| Literature DB >> 22606017 |
Mingzhou Sun1, Xiao Yin1, Fengxue Shi1, Lin Li1, Mingrui Li1, Linfeng Li1, Hongxing Xiao1.
Abstract
Polyploidy plays an important role in the evolution of plant genomes. To enable the investigation of the polyploidy events within the genus Anemone, we developed eighteen microsatellite markers from the hexaploid species A. amurensis (Ranunculaceae), and tested their transferability in five closely related species. The number of total alleles (N(A)) for each resulting locus varied from one to eight. The polymorphism information content (PIC) and Nei's genetic diversity (N(GD)) for these microsatellites ranged from 0.00 to 0.71 and 0.00 to 0.91, respectively. For each population, the N(A) was one to seven, and the values of PIC and N(GD) varied from 0.00 to 0.84 and 0.00 to 0.95, respectively. In addition, most of these microsatellites can be amplified successfully in the congeneric species. These microsatellite primers provide us an opportunity to study the polyploid evolution in the genus Anemone.Entities:
Keywords: A. amurensis; Anemone; microsatellite; polymorphism information content; polyploidy
Mesh:
Substances:
Year: 2012 PMID: 22606017 PMCID: PMC3344253 DOI: 10.3390/ijms13044889
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 6.208
Characteristics of 18 microsatellites for Anemone amurensis. Shown for each primer are the loci names, forward (F) and reverse (R) primer sequence, repeat motif (Repeat), size of cloned allele (Size), annealing temperature (Ta), Nei’s genetic diversity (NGD), number of alleles for each locus (NA), polymorphism information content (PIC) and GenBank accession numbers (GenBank). NGD marked with an asterisk indicates significant deviation from Hardy–Weinberg equilibrium (p < 0.01).
| Primer | Primer sequences (5′-3′) | Repeat | Size (bp) | Ta | NA | NGD | PIC | GenBank |
|---|---|---|---|---|---|---|---|---|
| BH84 | F: TTGCCATGGACCAATACTCG | (TG)9 | 172 | 48 | 6 | 0.91 | 0.59 | JQ518375 |
| BH86 | F: CAACCTTGCAAACCCCCTCA | (TG)16 | 209 | 48 | 4 | 0.82 | 0.71 | JQ518376 |
| BH112 | F: GCATAAGGAGTAGTCATTTCA | (AC)21 | 218 | 52 | 1 | 0.00 | 0.00 | JQ518377 |
| BH206 | F: TGTTGTTTCCCTTACTTGCC | (GT)22A | 157 | 48 | 6 | 0.50 | 0.36 | JQ518378 |
| BH235 | F: CATGGCCATTGGTATCAAAC | (GT)5A | 156 | 48 | 7 | 0.84 | 0.69 | JQ518379 |
| HS27 | F: GGAAGCATCATCTCACCTAC | (AC)7 | 182 | 50 | 4 | 0.66 | 0.71 | JQ518380 |
| HS37 | F: ACACAGATTCCACTCACCAC | (TC)7 | 198 | 50 | 8 | 0.87 | 0.57 | JQ518381 |
| HS47 | F: CACACGCAAACAGAAACACA | (TG)22 | 309 | 50 | 1 | 0.00 | 0.00 | JQ518382 |
| HS60 | F: CATCATGTGCATTGGTGTCT | (GT)18 | 154 | 50 | 1 | 0.00 | 0.00 | JQ518383 |
| HS117 | F: GAACACATCATTCATAGAGC | (GT)6 | 284 | 50 | 1 | 0.00 | 0.00 | JQ518384 |
| HS177 | F: GAAAATGTGACCGTCCCTAC | (AC)7 | 194 | 48 | 3 | 0.52 | 0.61 | JQ518385 |
| HS191 | F: GGAGAGTGGTGTAATACCCG | (TG)21 | 272 | 48 | 1 | 0.00 | 0.00 | JQ518386 |
| HS199 | F: GAGTGGAAGATCTGTGCAGG | (CA)8 | 199 | 50 | 7 | 0.86 * | 0.70 | JQ518387 |
| HS256 | F: CTGTTCCTCCGATGGCGTTT | (TG)7 | 211 | 50 | 5 | 0.76 | 0.50 | JQ518388 |
| HS263 | F: ACCAACTCACACACCAAATA | (TG)7 | 299 | 50 | 1 | 0.00 | 0.00 | JQ518389 |
| HS283 | F: ATGAGATGGGGATTTATGCC | (GT)6 | 183 | 50 | 1 | 0.00 | 0.00 | JQ518390 |
| HS316 | F: ACTTGGGAGGTTGTTTTTGG | (TG)6 | 189 | 50 | 4 | 0.74 | 0.54 | JQ518391 |
| HS321 | F: TGTGGAGGAAGAAGATGGTC | (CA)8 | 321 | 52 | 4 | 0.90 | 0.61 | JQ518392 |
Results of initial primer screening in Anemone amurensis. Parameters shown for each pair of primer are the number of the samples (N), number of alleles (NA), Nei’s genetic diversity (NGD) and polymorphism information content (PIC).
| Locus | Kuandian ( | Langxiang ( | Dunhua ( | ||||||
|---|---|---|---|---|---|---|---|---|---|
| NA | NGD | PIC | NA | NGD | PIC | NA | NGD | PIC | |
| BH84 | 5 | 0.87 | 0.71 | 6 | 0.84 | 0.67 | 5 | 0.94 | 0.57 |
| BH86 | 4 | 0.41 | 0.65 | 4 | 0.86 | 0.71 | 4 | 0.70 | 0.68 |
| BH112 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| BH206 | 6 | 0.52 | 0.83 | 6 | 0.00 | 0.83 | 6 | 0.54 | 0.84 |
| BH235 | 5 | 0.00 | 0.25 | 6 | 0.93 | 0.64 | 7 | 0.81 | 0.75 |
| HS27 | 4 | 0.85 | 0.73 | 3 | 0.23 | 0.66 | 4 | 0.67 | 0.70 |
| HS37 | 7 | 0.90 | 0.68 | 5 | 0.87 | 0.46 | 4 | 0.78 | 0.55 |
| HS47 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| HS60 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| HS117 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| HS177 | 2 | 0.17 | 0.50 | 3 | 0.66 | 0.54 | 3 | 0.00 | 0.65 |
| HS191 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| HS199 | 4 | 0.80 | 0.73 | 5 | 0.91 | 0.76 | 4 | 0.77 | 0.50 |
| HS256 | 3 | 0.95 | 0.45 | 5 | 0.67 | 0.50 | 4 | 0.81 | 0.53 |
| HS263 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| HS283 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
| HS316 | 3 | 0.69 | 0.48 | 3 | 0.79 | 0.66 | 4 | 0.67 | 0.47 |
| HS321 | 3 | 0.67 | 0.49 | 4 | 0.71 | 0.38 | 4 | 0.88 | 0.66 |
Cross-species amplification of the 18 microsatellite markers in five other species of the genus Anemone. For each primer pair, the number of individuals tested (N), monomorphic (M), polymorphic and number of alleles (P) and no-specific product (-) are given.
| Locus | |||||
|---|---|---|---|---|---|
| BH84 | P (3) | P (3) | P (2) | P (2) | P (3) |
| BH86 | - | - | - | - | - |
| BH112 | M | M | M | M | M |
| BH206 | - | P (4) | P (4) | P (2) | P (5) |
| BH235 | P (4) | P (4) | P (4) | P (5) | - |
| HS27 | - | M | M | M | - |
| HS37 | - | - | M | P (2) | P (2) |
| HS47 | - | - | P (2) | M | M |
| HS60 | - | - | M | M | - |
| HS117 | M | M | M | M | M |
| HS177 | - | - | P (2) | P (2) | P (2) |
| HS191 | M | M | M | M | M |
| HS199 | - | - | - | P (2) | M |
| HS256 | P (5) | - | - | P (2) | P (3) |
| HS263 | P (2) | M | P (2) | P (2) | P (2) |
| HS283 | M | - | M | M | M |
| HS316 | - | - | - | P (2) | - |
| HS321 | P (2) | - | P (2) | P (2) | P (3) |