Literature DB >> 22629389

HeT-A_pi1, a piRNA target sequence in the Drosophila telomeric retrotransposon HeT-A, is extremely conserved across copies and species.

Natalia Petit1, David Piñeyro, Elisenda López-Panadès, Elena Casacuberta, Arcadi Navarro.   

Abstract

The maintenance of the telomeres in Drosophila species depends on the transposition of the non-LTR retrotransposons HeT-A, TAHRE and TART. HeT-A and TART elements have been found in all studied species of Drosophila suggesting that their function has been maintained for more than 60 million years. Of the three elements, HeT-A is by far the main component of D. melanogaster telomeres and, unexpectedly for an element with an essential role in telomere elongation, the conservation of the nucleotide sequence of HeT-A is very low. In order to better understand the function of this telomeric retrotransposon, we studied the degree of conservation along HeT-A copies. We identified a small sequence within the 3' UTR of the element that is extremely conserved among copies of the element both, within D. melanogaster and related species from the melanogaster group. The sequence corresponds to a piRNA target in D. melanogaster that we named HeT-A_pi1. Comparison with piRNA target sequences from other Drosophila retrotransposons showed that HeT-A_pi1 is the piRNA target in the Drosophila genome with the highest degree of conservation among species from the melanogaster group. The high conservation of this piRNA target in contrast with the surrounding sequence, suggests an important function of the HeT-A_pi1 sequence in the co-evolution of the HeT-A retrotransposon and the Drosophila genome.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22629389      PMCID: PMC3357415          DOI: 10.1371/journal.pone.0037405

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The function of eukaryotic telomeres goes beyond capping the end of the DNA molecule and has been found of key importance for other cellular processes such as senescence, genomic stability and oncogenesis [1]–[3]. Telomeres from eukaryotic chromosomes consist in arrays of repeated sequences that in most eukaryotes are maintained by the telomerase holoenzyme [4]. In contrast, in the Drosophila genus telomeres are maintained by a different mechanism. Telomere-specific retrotransposons are reverse transcribed specifically onto the end of the chromosomes [3], [5], [6]. Drosophila species contain two main types of retroelements in their telomeres, TART and HeT-A, with a few copies of TAHRE inside the melanogaster group [7]. These two retrotransposons are non-LTR retroelements with features that distinguish them from other non-telomeric elements. HeT-A and TART have very long 3′ untranslated regions (UTR) and are specifically targeted to the end of the chromosomes, thus maintaining telomere length [6]. HeT-A is the main component of D. melanogaster telomeres and its orthologues have been described in almost all telomeres of studied Drosophila species, from D. melanogaster to D. virilis, indicating that the function of this element predates the Drosophila genus [8]–[12]. The invasion of eukaryote genomes by transposable elements (TEs) triggered the development of a great diversity of defense mechanisms. These defense mechanisms are actively evolving to control transposition at different levels. In recent years small interfering RNAs have been highlighted as a very powerful mechanism of gene regulation. Piwi-interacting RNAs (piRNAs) [13], [14] are a particularly interesting class of RNAs. They act mainly upon TEs in germ line tissues where control of transposition is critical, because new transpositions would be passed to the offspring. Two versions of the piRNA pathway exist in ovaries depending on whether the cell belongs to the oocyte and the accompanying nurse cells (germ cells) or to the follicle cells that surround the egg (somatic cells; [15]).The generation of piRNAs in germ cells by the action of the different Piwi (P-element induced wimpy testis) proteins, Aubergine, Argonaute3 and Piwi, is dependent on an amplification cycle, the so called Ping-Pong cycle. In that cycle, a primary piRNA complementarily recognizes its target and recruits PIWI-proteins, which will cleave the transcript generating a secondary piRNA, which, in turn, will further amplify the process. According to a recent classification based on the relative abundances of sense and antisense piRNAs loaded into the different PIWI-proteins TEs can be classified in three groups, HeT-A belongs to Group I [16], [17]. Group I transposons are heavily repressed in germ line cells and present a strong ping-pong signature that derives from a 10 nucleotide overlap between antisense piRNAs bound to Aubergine and sense piRNAs bound to Ago3 [17]. Whatever the exact mechanism of action of piRNAs, processing of the transposon’s mRNA results in effective posttranscriptional silencing and further amplifies the presence of sense and antisense piRNAs for that particular copy of the TE. These newly generated piRNAs can now target both strands of a genomic copy of a TE and direct specific silencing complexes to remodel the chromatin environment achieving transcriptional silencing [14], [18]. The fact that piRNAs can silence TEs provides an opportunity for an arms race in which natural selection would favor transposable elements that escape this kind of control by acquiring mutations in their piRNA target sequences. This process tends to make piRNAs rapidly evolving sequences [19], [20]. Beyond their functional role in the control of transposable elements, piRNAs may also have regulatory roles in heterochromatin assembly and epigenetic regulation [19], [21]. The complexity of small-RNA mediated epigenetic regulation in higher organisms remains largely unexplored, and it has been suggested that the interaction between PIWI-proteins and piRNAs could promote heterochromatin or euchromatin formation depending on the chromatin context in D. melanogaster [21], [22]. In addition, it has been recently shown that two components of the PIWI pathway, Armitage and Aubergine are required for the proper assembly of the telomere protection complex demonstrating additional functional roles of this pathway besides TEs silencing [23]. Although data available for the heterochromatic portion of the Drosophila genomes is far from complete, different studies indicate a lack of sequence conservation in the nucleotide sequence of HeT-A indicating a fast evolution of this retroelement [6], [8]–[11], [24], [25]. This seems contradictory for a transposable element with an important function in the stem cells maintenance and raises questions about the co-evolution of telomeric transposons and Drosophila telomeres. Motivated by this contradiction, we studied the degree of conservation along the copies of HeT-A looking for putative regulatory sequences. We identified a small sequence within the 3′ UTR of the element that is highly conserved among copies and species from the melanogaster group (5–15 MY of genetic distance). Further analysis of this sequence revealed that, quite surprisingly, it corresponds to a piRNA target sequence. Because of the highly variable nature of HeT-A sequence, the extreme conservation of this piRNA target sequence, HeT-A_pi1, suggests a possible role in the co-evolution of HeT-A and the Drosophila genome.

Results

Sequence Conservation at the 3′UTR of the HeT-A Retrotransposon and Presence of piRNA Targets

To search for putative functional elements along the HeT-A retrotransposon, we performed two analyses. First we investigated the levels of sequence conservation amongst the six described D. melanogaster complete HeT-A copies [6]. We measured nucleotide diversity as the average number of pairwise nucleotide differences among copies of the element using sliding windows of several sizes (see Methods and Results S1). In Figure 1A, a sliding-window graph (25 ntds long, with a 1 ntds step) shows that there are three small conserved regions, R1, R2 and R3, in the 3′ UTR of the element. Conservation analyses performed with DNAspv5 [26] using a range of different windows and conservation thresholds; indicated that only these three small regions are fully conserved (conservation = 1) across copies for all the window sizes used, indicating that these three regions are more conserved than any other fragment of the element. They are even more conserved than any fragment of the gag coding region, which in average is, of course, the most conserved part of the element (Figure 1A and Table S1).
Figure 1

Nucleotide diversity estimates among elements and species.

(A) Conservation analysis of the six complete HeT-A elements from D. melanogaster. Sliding windows of 25 ntds size and 1 ntd steps are represented. The significantly conserved regions (R) in the 3′UTR are marked with arrows. (B) Conservation analysis of the last 500 ntds of the 3′UTR among species (D. melanogaster, D. sechellia, D. simulans, D. yakuba). Graph constructed with an alignment of homologous sequences, longer than 350 ntds, obtained from the Blast analysis of the 3′ UTR sequence with a window size of 25 ntds and step size of 1 ntds (see Methods and Results S1). Number of aligned sequences: D. melanogaster 26, D. sechellia 26, D. yakuba 6 and D. simulans 12. The estimated average nucleotide diversity among all 72 sequences is 0.13571. For nucleotide diversity within each species see Figure S1. (C) Alignment of the piRNA target sequence among HeT-A copies from four Drosophila species. Nucleotide diversities: all, 0.048; D. sechellia, 0.028, D. yakuba, 0.021; D. simulans, 0.058; and D. melanogaster, 0.0437 (See Figure S1).

Nucleotide diversity estimates among elements and species.

(A) Conservation analysis of the six complete HeT-A elements from D. melanogaster. Sliding windows of 25 ntds size and 1 ntd steps are represented. The significantly conserved regions (R) in the 3′UTR are marked with arrows. (B) Conservation analysis of the last 500 ntds of the 3′UTR among species (D. melanogaster, D. sechellia, D. simulans, D. yakuba). Graph constructed with an alignment of homologous sequences, longer than 350 ntds, obtained from the Blast analysis of the 3′ UTR sequence with a window size of 25 ntds and step size of 1 ntds (see Methods and Results S1). Number of aligned sequences: D. melanogaster 26, D. sechellia 26, D. yakuba 6 and D. simulans 12. The estimated average nucleotide diversity among all 72 sequences is 0.13571. For nucleotide diversity within each species see Figure S1. (C) Alignment of the piRNA target sequence among HeT-A copies from four Drosophila species. Nucleotide diversities: all, 0.048; D. sechellia, 0.028, D. yakuba, 0.021; D. simulans, 0.058; and D. melanogaster, 0.0437 (See Figure S1). Our second analysis considered interspecific variability across all the available genomes of Drosophila species. We performed a Blast analysis of the three functional parts (3′ UTR, 5′UTR and gag coding region) of a randomly selected HeT-A copy from D. melanogaster (HeT-A{}6268) against HeT-A databases comprised by the HeT-A sequences of the eleven Drosophila genomes annotated by RepeatMasker at the UCSC Genome Bioinformatics website (http://genome.ucsc.edu/; See Methods). For the gag coding regions, we only observed homology with the closest species (D. sechellia and D. simulans, <5 Myr divergence). In contrast, for the 3′ UTR region we also obtained homology hits in HeT-A copies of D. yakuba. (∼10 Myrs divergence, see TableS2). Since the 3′ UTR hits were located in its last 500 bp, where the R2 and R3 regions are located, for these 500 bp we extended the sliding window analysis explained above to the three Drosophila species presenting homology hits (D. sechellia, D. simulans and D. yakuba). Two out of the three regions (R2 and R3) were found to be significantly conserved (Figure 1B, full results and details are given in Methods and Results S1). In order to explain the conservation of the R2 and R3 regions, we performed several analyses looking for a function for these sequences. First, we checked whether these regions are part of the sense or antisense HeT-A promoters. From the known functional annotation of HeT-A, we could exclude that the R2 region was part of the antisense promoter [27] and, although included in the sense promoter, the R2 is not necessary for driving transcription [28] (Figure S2). Second, we blasted the final 500 ntds of the 4R{}6268 HeT-A element, which span the R2 and R3 conserved regions, against the full NCBI Nucleotide Database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Besides HeT-A sequences, several matches were obtained corresponding to two mapped D. melanogaster cDNAs (BT015972 and BT030306) and one antisense piRNA from D. melanogaster testes (AB297338.1; see Methods and Results S1). The high identity of the R2 conserved region with the antisense piRNA sequence AB297338.1 (27 out 28 identical nucleotides, see also Figure 1C) suggests that corresponds to the target sequence for this piRNA. Given that a piRNA had been discovered, we searched for other possible target sequences of this piRNA besides HeT-A. With this purpose we blasted the piRNA sequence looking for matches of at least 24 nucleotides against a database containing all described TEs (N = 176 from Flybase) and a database containing all mRNAs from D. melanogaster. We detected 47 mRNAs carrying the sense or antisense sequence of the piRNA (see Table S4). Inspection of the sequence of these mRNAs showed that these are fully composed by repetitive sequences from different transposable elements including HeT-A. These mRNAs map in heterochromatic unassembled parts of the genome, without any known genes, and they could be transcripts from piRNA clusters [16], [17]. Putting all this evidence together, it seems clear that this piRNA does not target another TE sequence or known gene different from HeT-A. In order to ascertain whether other conserved piRNA targets could be found along the HeT-A sequence. We split the six known HeT-A complete copies in 30 ntds fragments with an overlap of 29 ntds (i.e. a 1ntds step). These fragments were blasted against the database of small RNA reads obtained by Li et al. [17] from wild-type ovaries of D. melanogaster (SRX002245). We obtained a total of 21,319 different small RNAs reads that matched one or more fragments of the different HeT-A copies. These reads represent 7,048 putative piRNA sequences matching different HeT-A sequences in D. melanogaster, (42% sense and 58% antisense). Most of these piRNA targets are located within the gag coding region (Table 1 and Methods and Results S1) producing a negative correlation between nucleotide diversity and number of piRNAs targets (see Methods and Results S1, Table S3, Figures S3,S4,S5,S6,S7,S8). Although many RNA reads target moderately conserved regions of the HeT-A copies, more than 50% of these reads exactly match only a single copy of the element and only 17 RNA reads match fragments coming from all six complete HeT-A copies (see Figure S8 and Table 1). This frequency distribution of target piRNAs along HeT-A agrees with the expectations from an arms-race between the host and the controlled TEs [29].
Table 1

Number of piRNA reads, along the HeT-A copies and coordinates for piRNA targets HeT-A_pi1 and 2 in each described copy from D. melanogaster.

piRNA coordinates
HeT-A copies nameNumber of readsNumber of differentpiRNAs (Total/gag coding region)HeT-A_pi1 senseHeT-A_pi1anti-senseHeT-A_pi2 senseHeT-A_pi2anti-sense
HeT-A{}626565511318/8505496.55245506.55295821.58475821.5844
HeT-A{}627467251307/8295481.55095491.55145806.58335806.5829
HeT-A{}480045851057/6445645.56735655.56805974.60015974.5997
HeT-A{}626855061099/7245651.56795661.56865980.60075980.6003
HeT-A{}626256751169/7865431.54595441.54465760.57865760.5783
HeT-A23Znk69521098/7865728.57565737.57626048.60756048.6071
The small 17 RNA reads found to target all six D. melanogaster HeT-A copies correspond to sense and antisense RNA sequences targeting precisely the two conserved regions in the last 500 nucleotides of the 3′UTR, R2 and R3 (Table 1 and Figure 1A). At this point we have evidence for the two regions being targeted by piRNA, since piRNAs matching these target sequences have been found to bind PIWI-proteins, (Piwi and Aubergine) in databases of piRNAs obtained by Li et al. [17] (supporting R2 and R3; SRX002242-3) and Nishida et al. [30] (supporting R2; AB297338.1). Therefore, we renamed the R2 conserved region as piRNA target HeT-A_pi1 and R3 as piRNA target HeT-A_pi2. Coordinates of these piRNAs in each HeT-A copy are presented in Table 1. Figure S2 shows the relative positions of HeT-A_pi1 and HeT-A_pi2 relative to known functional features of the 3′UTR.

The piRNA Target HeT-A_pi1 is Conserved within the 3′UTR of HeT-A Orthologues from Different Drosophila Species

To ascertain up to which level the sequence and position of the two HeT-A piRNA targets (HeT-A_pi1 and HeT-A_pi2) had been conserved across the evolution of the whole Drosophila group, we investigated the presence of these piRNA targets and their flanking regions in related species from the melanogaster group (D. melanogaster, D. simulans, D. sechellia and D. yakuba) for which we had detected HeT-A copies with the conserved regions (see Methods and Results S1). To do so, we again used our HeT-A databases (see Methods), but in order to ensure that the piRNA targets were located within the same region of the element, that is in order to ensure we were dealing with orthologous piRNA targets, instead of using only the HeT-A_pi1 sequence we also blasted a 250 ntds-long sequence (“homologous sequence”) starting 100 ntds 5′ before the piRNA target sequence. The piRNA target HeT-A_pi2 was only found in D. melanogaster, while HeT-A_pi1 was found in all four species: D. melanogaster, D. simulans, D. sechellia and D. yakuba. Thus, in what follows we focused in HeT-A_pi1 (region R2). The numbers of hits obtained by the sense piRNA HeT-A_pi1 and the 250 nucleotides sequence in each species are summarized in Table 2. The results for the antisense piRNA HeT-A_pi1 are nearly identical since this pair overlaps in nearly 20 nucleotides. More than 80% of the homologous HeT-A sequences contain the sequence of the piRNA HeT-A_pi1, with at least 24 consecutive identical nucleotides. The nucleotide alignment shown in Figure 1C further illustrates the conservation of that piRNA in different species.
Table 2

Summary of hits from Blast analyses of the HeT-A_pi1 (Number of hits piRNA) and the 250 ntds sequences (Number of hits TE) containing the sequence of HeT-A_pi1 against databases of annotated HeT-A sequences in different Drosophila species.

SpeciesNumber hits piRNANumber of hits TE (A)Number of shared hits*(B)%TE seqs. with the piRNA((B/A)*100)
D. sechellia 33322990.63
D. simulans 12141285.71
D. yakuba 59403997.50
D. melanogaster 34413380.49

number of hits where the 250 ntds sequences contain the piRNA HeT-A_pi1.

number of hits where the 250 ntds sequences contain the piRNA HeT-A_pi1. To further quantify the conservation of the HeT-A_pi1 target sequence and to ensure that conservation was due to the HeT-A_pi1 target sequence itself, and not to the surrounding 250 ntds window, we used a log-likelihood ratio test (see ) to check whether variability of the piRNA target HeT-A_pi1 (among copies and within species) was significantly lower than the nucleotide variability of the 250 ntds window flanking HeT-A_pi1 sequence in D. melanogaster (p = 0.013), D. sechellia (p = 0.009) and D. yakuba (p = 0.038). In D. simulans, where both the number of homologue copies and nucleotide diversity are lower than for the other three species the test is not significant (Table 2 and supp. Table S7).

Putative Functional and Transcribed Elements Contain the piRNA Target HeT-A_pi1

As mentioned above, all the six complete elements in D. melanogaster contain the exact target sequence for the HeT-A_pi1 piRNA within their 3′UTRs (Table 1). In order to know if the conserved HeT-A_pi1 is also found in putative functional elements in other species, an in silico analysis searching for complete and putative functional gag coding regions in the HeT-A databases of the different species was performed. The sequence of the Gag protein was t-blasted against the HeT-A databases of the different species. Because the nucleotide sequence identity among gag coding regions with the most distant species, D. yakuba, is low (see Methods and Results S1 and Table S2) we used two different Gag protein sequences. The Gag protein from D. melanogaster’s HeT-A{}6268 copy was blasted against D. sechellia and D. simulans; while the sequence from the previously described HeT-A orthologue in D. yakuba (AF043258; [24]) was blasted against the D. yakuba. Analysis revealed eleven putatively functional gag coding regions (nine in D. sechellia, one in D. simulans and one in D. yakuba; Table 3). The sequence of the target HeT-A_pi1, was searched within a 5 kb window downstream of the identified gag coding regions. In all cases where genomic sequence was available, the piRNA target HeT-A_pi1 was found (Table 3).
Table 3

Coordinates of complete gag coding regions and HeT-A_pi1 targets in different Drosophila species. Nucleotide changes in the piRNA target sequence labeled in red, otherwise perfect identity.

Species gag gene coordinates (strand)piRNA target coordinatespiRNA target sequence
D. simulans chrU:5142940–5145762(+)chrU:5147652–5147679tcggtgcttccgtccttctggcgggggt
super_173∶1481–4303(−)No downstream sequence
super_2∶42799–45513(+)super_2∶47693–47720gcggtgctcctgtccttctgatgggggt
super_986∶2128.4944(−)No downstream sequence
super_296∶1169–3964(+)super_296∶7345–7372tcggtgcttccgtccttctggcgggggt
D. sechellia super_182∶4515–7309(−)super_182∶3079–3106tcggtgcttccgtccttctggcgggggt
super_543∶3382–6177(+)super_543∶7667–7694tcggtgcttccgtccttctggcggaggt
super_535∶1469–4282(+)super_535∶5773–5800tcggtgcttccgtccttctggcggaggt
super_330∶1726–4545(−)No downstream sequence
super_173∶1480–4302(−)No downstream sequence
D. yakuba chr2R:21104242–21106926(−)chr2R:21102135–21102162tcggtgcttccgtccttctggcgggggt
To find out if the sequence of the 3′UTR containing the piRNA is being actively transcribed, we amplified, cloned and sequenced thirty-nine mRNAs of the HeT-A 3′UTR from D. melanogaster ovaries and testes (strain Oregon-R). All transcripts contain the piRNA target HeT-A_pi1 sequence. The alignment in Figure 2 demonstrates that although the flanking sequence at both sides of the piRNA target shows different nucleotide polymorphisms, variability decreases substantially inside the sequence of the piRNA target (3 changes, nucleotide diversity = 0.028; Figure 3). The sequenced transcripts could be classified in ten groups, seven of which map with more than 97% identity within the arrays of the telomeric elements in the two completely assembled telomeres of D. melanogaster (4R and XL, isogenic strain 2057 yellow (y); cinnabar (cn) brown (bw) speck (sp)) (see Methods and Results S1 and Table S5). Interestingly, the transcript ov11 is 100% identical to the HeT-A{}6274 copy, which maps at the right telomere of chromosome IV. The HeT-A copies 23Znk and HeT-A{}6274 are the two complete elements with a higher number of small RNA reads (Table 1), which suggests that these two master copies are among the most active in different strains of D. melanogaster.
Figure 2

Alignment of 3′UTR transcripts obtained from testes and ovaries of D. melanogaster Oregon R.

Nucleotide polymorphisms are indicated. piRNA target HeT-A_pi1 is labelled with a red rectangle.

Figure 3

Average conservation index of the fifteen highly conserved piRNA targets from the TEs HeT-A, accord2 and I among D. melanogaster, D. simulans, D. sechellia and D. yakuba species.

Asterisks label those cases (species) where the piRNA target sequence has significantly different number of nucleotide changes than the flanking sequence by a log-likelihood ratio test (See Methods). For values within species see Table S7 and Figure S10.

Alignment of 3′UTR transcripts obtained from testes and ovaries of D. melanogaster Oregon R.

Nucleotide polymorphisms are indicated. piRNA target HeT-A_pi1 is labelled with a red rectangle.

Average conservation index of the fifteen highly conserved piRNA targets from the TEs HeT-A, accord2 and I among D. melanogaster, D. simulans, D. sechellia and D. yakuba species.

Asterisks label those cases (species) where the piRNA target sequence has significantly different number of nucleotide changes than the flanking sequence by a log-likelihood ratio test (See Methods). For values within species see Table S7 and Figure S10.

The piRNA Target HeT-A_pi1 Shows Higher Conservation than Other Target piRNAs in Different TEs

To ascertain whether the case of HeT-A_pi1 is as rare as it seems from the results above, we investigated the level of conservation of piRNAs matching sequences of other transposable elements (TEs) within the melanogaster group. We selected the most representative elements of each of the groups defined by Li et al. [17] in order to take into account any possible biological differences in the levels of conservation among these three groups. Gypsy from Group III, Accord2 from Group II and for Group I, the HeT-A related elements Jockey and TART and the HeT-A unrelated elements copia and I. We followed the same strategy that we used for HeT-A to find conserved target piRNAs within these retrotransposons in the databases of the four species of the melanogaster group. For each retrotransposon we take 250 piRNAs exactly matching (best hits of at least in 24 consecutive ntds) the canonical TE sequence (see Methods and Results S1 and Figure S9). For each piRNA matching the canonical sequence of each TE we checked for the presence of the piRNA target within a 250 ntds homologous sequence, (beginning 100 ntds. before the piRNA target sequence). This analysis unveiled 98 non-redundant piRNA targets with significant hits and exact match (at least 24 consecutive identical nucleotides) in homologous sequences of the different TEs in all four species (supp. Table S6). Fourteen of these piRNA target sequences are present in more than 50% of the homologous copies and at least in four different copies of the elements (accord2 and I, supp. Table S6). Since the probability to find the same piRNA target in different copies of one element depends on the level of nucleotide variability of each particular TE, we calculated a conservation index based on the nucleotide diversity of each piRNA target sequence, relative to the nucleotide diversity of the flanking sequence (see Methods). Moreover, because the rate of evolution of transposable elements depends not only on nucleotide substitutions but also on the rate of sequence insertion and deletion [31] we took into account the percentage of TE sequences with the complete target piRNA sequence (Table 4). Figure 3 shows the graphs corresponding to the mean values of the conservation index among species for the fifteen conserved piRNA targets, (see Figure S10 and Table S7 for individual species). Among the fifteen most conserved target piRNAs analyzed, the target HeT-A_pi1 has the highest conservation index and the highest number of species where the sequence variability of the target piRNA is significantly lower than the nucleotide variability of the sequence of the TE without the piRNA target sequence (Figure 3 and Figure S11 and S12).
Table 4

Most conserved target piRNAs from the seven analyzed TEs. The values presented are means and standard deviation across species (see Table S7 for individual species analyses).

piRNA_IDMean ± SD
Nucletide diversity ofpiRNA (A)Nucleotide diversity ofTE (B)% TE sequences with thepiRNA (C)Conservation Index(1-A/B)*C
HeT-A_pi10.026±0.0100.104±0.0280.886±0.0720.655976±0.141149
55_accord20.017±0.0160.076±0.0950.851±0.1520.641643±0.245810
100_I0.014±0.0130.042±0.0070.789±0.1560.550814±0.344161
75_I0.024±0.0170.045±0.0080.784±0.1730.408558±0.412469
222_accord20.030±0.0220.042±0.0180.717±0.2030.346673±0.442072
119_accord20.022±0.0170.038±0.0120.733±0.0850.344468±0.180259
155_accord20.020±0.0050.040±0.0110.723±0.1280.325855±0.110779
78_I0.024±0.0080.039±0.0090.706±0.1440.269431±0.219061
73_I0.028±0.0190.038±0.0060.729±0.0940.220935±0.284904
209_I0.027±0.0160.039±0.0200.645±0.0290.215759±0.225368
9_I0.025±0.0160.034±0.0090.686±0.1030.132290±0.496102
183_accord20.035±0.0350.036±0.0120.723±0.1420.127842±0.413761
127_I0.033±0.0280.033±0.0100.722±0.097–0.013562±0.561638
18_accord20.037±0.0100.035±0.0110.651±0.152–0.058755±0.149838
16_I0.047±0.0150.050±0.0370.746±0.115–0.513765±1.271019

Discussion

Why Would the HeT-A Retrotransposon Conserve a Sequence Containing a piRNA Target?

Our results indicate that the piRNA target HeT-A_pi1 is highly conserved in the different HeT-A copies in D. melanogaster and also in HeT-A orthologues of related species within the melanogaster group: D. yakuba, D. sechellia, D. simulans, presenting a degree of conservation that is even higher than any fragment of the gag coding region. Moreover, the piRNA target HeT-A_pi1, is the target piRNA with the highest conservation among 98 conserved target piRNAs in different copies of seven analyzed TEs. Given the high nucleotide variability of the HeT-A sequence inside and among species [6], [10], [12], [32] this result strongly suggests that the sequence of this piRNA target, HeT-A_pi1, has been maintained under strong purifying selection for nearly 5–10 million years. The function of piRNAs has been related to transcriptional and posttranscriptional control of genetic mobile elements [16]–[19], [29], [33]. Although the mechanism of biogenesis and function of these small RNAs is not yet fully understood, the main activities in which piRNAs are involved are aimed to guard genome integrity from the potential deleterious activity of transposable elements. Following an arms-race logic in which the transposable elements would try to escape this control, one would not expect that HeT-A would conserve a piRNA target within its sequence, facilitating host control and reducing its capacity to transpose. However, in a series of simulation studies Lu and Clark [29] showed that, under certain circumstances, TEs that are producers and targets of piRNAs have an increased probability of reaching high frequencies or even fixation within populations. These authors suggest that the piRNA sequence provides a “Trojan horse” for retrotransposons, allowing transposition of the elements within a given genome to be fine-tuned. We postulate that the HeT-A_pi1 piRNA could constitute a nice example of Lu & Clark’s “Trojan horse” hypothesis. Because of its telomeric role, the HeT-A retrotransposon and the Drosophila genome would have reached an armistice; a sort of symbiosis in which the terminal transposition of the element is allowed when telomere elongation is required, while potentially deleterious transposition events that would result in genomic instability are strongly repressed. We have shown that the transcripts of active copies of the HeT-A retrotransposon in germ line tissues (ovaries and testes) carry the piRNA target HeT-A_pi1. We have identified antisense cDNAs (such as BT015972, see Methods and Results S1) that most likely correspond to antisense transcripts produced from the HeT-A clusters at the telomeres, which could be sources for antisense HeT-A_pi1 RNAs. Shpiz et al. [27] and Piñeyro et al. [32] have shown that the 3′UTR of the HeT-A retrotransposon contains an antisense promoter capable of producing a variety of antisense transcripts from the HeT-A clusters at the telomeres. Thus, all the potential factors for the piRNA target HeT-A_pi1 to act as a canonical piRNA target and function to silence the HeT-A retrotransposon are undoubtedly in place in D. melanogaster. Interestingly, neither TART nor TAHRE, that are considerably less efficient in successfully transposing into Drosophila telomeres, contain the piRNA target sequence HeT-A_pi1. In fact, a search of the HeT-A_pi1 element in different databases (canonical TEs and mRNAs from D. melanogaster) indicates that this piRNA targets specifically the HeT-A sequence in D. melanogaster. Although either TART or TAHRE, or both, should contribute to HeT-A transposition by providing enzymatic activities, their regulation may be somehow less sophisticated. The copy number of TAHRE is very low and although many copies of TART are present at the telomeres of any given stock [6], a low level of enzymatic activities might be enough to achieve HeT-A terminal transposition when needed. In this scenario, a stronger regulation of TART expression would be compatible with the currently most accepted model of a collaborative effort of HeT-A and TART in telomere maintenance [12]. Alternatively, TART might have also acquired a sophisticated strategy to evade regulatory control by piRNAs that still needs to be identified. Moreover, we have also shown that the HeT-A_pi1 piRNA target is conserved in the orthologue copies of the HeT-A retrotransposon in three other species of the melanogaster group, thus suggesting that it became fixed nearly 5–10 million years ago. Of course, we can neither exclude some other function for the HeT-A_pi1 region in these other three Drosophila species, nor ensure that HeT-A_pi1 is a piRNA target in them, since no extensive small RNA sequencing has yet been carried out for these species. However, both the extreme nucleotide conservation and the age of this sequence suggest a similar function in all analyzed species. Our study and others [16], [17] have shown a considerable number of piRNAs matching different target sequences along the HeT-A retrotransposon which would be by far sufficient to regulate HeT-A transcription. Most intriguingly, only the piRNA target HeT-A_pi1 is conserved across all active copies in D. melanogaster and other species of its group. Because the HeT-A retrotransposon fulfills an essential function through its active transposition the striking conservation of only this piRNA target sequence also suggests an alternative explanation linked to a functional role in telomere chromatin. Yin and Lin [21] found a piRNA located in the 3R subtelomeric region that binds the Piwi protein and opens the heterochromatin in this genomic region suggesting a crucial role in telomere regulation. Interestingly, in a recent report, Khurana et al. [23] find a direct link between the presence of a subset of piRNAs from the telomeres bound to the Piwi protein and the recruitment of the capping protein complex that protects the telomeres. In those cases one would expect these short sequences and their processing as piRNA be conserved in evolution. We believe that these two examples together with the striking conservation that we have shown here for the HeT-A_pi1 piRNA target across species, strongly suggests that this could be a case of an alternative or additional functional role other than fine-tuning transcriptional control. The putative dual role of the HeT-A_pi1 piRNA target could have allowed the HeT-A retrotransposon to master its role at maintaining Drosophila telomeres. Future work in this direction will hopefully shed enough light to discern the nature of the conservation of this small DNA sequence and the alternative mechanism of Drosophila telomeres.

Conclusions

The extreme degree of conservation (both within and among species) of the HeT-A piRNA target sequence, HeT-A_pi1, particularly in contrast with the high variability of the closely surrounding region, suggests an important function of this sequence in the co-evolution of this TE and the Drosophila genome. Two hypotheses are proposed to explain the function of this conserved piRNA target sequence: (1) The fixation of this piRNA target within the sequence of the HeT-A retrotransposon could be a truce in the arms race between the telomeric retrotransposon and the fly genome, allowing a highly sophisticated fine-tuned transposition of this particular retrotransposon to the end of the chromosome. (2) The piRNA target HeT-A_pi1 could have an additional and unique function related to telomeric chromatin, protection or function. The latter case would be an example of co-evolution between the HeT-A retrotransposon and the Drosophila genome. The new world of recently discovered piRNAs opens a high number of possibilities to study how TEs might have influenced genome evolution.

Materials and Methods

Accession Numbers of Used Sequences

The sequences of all D. melanogaster complete and canonical transposable elements were obtained from FlyBase [34]. HeT-A elements: HeT-A{}6262 (FBti0102105), HeT-A{}6268 (FBti0102111), HeT-A{}6274 (FBti0102117), HeT-A{}6265 (FBti0102108), HeT-A{}4800 (FBti00062861) and 23Znk (U06920.2). gypsy1: M12927.1. Copia: X02599.1. TART: AY561850.1. Jockey: M22874.1. accord2: AF541947. I: M14954.2. The reference sequence used for HeT-A elements was HeT-A{}6268 (FBti0102111). The coordinates of the functional parts of this element are: 5′UTR: 1.914, Gag protein: 915.3749, 3′UTR: 3750.6012. Annotated TE genomic sequences and mRNA sequences were obtained from UCSC database (http://genome.ucsc.edu; tables/repeatMasker and tables/all_mRNAs, respectively). Small RNA reads where obtained from NCBI Sequence Read Archive: SRA007727/SRX002242-5 [17].

TE Databases

To construct the different Blast databases we used the program makeblastdb from the NCBI/blast2.2.22+ package [35]. For each Drosophila species with genome sequences available, we extracted the sequences of HeT-A elements annotated with RepeatMasker from the UCSC Mysql database (filter “HETA”). The number of HeT-A sequences for each species are presented in Table S1. For species belonging to the melanogaster subgroup we extracted sequences annotated as TART-B1, copia, I, gypsy1, jockey and accord2 by RepeatMasker. Different databases were constructed for each element and species. TE sequences annotated by RepeatMasker include both complete and truncated elements.

Sequence Alignments and Nucleotide Diversity Analyses

All alignments were obtained using Muscle3.6 software [36]. Estimates of nucleotide diversity among elements and species were computed using DNAspv5 [26]. Estimates of nucleotide diversity are obtained from the average number of pairwise nucleotide differences among sequences, irrespective of them coming from different copies of the element. Full methods for conservation analyses can be found in Methods and Results S1.

Blast Analyses

Blast analyses where performed using local Blast (Blast2.2.22; [35]). To search for small RNA sequences the blastn algorithm was modified to find small sequence hits with at least 24 consecutive identical nucleotides, that is the minimun described length for a piRNA. To find piRNA target sequences matching HeT-A copies, each copy was split in overlapping fragments of 30 ntds (with a step of 1 ntds) and the fragments were blasted against the database of small RNA reads database from Li et al. SRA007727/SRX002242-5 [17]. To search for gag coding regions, Gag protein sequences were blasted using the tblastn algorithm. The Gag protein in HeT-A{}6268 was t-blasted against the database of HeT-A annotated sequences from D. simulans and D. sechellia. In the same way the Gag protein of the HeT-A element AF043258, [24] from D. yakuba was t-blasted against the database of HeT-A annotated sequences from D. yakuba. All reported results of Blast analyses are significant.

Conservation Analysis of piRNAs in Different Species

Conserved piRNA targets among D. melanogaster HeT-A copies (HeT-A_pi1 and HeT-A_pi2) and the 250 ntds sequence where they are contained (starting from 100 ntds before the beginning of each piRNA) were blasted against databases of annotated HeT-A sequences in four melanogaster related species (D. melanogaster, D. yakuba, D. simulans and D. sechellia). The shared hits between the two blast analyses (blast of piRNAs against TE dbs and blast of sequences of 250 ntds containing the piRNAs against TE dbs) were counted. The proportion of the sequences resulting of the blast of the sequences of 250 ntds without the piRNA was taken as an indicative of the piRNA deletion. A rough estimation of the conservation of the piRNA for each species was obtained dividing the nucleotide diversity estimates for each piRNA by the nucleotide diversity of the surrounding TE sequence (hits of the Blast analysis of the 250 ntds long sequence) and multiplying this ratio by the proportion of TE sequences containing the piRNA. To test whether the degree of conservation of piRNAs was significantly different from that of the surrounding region, we devised a likelihood-ratio test. The test is based in comparing the number of observed differences within the piRNA vs. differences in the neighboring 250 ntds region. We use the sequence alignments obtained from the blast analyses to count the relative number of sequence changes harbored by the piRNA and its neighboring 250 ntds region between different copies of the same element within each species. The likelihood of the probabilities of nucleotide changes inside and outside of the piRNA target sequence was estimated under two alternative models (Models 1 and 2). Both models used a binomial distribution where the number of trials is the length of the sequence and the number of successes is the actual number of observed changes. Under Model 1 the piRNA sequence and its neighboring sequences have the same probability of nucleotide changes. Under Model 2 the probability of nucleotide changes is different within the piRNA sequence that in the surrounding region. The basic likelihood function under these two models is as follows:Where L and L are, respectively, the lengths in ntds of the piRNA sequence and the neighboring sequence surronding it (a window of 250 ntds was used); x and x are the number of nucleotide changes observed in these two sequences and p and p are the estimated probability of changes. Under Model 1 p  =  p while under Model 2 p >p. A log-likelihood ratio test was used to test if Model 2, that contains an extra parameter, is significantly better in explaining our observations than Model 1. The obtained p-values and nucleotide diversity estimates for each species are presented in Table S7. A similar approach was used to find conserved piRNAs in other transposable elements (see Methods and Results S1 and Figure S9).

RNA Extraction

Ovaries and testicles from adult females and males of D. melanogaster Oregon R strain were dissected and used to perform RNA extraction (RNeasy® Mini Kit, Qiagen ref.74104). DNAse I treatment as follows: once with RNase-Free DNase set (Qiagen ref.79254) on-column, as manufacturer instructions and twice for 3 hours with the same DNAse I in solution, as manufacturer instructions. The RNA concentration and quality were checked using NanoDrop® ND-1000.

HeT-A Transcript Amplification and Cloning

Conserved regions from HeT-A sequences available in the FlyBase [34] were considered to design primers: 3UTRHeTbF (5′ GCTCCAAGCTGCCAATCC 3′) and HeT-A 3′ final reverse (5′ ATTCTGTTCCGCATCCAC 3′), in order to amplify the 3′ UTR region containing the piRNA target HeT-A_pi1 sequence. Amplification was performed by RT-PCR (Transcriptor One-Step RT-PCR Kit (Roche ref. 04655877001) as directed by the manufacturer) specific for sense transcripts amplification. The product of the amplification was directly ligated into pST-Blue 1 plasmid, using the AccepTor™ Vector Kit (Novagene ref. 70595-3). Plasmid DNA was purified by standard alkaline miniprep protocol. Insert presence was checked by EcoRI (Fermentas ref. #ER0271) restriction. The plasmid DNA was sequenced by the Value Service of Macrogen (Korea) using the T7 promoter primer. Sliding windows showing the nucleotide diversity of the last 400 nucleotides of the 3′ UTR in different Drosophila species. (PDF) Click here for additional data file. Position of HeT-A_pi1 relative to the sense and antisense promoters and start sites. Positions in accordance with the sequence from clone HeT-A{}4R6262 are shown. (PDF) Click here for additional data file. Correlation between the number of piRNAs targeting the complete six copies from and nucleotide diversity among copies. (PDF) Click here for additional data file. Correlation between the number of piRNAs targeting the complete six copies from and nucleotide diversity among copies without windows conatining the coding region sequences. (PDF) Click here for additional data file. Correlation between the number of piRNAs targeting five copies from and nucleotide diversity among copies. (PDF) Click here for additional data file. Correlation between the number of piRNAs targeting five copies from and nucleotide diversity among copies. (PDF) Click here for additional data file. Correlation between the number of piRNAs targeting five copies from and nucleotide diversity among copies. (PDF) Click here for additional data file. Correlation between the number of piRNAs targeting five copies from and nucleotide diversity among copies. (PDF) Click here for additional data file. Frequency distribution of RNA reads across six copies. (PDF) Click here for additional data file. Diagram of the approach to find conserved piRNA targets in TEs among copies and species. (PDF) Click here for additional data file. Conservation index of the fifteen highly conserved piRNA target sequences in the different Drosophila species. (PDF) Click here for additional data file. Mean values of conservation index (red) and constraints (blue) of the fifteen highly conserved piRNAs target sequences among and species. (PDF) Click here for additional data file. Regions significantly conserved among complete elements. (XLS) Click here for additional data file. Blast hits along the functional domains of the copy HeT-A{}6268. (XLS) Click here for additional data file. Correlation analyses between nucleotide diversity and the number of piRNA target sequences. (XLS) Click here for additional data file. Coordinates of the non-TE mRNAs carrying the HeT-A_pi1 sequence. (XLS) Click here for additional data file. Results of nucleotide diversity and mapping analyses of 3′ UTR transcripts from ovaries and testes. (XLS) Click here for additional data file. Coordinates and number of hits obtained for the 98 conserved piRNA targets. (XLS) Click here for additional data file. Estimates for nucleotide diversity, conservation index and p-values for the sixteen most conserved piRNAs among the four species of the melanogaster group. (XLS) Click here for additional data file. (DOC) Click here for additional data file.
  35 in total

1.  Somatic piRNA biogenesis.

Authors:  Phillip D Zamore
Journal:  EMBO J       Date:  2010-10-06       Impact factor: 11.598

Review 2.  Interactions between transposable elements and Argonautes have (probably) been shaping the Drosophila genome throughout evolution.

Authors:  Haruhiko Siomi; Mikiko C Siomi
Journal:  Curr Opin Genet Dev       Date:  2008-03-04       Impact factor: 5.578

3.  DnaSP v5: a software for comprehensive analysis of DNA polymorphism data.

Authors:  P Librado; J Rozas
Journal:  Bioinformatics       Date:  2009-04-03       Impact factor: 6.937

Review 4.  Drosophila telomeres: A variation on the telomerase theme.

Authors:  Mary-Lou Pardue; P Gregory DeBaryshe
Journal:  Fly (Austin)       Date:  2008-05-04       Impact factor: 2.160

5.  Population dynamics of PIWI-interacting RNAs (piRNAs) and their targets in Drosophila.

Authors:  Jian Lu; Andrew G Clark
Journal:  Genome Res       Date:  2009-11-30       Impact factor: 9.043

Review 6.  A novel epigenetic mechanism in Drosophila somatic cells mediated by Piwi and piRNAs.

Authors:  H Lin; H Yin
Journal:  Cold Spring Harb Symp Quant Biol       Date:  2009-03-06

7.  Specialized piRNA pathways act in germline and somatic tissues of the Drosophila ovary.

Authors:  Colin D Malone; Julius Brennecke; Monica Dus; Alexander Stark; W Richard McCombie; Ravi Sachidanandam; Gregory J Hannon
Journal:  Cell       Date:  2009-04-23       Impact factor: 41.582

8.  Distinct functions for the Drosophila piRNA pathway in genome maintenance and telomere protection.

Authors:  Jaspreet S Khurana; Jia Xu; Zhiping Weng; William E Theurkauf
Journal:  PLoS Genet       Date:  2010-12-16       Impact factor: 5.917

9.  Transcriptional analysis of the HeT-A retrotransposon in mutant and wild type stocks reveals high sequence variability at Drosophila telomeres and other unusual features.

Authors:  David Piñeyro; Elisenda López-Panadès; María Lucena-Pérez; Elena Casacuberta
Journal:  BMC Genomics       Date:  2011-11-23       Impact factor: 3.969

10.  rasiRNA pathway controls antisense expression of Drosophila telomeric retrotransposons in the nucleus.

Authors:  Sergey Shpiz; Dmitry Kwon; Yakov Rozovsky; Alla Kalmykova
Journal:  Nucleic Acids Res       Date:  2008-11-26       Impact factor: 16.971

View more
  3 in total

1.  Specific Localization of the Drosophila Telomere Transposon Proteins and RNAs, Give Insight in Their Behavior, Control and Telomere Biology in This Organism.

Authors:  Elisenda López-Panadès; Elizabeth R Gavis; Elena Casacuberta
Journal:  PLoS One       Date:  2015-06-12       Impact factor: 3.240

Review 2.  Transposable elements in Drosophila.

Authors:  Tabitha J McCullers; Mindy Steiniger
Journal:  Mob Genet Elements       Date:  2017-04-19

Review 3.  Regulatory RNAs in the light of Drosophila genomics.

Authors:  Antonio Marco
Journal:  Brief Funct Genomics       Date:  2012-09-05       Impact factor: 4.241

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.