10μL/mL) in sterilized Petri plates and incubated overnight at 37°C in the presence of 5% CO2. DMEM was removed from Vero cell plates followed by washing with PBS. Filtered and sterilized (0.2 μm pore size syringe filter) UPEC culture supernatant (1.5 mL) was added to each plate along with 1.5 mL DMEM and incubated overnight at 37°C with 5% CO2. The medium was removed from Petri plates into the falcon tubes. One mL of 1X trypsin: EDTA solution was added and after 5 min, dislodged cells were transferred to the same falcon tube. The falcon tube was centrifuged at 10,000 rpm for 10 minutes and supernatant was discarded; 1 mL of trypan blue was added, mixed gently and incubated at 37°C for 10 min. The ratio of dead (stained) and living cells was counted in a hemocytometer using inverted microscope (x4). The concentration resulting in 50% stained cells represented the 50% cytotoxic dose.

Statistical analysis

Analysis of variance was used to compare the prevalence of various phylogenetic groups and presence of different virulence related genes. The difference having P value equal or less than 0.05 was considered as statistically significant.

Results

Confirmation of E. coli isolates

A total of 59 isolates were confirmed as E. coli by conventional biochemical identification followed by the detection of uidA gene. Out of 59 UPEC isolates, the group B2 isolates 30 (50%) were found significantly higher (P < 0.05) as compared to other phylogenetic groups. Seven (12%) isolates fell in group D and 11 (19%) belonged to each of groups A and B1. Groups B1 and B2 showed two different patterns each. Details are given in Table 2.
Table 2

Phylogenetic distribution of uropathogenic

Phylogenetic groupsNo. of UPEC isolate n = 59Distribution according to gene groupings (n)chuAgeneyjaAgeneTSPE4.C2
Group B2
30 (50%)
28
+
+
+
 
 
02
+
+
-
Group B1
11(19%)
09
-
-
+
 
 
02
-
+
+
Group A
11(19%)
11
-
+
-
Group D07 (12%)07+-+
Phylogenetic distribution of uropathogenic

Prevalence of virulence genes among UPEC isolates

The targeted virulence genes were detected in 37 (63%) isolates. Remaining isolates were negative for the targeted genes. All the 7 group D isolates showed presence of these virulence genes. Breakup for other groups was: A 5/11 (45%), B1 6/11 (55%), and B2 18/30 (60%). It was found that most prevalent gene was hlyA which was detected in 22 isolates (37%) while 16 (27%), 14 (24%), 11 (19%), 12 (20%), and 8 (14%) isolates were positive for sfaDE, papC,eaeA, cnf1, and afaBC3 genes respectively. One isolate was positive for all 6 targeted virulence genes, two showed presence of 5 genes, and in three others 4 genes were detected. Three, two and one genes were found in 7, 10 and 14 isolates respectively. Detailed results are shown in Table 3.
Table 3

Prevalence of virulence related genes in various phylogenetic groups of uropathogenic isolates

Phylogenetic groups
No. of Isolates with Virulence genes
Distribution of virulence genes
  papCsfaDEafaBC3eaeAhlyAcnf1
Group B2
18/30 (60%)
10
08
04
05
11
05
Group B1
07/11 (64%)
02
03
01
01
02
03
Group A
05/11 (45%)
0
0
01
02
04
01
Group D
07/07 (100%)
02
05
02
03 05 03
 
 
Total37/59 (63%)141608112212
Prevalence of virulence related genes in various phylogenetic groups of uropathogenic isolates It was also found that papC, cnf1 and hlyA were present collectively in 4 isolates, where as papC, sfaDE and afaBC3 genes which represent P-fimbial, S-fimbrial and A-fimbrial adhesins respectively, were also identified collectively in two isolates as shown in the Table 4.
Table 4

Presence of virulence genes in UPEC isolates

No. of GenesVirulence GenesNo. of Isolates (n = 59)
6
sfaDE, afaBC3, papC, eaeA, cnf1, hlyA
1
5
sfaDE, papC, eaeA, cnf1, hlyA
1
5
sfaDE, afaBC3, papC, cnf1, hlyA
1
4
sfaDE, papC, eaeA, hlyA
2
4
afaBC3, papC, eaeA, hlyA
1
3
sfaDE, cnf1, hlyA
3
3
papC, eaeA, hlyA
1
3
afaBC3, eaeA, hlyA
1
3
afaBC3, papC, hlyA
1
3
papC, cnf1, hlyA
1
2
eaeA, hlyA
3
2
sfaDE, cnf1
1
2
sfaDE, hlyA
3
2
sfaDE,papC
2
2
papC,hlyA
1
1
sfaDE
2
1
afaBC3
3
1
papC
2
1
eaeA
1
1
cnf1
4
1
hlyA
2
0No gene22

Note:, S-fimbrial adhesin; , A-fimbrial adhesin; , P-fimbrial adhesin; , Intimin; , cytotoxic necrotizing factor; , hemolysin.

Presence of virulence genes in UPEC isolates Note:, S-fimbrial adhesin; , A-fimbrial adhesin; , P-fimbrial adhesin; , Intimin; , cytotoxic necrotizing factor; , hemolysin. The detected genes were confirmed by restriction analysis: sfaDE and papC amplicons (410 and 328 bp respectively) were restricted with HaeIII and yielded fragments of 209 bp, 135 bp and 66 bp; and 161 bp, 112 bp and 55 bp respectively. The afaBC3 amplicon (793 bp) was restricted with Hinf1 and yielded fragments of 565 and 228 bp. The eaeA amplicon (384 bp) was restricted with EcoR1 and yielded fragments of 305 and 79 bp. Tail and msp1 were used to restrict amplicons of cnf1 (552 bp) and hlyA (534 bp) genes respectively to yield fragments of 356, 192 and 4 bp, and 315 and 219 bp.

Phylogenicity and virulence

When relationship of phylogenicity and virulence was studied, the prevalence of all virulence genes was found significantly higher in phylogenetic group D (P < 0.05) as compared to other phylogenetic groups except for papC gene which was found highest in group B2 isolates. The papC and sfaDE genes were absent in all group A isolates (Table 3).

Hemolysis assay

Out of 59 isolates, 22 isolates were hlyA positive. All hlyA positive isolates (22) showed hemolytic activity in hemolysis assay. Hemolytic activity was classified into three groups, highly hemolytic (above 20 HU), moderately hemolytic (between 10–20 HU) and poorly hemolytic (below 10 HU). Accordingly, among 22 isolates, 3 (14%) were found highly hemolytic, 3 (14%) as moderately hemolytic and 16 (72%) as poorly hemolytic.

Verotoxicity assay

Twenty seven isolates which were positive for hlyA and/or cnf1 genes were selected for verotoxicity assay. Among 27 isolates, 15 were hlyA positive, 5 were cnf1 positive and 7 possessed both genes. All the isolates showed verotoxicity. They were classified into highly toxic (80-100% cell death), moderately toxic (50-80%) and poorly toxic (below 50%). More details are given in Table 5.
Table 5

Verotoxicity assay of and gene positive UPEC isolates (n = 27)

 hlyAgene positive isolates (n = 15)cnf1gene positive isolates (n = 5)hlyA+cnf1positive isolates (n = 7)
Highly toxic
06
01
04
80-100% cell death
 
 
 
Moderately toxic
05
03
01
50-80% cell death
 
 
 
Poorly Toxic
04
01
02
Below 50% cell death   
Verotoxicity assay of and gene positive UPEC isolates (n = 27)

Discussion

UPEC are major cause of urinary tract infections and may be responsible for nearly 90% of UTI [25]. There are four main phylogenetic groups (A, B1, B2, and D) of UPEC and the phylogenicity has been reported to play an important role in virulence of these pathogens [1-3]. Although a number of studies on this subject have been carried in various parts of the world, such data is not available from Pakistan where UTI are very common. This study was designed to characterize local isolates of UPEC with respect to phylogenicity and distribution of most important virulence factors. Although our study is comprised of a relatively small number of samples and therefore faces limitations in statistical analysis, it provides important information about the phylogenetic background of uropathogenic E.coli from this region. In the present study, we found that 50% of our isolates belonged to a single phylogenetic group B2 which is in line with some other studies [4,5]. We found that among all phylogenetic groups, most of the virulence related genes were present in significantly higher proportion in phylogenetic group D isolates except papC gene, which was more frequent in B2 isolates. This is in accordance with the report of Nowrouzian et al.[26] who found that most B2 strains carried genes for P-fimbriae. Our results also supported some previous reports indicating greater association of traditionally recognized uropathogenic virulence factors (e.g. pap, sfa, and hly) with groups D and B2 as compared with A and B1 [6,27]. Among adhesins, sfaDE was highly (27%) prevalent among local UPEC isolates followed by papC (24%) and afaBC3 (8%) genes. We found that frequency of sfa was higher as compared to other genes. In some of isolates, multiple adhesin genes were identified (pap and sfa; pap and afa; pap, sfa and afa) where as in some other isolates these genes were present independently. Here again, phylogenetic group D was most prominent. Our findings are comparable with those of Le Bouguenec et al.[20] who found pap operon in 79.4% of the pyelonephritis strains, either present alone (51.5%) or in association with either afa or sfa operon (27.9%), whereas in 12.4% and 22.7% of the isolates the adhesive properties were associated with the presence of afa and sfa operons, respectively. It is important to note that we did find these three operons in two isolates. The simultaneous presence of pap, afa, and sfa operons has not been reported before. The intimin adhesin (eaeA gene) is an attachment and membrane damaging pathogenicity factor. It was found in 19% of the isolates. The presence of this adhesin gene has also been previously reported in UPEC [23] though it is well known that it is associated with diarrhoeagenic E. coli[21,28]. Among toxins, hemolysin was identified in 22 (37%) isolates. These findings are in line with those of Bingen-Bidois et al.[29] who found hly gene in 34% of UPEC isolates. In the present study, all hlyA gene positive isolates hemolysed human erythrocytes. Our UPEC isolates showed considerable cytotoxic effects and 20% were positive for cnf1 gene. When 27 (46%) UPEC isolates having cnf1, hlyA or both genes were used to invade the Vero cells, highest toxicity (80-100% vero cell death) was observed in hlyA gene positive isolates (n = 06), followed by hlyA + cnf1 (n = 04) and cnf1 positive (n = 01) isolates. This is in agreement with the reports suggesting that during the early stages of uropathogenesis, hly plays a major role in the damage of uroepithelium. It has also been reported that in many uropathogenic E. coli the loci of hly and cnf1 are often linked and responsible for the severity of urinary tract infections [30]. High cytotoxicity levels were not always found associated with cnf1 and hly positive isolates in this study because some isolates which were positive for other virulence genes, showed cytotoxic effect as well. On the other hand, some isolates with cnf1 did not express any cytotoxic effect on Vero cells. It may be due to an insertion of a thymidine base at position 3325 in the C-terminal domain of cnf1, which encodes the catalytic region of the toxin [31,32]. The cumulative presence of papC, cnf1 and hlyA is the evidence of pathogenicty island IIJ96, which is highly prevalent among UTI isolates [33]. In the present study the simultaneous presence of papC, cnf1 and hlyA was observed in 4 UPEC isolates. Highly hemolytic isolates belonged to phylogenetic group D, while highly cytotoxic isolates belonged to group B2 and D. This is in partial disagreement with the studies of Zhang et al.[34] who found that hly and cnf1 positive isolates mainly belonged to phylogenetic group B2. It can be concluded that all local UPEC isolates have a battery of virulence factors which makes them a serious and challenging health problem. The simultaneous presence of pap, afa, and sfa operons has been reported for the first time underlining the dynamic nature of these isolates. Another finding of interest was the prominence of Group D in relevance to the presence of virulence factors. The previous reports from other parts of the globe mostly highlight Group B2.

Competing interests

All authors declare that they have no competing interest.

Authors' contributions

SB carried out sample collection, analysis and drafted the manuscript, AH provided concept and finally drafted the manuscript, YS and AA provided guidance in Lab work, MIA helped in sample collection and preparation of manuscript. All authors read and approved the final manuscript.
  32 in total

Review 1.  Extraintestinal pathogenic Escherichia coli: "the other bad E coli".

Authors:  James R Johnson; Thomas A Russo
Journal:  J Lab Clin Med       Date:  2002-03

2.  Rapid and simple determination of the Escherichia coli phylogenetic group.

Authors:  O Clermont; S Bonacorsi; E Bingen
Journal:  Appl Environ Microbiol       Date:  2000-10       Impact factor: 4.792

3.  Phylogenetic distribution of extraintestinal virulence-associated traits in Escherichia coli.

Authors:  J R Johnson; P Delavari; M Kuskowski; A L Stell
Journal:  J Infect Dis       Date:  2000-11-22       Impact factor: 5.226

4.  S-Fimbria-encoding determinant sfa(I) is located on pathogenicity island III(536) of uropathogenic Escherichia coli strain 536.

Authors:  U Dobrindt; G Blum-Oehler; T Hartsch; G Gottschalk; E Z Ron; R Fünfstück; J Hacker
Journal:  Infect Immun       Date:  2001-07       Impact factor: 3.441

5.  Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains.

Authors:  W L Zhang; B Köhler; E Oswald; L Beutin; H Karch; S Morabito; A Caprioli; S Suerbaum; H Schmidt
Journal:  J Clin Microbiol       Date:  2002-12       Impact factor: 5.948

6.  Phylogenetic analysis and prevalence of urosepsis strains of Escherichia coli bearing pathogenicity island-like domains.

Authors:  Martine Bingen-Bidois; Olivier Clermont; Stéphane Bonacorsi; Mustapha Terki; Naïma Brahimi; Chawki Loukil; Dominique Barraud; Edouard Bingen
Journal:  Infect Immun       Date:  2002-06       Impact factor: 3.441

7.  Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise.

Authors:  J R Johnson; A L Stell
Journal:  J Infect Dis       Date:  2000-01       Impact factor: 5.226

8.  Escherichia coli cytotoxic necrotizing factor-1 (CNF-1) increases the adherence to epithelia and the oxidative burst of human polymorphonuclear leukocytes but decreases bacteria phagocytosis.

Authors:  P Hofman; G Le Negrate; B Mograbi; V Hofman; P Brest; A Alliana-Schmid; G Flatau; P Boquet; B Rossi
Journal:  J Leukoc Biol       Date:  2000-10       Impact factor: 4.962

9.  Phylogenetic background and virulence profiles of fluoroquinolone-resistant clinical Escherichia coli isolates from the Netherlands.

Authors:  James R Johnson; Cindy van der Schee; Michael A Kuskowski; Wil Goessens; Alex van Belkum
Journal:  J Infect Dis       Date:  2002-11-22       Impact factor: 5.226

10.  Assigning Escherichia coli strains to phylogenetic groups: multi-locus sequence typing versus the PCR triplex method.

Authors:  David M Gordon; Olivier Clermont; Heather Tolley; Erick Denamur
Journal:  Environ Microbiol       Date:  2008-06-02       Impact factor: 5.491

View more
  14 in total

1.  Escherichia coli B2 Phylogenetic Subgroups in the Infant Gut Microbiota: Predominance of Uropathogenic Lineages in Swedish Infants and Enteropathogenic Lineages in Pakistani Infants.

Authors:  Forough L Nowrouzian; Olivier Clermont; Mona Edin; Anna Östblom; Erick Denamur; Agnes E Wold; Ingegerd Adlerberth
Journal:  Appl Environ Microbiol       Date:  2019-11-27       Impact factor: 4.792

2.  Distribution of pathogenicity island markers and virulence factors in new phylogenetic groups of uropathogenic Escherichia coli isolates.

Authors:  Akram Najafi; Mojtaba Hasanpour; Azam Askary; Masoud Aziemzadeh; Najmeh Hashemi
Journal:  Folia Microbiol (Praha)       Date:  2017-12-03       Impact factor: 2.099

3.  Bacterial drug-resistance patterns and genetic diversity of bacteria-associated bacteriuria in diabetic patients in Ghana.

Authors:  Akua Obeng Forson; Dickson Agyei Menkah; Marjorie Ntiwaa Quarchie; Shittu Bunkunmi Dhikrullahi; Michael Olu-Taiwo; Francis Samuel Codjoe
Journal:  IJID Reg       Date:  2021-10-28

4.  Phylogenetic groups of Escherichia coli strains from patients with urinary tract infection in Iran based on the new Clermont phylotyping method.

Authors:  Darioush Iranpour; Mojtaba Hassanpour; Hossein Ansari; Saeed Tajbakhsh; Gholamreza Khamisipour; Akram Najafi
Journal:  Biomed Res Int       Date:  2015-01-08       Impact factor: 3.411

5.  Snapshot of Phylogenetic Groups, Virulence, and Resistance Markers in Escherichia coli Uropathogenic Strains Isolated from Outpatients with Urinary Tract Infections in Bucharest, Romania.

Authors:  Violeta Corina Cristea; Irina Gheorghe; Ilda Czobor Barbu; Laura Ioana Popa; Bogdan Ispas; Georgiana Alexandra Grigore; Irina Bucatariu; Gabriela Loredana Popa; Maria-Cristina Angelescu; Alexandra Velican; Luminita Marutescu; Marcela Popa; Mariana Carmen Chifiriuc; Ioan Mircea Popa
Journal:  Biomed Res Int       Date:  2019-05-20       Impact factor: 3.411

6.  Distribution of virulence genes and phylogenetics of uropathogenic Escherichia coli among urinary tract infection patients in Addis Ababa, Ethiopia.

Authors:  Belayneh Regasa Dadi; Tamrat Abebe; Lixin Zhang; Adane Mihret; Workeabeba Abebe; Wondwossen Amogne
Journal:  BMC Infect Dis       Date:  2020-02-07       Impact factor: 3.090

7.  High frequency of simultaneous presence of ESBL and carbapenemase producers among nosocomial coliform isolates in Faisalabad, Pakistan.

Authors:  Sofia Irfan; Aysha Azhar; Asad Bashir; Salman Ahmed; Abdul Haque
Journal:  Pak J Med Sci       Date:  2021 Jan-Feb       Impact factor: 1.088

8.  Faecal Escherichia coli isolates show potential to cause endogenous infection in patients admitted to the ICU in a tertiary care hospital.

Authors:  D Nagarjuna; G Mittal; R S Dhanda; P K Verma; R Gaind; M Yadav
Journal:  New Microbes New Infect       Date:  2015-06-04

9.  Phylogenetic Group/Subgroups Distributions, Virulence Factors, and Antimicrobial Susceptibility of Escherichia coli Strains from Urinary Tract Infections in Hatay.

Authors:  Ebru Şebnem Yılmaz; Özkan Aslantaş
Journal:  Rev Soc Bras Med Trop       Date:  2020-02-07       Impact factor: 1.581

10.  Phylogenetic Group B2 Expressed Significant Biofilm Formation among Drug Resistant Uropathogenic Escherichia coli.

Authors:  Saima Javed; Zulfiqar Ali Mirani; Zaid Ahmed Pirzada
Journal:  Libyan J Med       Date:  2021-12       Impact factor: 1.657

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.