Clear genetic distinctiveness between human- and pig-derived Trichuris based on analyses of mitochondrial datasets.

The whipworm, Trichuris trichiura, causes trichuriasis in ∼600 million people worldwide, mainly in developing countries. Whipworms also infect other animal hosts, including pigs (T. suis), dogs (T. vulpis) and non-human primates, and cause disease in these hosts, which is similar to trichuriasis of humans. Although Trichuris species are considered to be host specific, there has been considerable controversy, over the years, as to whether T. trichiura and T. suis are the same or distinct species. Here, we characterised the entire mitochondrial genomes of human-derived Trichuris and pig-derived Trichuris, compared them and then tested the hypothesis that the parasites from these two host species are genetically distinct in a phylogenetic analysis of the sequence data. Taken together, the findings support the proposal that T. trichiura and T. suis are separate species, consistent with previous data for nuclear ribosomal DNA. Using molecular analytical tools, employing genetic markers defined herein, future work should conduct large-scale studies to establish whether T. trichiura is found in pigs and T. suis in humans in endemic regions.

Introduction

Soil-transmitted helminths ( = geohelminths), including whipworm, are responsible for neglected tropical diseases (NTDs) of humans in developing countries [1]–[3]. Trichuris trichiura infects ∼600 million people worldwide. This parasite is transmitted directly via a direct, faecal-oral route. The thick-shelled (infective) eggs are ingested and then hatch, following gastric passage, in the small intestine. First-stage larvae (L1s) are released and migrate to the large intestine (caecum and colon), where they develop, following multiple moults, into adults (∼30–50 mm in length). The worms burrow their thin, thread-like anterior end into the mucosal lining of the large intestinal wall, feed on tissue fluids, mature and produce eggs. In the large intestines, large numbers of worms cause disease ( = trichuriasis), which is usually associated with entero-typhlocolitis and clinical signs, such as dysentery, bloody diarrhoea and/or rectal prolapse, in people with a high intensity of infection. Children (∼5–15 years of age) often harbour the largest numbers of worms [2]. Whipworms also infect other animal hosts, including non-human primates, pigs and dogs, and can cause clinical disease similar to trichuriasis of humans [4]–[6].

Based on current knowledge, Trichuris species are considered to specifically infect a particular host species or a group of related hosts. Trichuris species are usually identified based on host origin and the morphological features of the adult worm (spicule and pericloacal papillae) [7], [8]. However, it is not always possible to unequivocally identify and differentiate Trichuris species based on the morphology of adult worms alone. Importantly, T. trichuria cannot be unequivocally differentiated morphologically from T. suis or Trichuris from some other animals, such as non-human primates [7]. Over the years, there has been considerable discussion as to whether T. trichuira and T. suis are the same or distinct species [9]–[13], and whether humans can become infected with T. suis, and pigs with T. trichiura in endemic countries in which both host species live in close association. Although the authors of a recent molecular study suggested that T. suis is a separate species from T. trichiura [14], only a small number of specimens from one country (Spain) was used in this study, and amplicons (from the first and second internal transcribed spacers, ITS-1 and ITS-2, of nuclear ribosomal DNA) were subjected to cloning prior to sequencing, which has significant potential to lead to artefacts [15], [16]. Therefore, the findings from this study [14] need to be interpreted with some caution at this stage. Moreover, internal transcribed spacers (ITS) of nuclear ribosomal DNA might not be suited as specific markers for enoplid nematodes, because of sequence polymorphism (heterogeneity) that occurs within species (or individuals) [14], [17].

Given this heterogeneity in nuclear rDNA, barcoding from whole mitochondrial (mt) genomes (haploid) has major advantages, particularly when concatenated protein sequences derived from all coding genes are used as markers in comparative, phylogenetic-based analyses [18]–[25]. Therefore, in the present study, we (i) characterised the mt genomes of human-derived Trichuris and pig-derived Trichuris, (ii) compared these genomes and (iii) then tested the hypothesis that human-Trichuris and pig-Trichuris are genetically distinct in a phylogenetic analysis of sequence data sets representing both genomes and those from selected nematodes for comparative purposes.

Materials and Methods

Ethics statement

This study was approved by the Animal Ethics Committee of the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. For the collection of Trichuris from humans, the subjects provided informed, written consent. All pigs, from which Trichuris specimens were collected, were handled in accordance with good animal practices required by the Animal Ethics Procedures and Guidelines of the People's Republic of China.

Parasites and isolation of total genomic DNA

Adult specimens of Trichuris were collected from the caecum of a human patient during surgery in Zhanjiang People's Hospital in Zhanjiang, Guangdong Province, China. Adult specimens of Trichuris were also collected from the caecum from a pig slaughtered in an abattoir in Zhanjiang in the same province. Adult worms from each host were washed separately in physiological saline, identified morphologically [9], [26], fixed in 70% (v/v) ethanol and stored at −20°C until use. Total genomic DNA was isolated separately from two individual worms (coded Ttr2 and TsCS1 for human-Trichuris and pig-Trichuris, respectively) using an established method [27]. The region spanning ITS-1, the 5.8S gene and ITS-2 was amplified from each of these individuals by PCR using previously reported primers [14] and sequenced directly. The ITS-1 sequence of the human-Trichuris sample had 99.3% similarity with that of T. trichiura from human in Thailand (GenBank accession no. GQ352554). The ITS-1 and ITS-2 sequences of the pig-Trichuris sample had 98.6% and 98.5% similarity with that of T. suis from pigs in Spain (GenBank accession nos. AJ781762 and AJ249966, respectively) [14].

Long-range PCR-based sequencing of mt DNA

To obtain some mt gene sequence data for primer design, we amplified regions (400–500 bp) of the cox1 and nad1 genes by using (relatively) conserved primers JB3/JB4.5 and JB11/JB12, respectively [28], and of nad4 and rrnL genes using primers designed in this study (Table 1) by PCR. The amplicons were sequenced from both directions, using BigDye terminator v3.1, ABI PRISM 3730. We then designed primers (see Table 2) to regions within cox1, nad1, nad4 and rrnL and amplified from total genomic DNA (from an individual worm) the entire mt genome in three (for human-Trichuris) or four (for pig-Trichuris) overlapping fragments (of ∼2–4 kb each) between nad1 and nad4, nad4 and rrnL, and rrnL and cox1, cox1 and nad1. The cycling conditions used were 92°C for 2 min (initial denaturation), then 92°C for 10 s (denaturation), 50°C for 30 s (annealing), and 60–68°C for 10 min (extension) for 10 cycles, followed by 92°C for 10 s, 50°C for 30 s, and 60–68°C for 10 min for 20 cycles, with a cycle elongation of 10 s for each cycle and a final extension at 60–68°C for 7 min. Each amplicon, which represented a single band in a 0.8% (w/v) agarose gel, following electrophoresis and ethidium-bromide staining, was column-purified and then sequenced using a primer walking strategy [29].

Table 1

Sequences of primers for amplifying short-PCR fragments from human-Trichuris and pig-Trichuris.

Primer	Sequence (5′ to 3′)	Reference
Human-Trichuris
TTnad1F	CTTATATAGGTATTTCGTCAACGACG	This study
TTnad1R	TATTCATGCCTATAAATAGAAAAGCA	This study
TTnad4F	TAAGGCTCATGTWGAAGCTCCYG	This study
TTnad4R	ACCAAWGCAACAGAMGGAGGWGWAC	This study
TTrrnLF	TAAATGGCCGTCGTAACGTGACTGT	This study
TTrrnLR	AAAGAGAATCCATTCTATCTCGCAACG	This study
Pig-Trichuris
JB3	TTTTTTGGGCATCCTGAGGTTTAT	[28]
JB4.5	TAAAGAAAGAACATAATGAAAATG	[28]
JB11	AGATTCGTAAGGGGCCTAATA	[28]
JB12	ACCACTAACTAATTCACTTTC	[28]
TSnad4F	TAAGGCTCATGTWGAAGCTCCYG	This study
TSnad4R	ACCAAWGCAACAGAMGGAGGWGWAC	This study
TSrrnLF	TAAATGGCCGTCGTAACGTGACTGT	This study
TSrrnLR	AAAGAGAATCCATTCTATCTCGCAACG	This study

Table 2

Sequences of primers for amplifying mitochondrial DNA regions from human-Trichuris and pig-Trichuris.

Primer	Sequence (5′ to 3′)	Amplified region (cf. Fig. 1)
Human-Trichuris
TTnad1FTTnad4R	GGACGGACTCCATTTGATTTACT CTTCCTAGTGGGCATATTGTCTT	Partial nad1-(NCR-L)-K-nad2-M-F-nad5--H-R-partial nad4
TTnad4FTTrrnLR	GCGTAAGACAATATGCCCACTAG AAGACAATATGCCCACTAGGAAG	partial nad4-nad4L-T-P-nad6-cytb-S1--rrnS-V-partial rrnL
TTrrnLFTTnad1R	CCCCAGGGATAACAGCACAATAA GTAATCTTCCAAATAAGGCGAACT	Partial rrnL-atp6-cox3-W-Q-I-G-D-atp8--nad3-(NCR-S)-S2-N-L1-A-C-Y-cox1-cox2-L2-E-partial nad1
Pig-Trichuris
TSnad1FTSnad4R	AGCATACAGAAGAGTAACACACATA AATAACCGAGACAAACTACTAAATG	Partial nad1-(NCR-L)-K-nad2-M-F-nad5--H-R-partial nad4
TSnad4FTSrrnLR	ATGGTTATGTGTGTTACTCTTCTGT ATGTGTGTGTTATTCTGTACGCTGC	Partial nad4-nad4L-T-P-nad6-cytb-S1--rrnS-V-Partial rrnL
TSrrnLFTScox1R	CGTCGTAACGTGACTGTGCTAAGGT TAAAGCAAATTGGGTTTTTTGAAGA	Partial rrnL-atp6-cox3-W-Q-I-G-D-atp8--nad3-(NCR-S)-S2-N-L1-A-C-Y-partial cox1
TScox1FTSnad1R	TTTTAGGTTGTTTTGTATGAGGGCA AAAAAGTGGAATCCTTCTTGTGTCA	Partial cox1-cox2- L2-E-partial nad1

Sequence analyses

Sequences were assembled manually and aligned against the complete mt genome sequences of other nematodes (available publicly) using the computer program Clustal X 1.83 [30] to infer gene boundaries. The open-reading frames (ORFs) and codon usages of protein-coding genes were predicted using the program MacVector v.4.1.4 (Kodak), and subsequently compared with that of Trichinella spiralis [31]. Translation initiation and translation termination codons were identified based on comparison with those reported previously [31]. Codon usages were examined based on the relationships between the nucleotide composition of codon families and amino acid occurrence, for which codons are partitioned into AT rich codons, GC-rich codons and unbiased codons. The secondary structures of 22 tRNA genes were predicted using tRNAscan-SE [32] and/or manual adjustment [33].

Phylogenetic analyses

Amino acid sequences inferred from the 12 protein-coding genes (i.e. not atp-8) common among all of the nematodes included here were concatenated into a single alignment, and then aligned with those of 9 other enoplid nematodes (Trichinella spiralis, GenBank accession number NC_002681; Xiphinema americanum, NC_005928; Hexamermis agrotis, NC_008828; Agamermis sp., NC_008231; Romanomermis culicivorax, NC_008640; Romanomermis iyengari, NC_008693; Romanomermis nielseni, NC_008692; Strelkovimermis spiculatus, NC_008047; Thaumamermis cosgrovei, NC_008046), using the chromadorean nematode, Brugia malayi (NC_004298) as the outgroup. Any regions of ambiguous alignment were excluded using Gblocks (http://molevol.cmima.csic.es/castresana/Gblocks_server.html; Talavera and Castresana 2007) using stringent selection criteria (do not allow many contiguous nonconserved positions). Phylogenetic analyses were conducted using three methods: Bayesian inference (BI) analysis was conducted with four independent Markov chain runs for 1,000,000 metropolis-coupled MCMC generations, sampling a tree every 100th generation in MrBayes 3.1.1 [34]; the first 2,500 trees represented burn-in, and the remaining trees were used to calculate Bayesian posterior probabilities (pp). Maximum likelihood (ML) analyses were performed using PhyML 3.0 [35], and the (mtREV for amino acid sequences and GTR for rrnL nucleotide sequences) models were determined based on the Akaike information criterion (AIC). Bootstrap support was calculated using 100 bootstrap replicates. Maximum parsimony (MP) analysis was conducted using PAUP 4.0 Beta 10 [36], with indels treated as missing character states; 1,000 random additional searches were performed using TBR. Bootstrap support was calculated using 1,000 bootstrap replicates, and 100 random taxon additions in PAUP. Phylograms were drawn using the program Tree View v.1.65 [37].

Sequencing of rrnL and analysis

Two primers, rrnLF (5′-TAAATGGCCGTCGTAACGTGACTGT-3′) and rrnLR (5′- AAAGAGAATCCATTCTATCTCGCAACG-3′), were employed for PCR amplification and subsequent sequencing of a portion (471 bp for human-Trichuris and 482 bp for pig-Trichuris) of the large subunit of mt ribosomal RNA (rrnL) from multiple individuals of human- and pig-derived Trichuris (Table 3). The rrnL sequence from T. spiralis (accession number NC_002681) [31] was used as the outgroup in phylogenetic analyses, because this morphologically distinct species is related to Trichuris [38]. All rrnL sequences were aligned using Clustal X, and the alignment was modified manually, based on the predicted secondary structure of the rrnL for Trichuris [31], and then subjected to phylogenetic analysis using the same methods as described above.

Table 3

Trichuris samples from humans and pigs in different geographical locations in China.

Species	Sample codes	No. of individuals	Host	Geographical origin	Accession No.*
Human-Trichuris	TTGZ2-3,TTGZ5-8	6	Human	Zhanjiang, Guangdong	AM993017-AM993022
Pig-Trichuris	TSCS1-2	2	Pig	Changsha, Hunan	AM993023-AM993024
Pig-Trichuris	TSML	1	Pig	Miluo, Hunan	AM993025
Pig-Trichuris	TSPJ	1	Pig	Pingjiang, Hunan	AM993026
Pig-Trichuris	TSYY	1	Pig	Yiyang, Hunan	AM993027
Pig-Trichuris	TSYJ1-2	2	Pig	Yangjiang, Guangdong	AM993028-AM993029
Pig-Trichuris	TSZJ1-3	3	Pig	Zhanjiang, Guangdong	AM993030–AM993032

*: GenBank accession numbers of mitochondrial rrnL sequences of these Trichuris samples.

Results

Features of the mt genomes of Trichuris from the human or pig host

The complete mt genome sequences were 14,046 nt (human-Trichuris) and 14,436 nt (pig-Trichuris) in length, respectively (GenBank accession numbers GU385218 and GU070737). Each mt genome contains 13 protein-coding genes (cox1-3, nad1-6, nad4L, cytb, atp6 and atp8), 22 transfer RNA genes and two ribosomal RNA genes (rrnS and rrnL) (Table 4). The genes nad6 and cox3 overlapped by 25 bp (human-Trichuris); nad5 overlaps by 7 and 1 bp with tRNA-His, tRNA-Ser(AGN) by 8 and 3 bp with rrnS, tRNA-Asp by 13 and 4 bp with atp8 for human-Trichuris and pig-Trichuris, respectively. The atp8 gene is encoded (Fig. 1), as is typical for adenophorean nematodes [31]. The protein-coding genes are transcribed in different directions, as described for T. spiralis and X. americanum [31], [39]. Except for four protein-coding genes (nad2, nad5, nad4 and nad4L) and six tRNA genes (tRNA-Arg, tRNA-His, tRNA-Met, tRNA-Phe, tRNA-Pro and tRNA-Thr) encoded on the L-strand, all other genes were encoded on the H-strand. The AT-rich regions are located between nad1 and tRNA-Lys, and nad3 and tRNA-Ser(UCN), which differs from those of secernentean nematodes [19], [33]. The nucleotide composition of the entire mt genome is biased toward A and T, with T being the most favoured nucleotide and G being least favoured, which is consistent with mt genomes of some other nematodes for which mt genomic data are available [18], [19], [21], [31], [33]. The overall A+T content is 68.1% for human-Trichuris (33.6% A, 34.5% T; 15.0% G and 16.9% C) and 71.5% for pig-Trichuris (35.6% A, 35.9% T; 13.4% G and 15.1% C).

Table 4

Positions and nucleotide sequence lengths of mitochondrial genomes of human-Trichuris and pig-Trichuris.

Genes	Positions and nt sequence lengths (bp)		Strand	Ini/Ter codons*		Anticodons*
	Tt	Ts		Tt	Ts	Tt/Ts
cox1	1-1545	1-1542	H	ATG/TAA	ATG/TAG
cox2	1560–2234	1578–2258	H	ATG/TAA	ATG/TAA
tRNA-LeuUUR (L2)	2251-313 (63)	2271-2332 (62)	H			TAA
tRNA-Glu (E)	2318-2374 (57)	2337-2393 (57)	H			TTC
nad1	2397-3296	2415-3314	H	ATA/TAA	ATT/TAG
Non-coding region (NCR-L)	3297-3458	3315-3458	H
tRNA-Lys (K)	3459-3524 (66)	3459-3521 (63)	H			TTT
nad2	4406-3522	4414-3533	L	ATA/TAA	ATA/TAG
tRNA-Met (M)	4479-4419 (61)	4485-4424 (62)	L			CAT
tRNA-Phe (F)	4530-4474 (57)	4546-4488 (59)	L			GAA
nad5	6078-4531	6094-4538	L	ATA/TAA	ATA/TAG
tRNA-His (H)	6128-6072 (57)	6150-6094 (57)	L			GTG
tRNA-Arg (R)	6194-6130 (65)	6218-6152 (67)	L			ACG
nad4	7406-6195	7432-6224	L	ATG/TAA	ATA/TAA
nad4L	7682-7425	7901-7650	L	ATA/TAA	ATA/TAG
tRNA-Thr (T)	7744-7687 (58)	7962-7905 (58)	L			TGT
tRNA-Pro (P)	7802-7744 (59)	8023-7966 (58)	L			TGG
nad6	7795-8271	8016-8486	H	ATT/TAA	ATT/TAA
cytb	8278-9384	8501-9613	H	ATG/TAG	ATG/TAG
tRNA-SerAGN (S1)	9383-9432 (50)	9612-9666 (55)	H			GCT
rrnS	9425-10122	9664-10375	H
tRNA-Val (V)	10124-10180 (57)	10375-10431 (57)	H			TAC
rrnL	10180-11190	10440-11450	H
atp6	11173-12000	11422-12249	H	ATA/TAA	ATA/TAA
cox3	11975-12748	12259-13035	H	ATG/TAA	ATG/TAA
tRNA-Trp (W)	12755-12817 (63)	13040-13106 (67)	H			TCA
tRNA-Gln (Q)	12821-12874 (54)	13110-13166 (57)	H			TTG
tRNA-Ile (I)	12871-12937 (66)	13169-13234 (66)	H			GAT
tRNA-Gly (G)	12947-13003 (57)	13253-13308 (56)	H			TCC
tRNA-Asp (D)	13009-13067 (58)	13302-13363 (62)	H			GTC
atp8	13055-13219	13360-13530	H	ATA/TAG	TTG/TAA
nad3	13229-13570	13555-13896	H	ATA/TAA	ATA/TAA
Non-coding region (NCR-S)	13571-13663	13887-14003	H
tRNA-Ser UCN (S2)	13664-13715 (52)	14004-14055 (52)	H			TGA
tRNA-Asn (N)	13715-13768 (54)	14055-14113 (59)	H			GTT
tRNA-LeuCUN (L1)	13776-13842 (67)	14131-14193 (63)	H			TAG
tRNA-Ala (A)	13845-13899 (57)	14196-14250 (55)	H			TGC
tRN A-Cys (C)	13925-13979 (55)	14274-14328 (55)	H			GCA
tRNA-Tyr (Y)	13986-14046 (50)	14336-14394 (59)	H			TGT

*: Initiation and termination codons for protein-coding genes as well as their tRNA gene anticodons (starting from tRNA-T).

Tt: human-Trichuris; Ts: pig-Trichuris; Ini/Ter codons: initiation and termination codons.

Figure 1

Structure of the mitochondrial genome for human-Trichuris and pig-Trichuris.

Genes follow standard nomenclature [18], except for the 22 tRNA genes, which are designated using one-letter amino acid codes, with numerals differentiating each of the two leucine- and serine-specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families AGN and UCN, respectively). “NCR-L” refers to a large non-coding region; “NCR-S” refers to a small non-coding region.

Annotation

Protein-coding genes were annotated by aligning sequences and identifying translation initiation and termination codons by comparison with inference sequences for other nematodes. For both human-Trichuris and pig-Trichuris, the lengths of protein-coding genes were in the following order: nad5 (1548–1557 bp) >cox1>nad4>cytb>nad1>nad2>atp6>cox3>cox2>nad6>nad3>nad4L>atp8 (165–171 bp) (Table 4). The longest gene is nad5, and the lengths of the nad1 and nad3 genes are the same for human-Trichuris and pig-Trichuris (Table 5). The inferred nucleotide and amino acid sequences of each of the 13 mt proteins of human-Trichuris were compared with pig-Trichuris. For individual genes, the nucleotide and amino acid sequence differences between human-Trichuris and pig-Trichuris vary from 25.4 to 37.4% and 13.6 to 62.5%, respectively (Table 5).

Table 5

Differences in mitochondrial nucleotide and predicted amino acid sequences between human-Trichuris and pig-Trichuris.

Gene/region	Nucleotide sequence length		Nucleotide difference (%)	Number of aa		aa difference (%)
	Tt	Ts	Tt/Ts	Tt	Ts	Tt/Ts
atp6	828	828	39.6	275	275	49.5
nad1	900	900	33.1	299	299	33.1
nad2	885	882	34.1	294	293	40.8
nad3	342	342	33.6	113	113	31.9
nad4	1212	1209	40.9	403	402	58.3
nad4L	258	252	38.0	85	83	42.4
nad5	1548	1557	35.9	515	518	42.5
nad6	477	471	33.1	158	156	38.6
cox1	1545	1542	25.4	514	513	13.6
cox2	675	681	30.7	224	226	28.8
cox3	774	777	35.5	257	258	34.5
cytb	1107	1113	27.7	368	370	26.2
atp8	165	171	47.4	54	56	62.5
All 22 trns	1283	1306	25.4	-	-	-
rrnS	698	712	24.6	-	-	-
rrnL	1011	1011	25.1	-	-	-
Non-coding	255	261	36.6	-	-	-

Tt: human-Trichuris, Ts: pig-Trichuris, Trs: Trichinella spiralis, aa: amino acids.

A total of 3559 and 3562 amino acids are encoded in the mt genome of human-Trichuris and pig-Trichuris, respectively. As the mt genomes of nematodes can contain non-standard initiation codons [18], the identification of initiation codons can sometimes be challenging. For human-Trichuris, five genes (cox1, cox2, cox3, cytb and nad4) start with ATG and eight genes (nad1, nad2, nad3, nad5, nad6, nad4L, atp6 and atp8) use ATA. All genes have complete termination codons, 11 genes (cox1, cox2, cox3, nad1, nad2, nad3, nad4, nad4L, nad5, nad6 and atp6) use TAA and two genes (atp8 and cytb) use TAG as a termination codon, respectively. For pig-Trichuris, six genes (nad2, nad3, nad4 nad4L nad5 and atp6) start with ATA, four genes (cox1, cox2, cox3 and cytb) with ATG, and one gene (atp8) with TTG. All protein-coding genes have complete termination codon; seven genes (cox2, cox3, nad3, nad4, nad6, atp6 and atp8) stop with TAA and six genes (cox1, nad1, nad2, nad5, nad4L and cytb) use TAG. No abbreviated stop codons, such as TA or T, were detected. Such codons are known to occur in the mt genomes of other nematodes, such as Strongyloides stercoralis (cytb, nad4, nad1 and atp6) and T. spiralis (cytb and nad4) and Caenorhabditis elegans (nad1 and nad3) [19], [31], [40]. The atp8 gene was inferred by comparison with the homologous gene of T. spiralis. The ORF of this gene was located between genes tRNA-Asp and nad3 and inferred by the presence of a methionine for human-Trichuris and a leucine for pig-Trichuris.

Twenty-two tRNA genes were predicted from the mt genomes of human-Trichuris and pig-Trichuris and varied from 50 to 67 nt in length. Most of the tRNA genes are smaller than the corresponding genes in the mt genomes of other nematodes due to a reduced TΨC stem-loop region (TV-replacement loop) or DHU stem-loop region [39]. Most of the tRNA gene sequences can be folded into conventional secondary four-arm cloverleaf structures. In these tRNA, there is a strict conservation of the sizes of the amino acid acceptor stem (11–15 bp) and the anticodon loop (7 bp). Their D-loops consist of 5–9 bp. The two tRNA-Ser each contain the TΨC arm and loop, but lack the DHU arm and loop.

The two ribosomal RNA genes (rrnL and rrnS) of human-Trichuris and pig-Trichuris were inferred based on comparisons with sequences from T. spiralis; rrnL is located between tRNA-Val and atp6, and rrnS is located between tRNA-Ser(AGN) and tRNA-Val. The length of rrnL is 1011 bp for both human-Trichuris and pig-Trichuris. The lengths of the rrnS genes are 698 bp for human-Trichuris and 712 bp for pig-Trichuris. The A+T contents of rrnL for human-Trichuris and pig-Trichuris are 72.5% and 76.4%, respectively. The A+T contents of rrnS for human-Trichuris and pig-Trichuris are 69.9% and 75.4%, respectively.

Two AT-rich non-coding regions (NCRs) were inferred in the mt genomes of both human-Trichuris and pig-Trichuris. For these genomes, the long NCR (designated NCR-L; 162 bp and 144 bp in length, respectively) is located between the nad1 and tRNA-Lys (Fig. 1), has an A+T content of 71–72%. This overall A+T content is lower than those reported for nematodes (77.9–93.1%) studied to date [18], [19], [21], [33]. In this NCR, there are also 26 nt (human-Trichuris) and 17 nt (pig-Trichuris) AT dinucleotide repeats. Similar repeats have been detected in this region in C. elegans and A. suum [40]. For both human-Trichuris and pig-Trichuris, the short NCR (NCR-S; 93 bp and 117 bp in length) is located between genes nad3 and tRNA-Ser (UCN) (Fig. 1), with an A+T content of 65.6% and 84.6%, respectively. This region contains dinucleotide [AT]26 repeats and might form a hairpin loop structure (cf. AAAAAAAATTTTTTTTTT). Although nothing is yet known about the replication process in the mt DNA of parasitic nematodes, the high A+T content and the predicted structure of the AT-rich NCRs suggest an involvement in the initiation of replication [41].

Comparative analyses between human-Trichuris and pig-Trichuris

The full mt genome sequence of human-Trichuris (accession no. GU385218) was 14046 bp in length, 390 bp shorter than that of pig-Trichuris (accession no. GU070737). The arrangement of the mt genes (i.e., 13 protein genes, 2 rrn genes and 22 tRNA genes) and NCRs were the same. A comparison of the nucleotide sequences of each mt gene and NCR, as well as the amino acid sequences, conceptually translated from all protein genes of the two Trichuris, is given in Tables 4 and 5. The sequence lengths of individual genes and NCRs were the same for human-Trichuris and pig-Trichuris, except for variation of three to nine nucleotides in the each of 13 coding gene, 18 nucleotides in the first non-coding region and of one to nine nucleotides in each of 22 tRNA genes (Table 4). The magnitude of sequence variation in each gene and NCR between human-Trichuris and pig-Trichuris ranged from 24.6–47.4%. Sequence difference across the entire mt genome was 32.87%. The greatest variation was in the atp8 gene (47.4%), whereas least differences (24.6% and 25.1%) were detected in the rrnS and rrnL subunits, respectively (Table 5).

Amino acid sequences inferred from individual mt protein genes of human-Trichuris were compared with those of pig-Trichuris. The amino acid sequence differences ranged from 13.6–62.5%, with COX1 being the most conserved protein, and ATP8 the least conserved. There were 1299 amino acid substitutions (for an alignment length of 3559 and 3562 positions) in the 13 proteins, the majority of which were in the proteins NAD4 (n = 235), NAD5 (n = 220) and NAD2 (n = 120). Of the 1299 amino acid substitutions, 407 (31.3%) represented potentially informative characters, the greatest number of them being in the proteins NAD1 (n = 84), NAD5 (n = 55) and ATP6 (n = 37). The phylogenetic analyses of amino acid sequence datasets using B. malayi as the outgroup reflected the clear genetic distinctiveness between human-Trichuris and pig-Trichuris and also the grouping of these two members of Trichuris with T. spiralis (Trichocephalida), with absolute support, to the exclusion of members of the Dorylaimida and Mermithida (Fig. 2).

Figure 2

Inferred phylogenetic relationship among enoplid nematodes.

The phylogenetic relationship was inferred based on the concatenated amino acid sequences of 12 protein-coding genes (with the exception of atp8) by Bayesian (BI), maximum likelihood (ML) and maximum parsimony (MP) analyses, using Brugia malayi (a chromadorean nematode) (NC_004298) as the outgroup. The numbers along branches indicate bootstrap values resulting from different analyses in the order: BI/ML/MP.

Comparison of the mt genomes of human-Trichuris and pig-Trichuris showed that the rrnS and rrnL were the two most conserved genes (Table 5). Sequence variation in part of the rrnL gene was assessed among 16 individuals of Trichuris from humans and pigs (Table 3). Sequences of the 6 human-Trichuris individuals were of the same length (419 bp). Nucleotide variation among the 6 human-Trichuris individuals was detected at 4 sites (sequence positions 206, 228, 233 and 274; GenBank accession numbers AM993017–AM993022). Sequences of the 10 pig-Trichuris individuals were of the same length (430 bp). Nucleotide variation also occurred at 4 sites (sequence positions 184, 233, 318 and 395, GenBank accession numbers AM993023–AM993032).

The alignment of the partial rrnL sequences revealed that all individuals of human-Trichuris differed at 89 nucleotide positions when compared with pig-Trichuris. These differences included 15 indels, 16 purine transitions (A<->G) and 19 transversion (A<->T). Phylogenetic analyses of the rrnL sequence data revealed strong support for the separation of human-Trichuris from pig-Trichuris individuals into two distinct clades, and the trees produced using the three different methods were essentially the same in topology (Fig. 3). Sixteen of the 89 nucleotide differences were considered as derived (i.e., autapomorphic) characters, using T. spiralis as the outgroup.

Figure 3

Inferred phylogenetic relationship among representative Trichuris samples from humans and pigs.

The phylogenetic relationship was inferred by Bayesian (BI), maximum likelihood (ML) and maximum parsimony (MP) analyses of mitochondrial rrnL sequence data, using Trichinella spirialis as the outgroup. The numbers along branches indicate bootstrap values from different analyses in the order: BI/ML/MP.

Discussion

A substantial level of nucleotide difference (32.9%) was detected in the complete mt genome between an individual of human-Trichuris and pig-Trichuris from China. The sequence variation detected in the 13 protein-coding genes (25.4–47.4%) and in NCRs (36.6%) was consistent with previous findings of variation in the nucleotide sequences of the nuclear ITS rDNA from human and pig [14]. However, for many nematodes [42], [43], there is usually greater within-species variation in mt protein-coding genes than in the ITS. For example, the magnitude of the nucleotide sequence variation in the 12 common mt protein genes (3–7%) [20] was greater than the 15 (1.8%) variable positions in the ITS (over 852 bp) detected among multiple individuals of the human hookworm, N. americanus [44].

Comparison between human- and pig-derived Trichuris from China also revealed variation at 1299 amino acid positions in the 13 predicted mt protein sequences. This level of amino acid variation (36.4%) is very high, given that mt proteins are usually conserved within a species due to structural and functional constraints [45]. In addition, previous studies of other nematodes have detected little to no within-species variation in protein sequences. For example, no within-species variation was detected in a COX1 region of 131 amino acids for N. americanus and for related hookworms, including A. caninum Ancylostoma and A. duodenale [24], [33]. Similarly, amino acid substitutions were recorded at only two of 196 (1%) positions (based on a comparison of conceptually translated sequences originating from GenBank accession nos. AF303135-AF303159) in partial COX1 among 151 N. americanus samples from four locations in China [46]. In the present study, the greatest numbers of amino acid differences between human-Trichuris and pig-Trichuris were in the NAD4 (n = 235; 40.9%), NAD5 (n = 220; 35.9%) and NAD2 (n = 120; 34.1%) sequences; these percentages were significantly higher than that (4.9–10%) between the two hookworms A. caninum and A. duodenale [24], [33]. The nature, extent and significance of the amino acid sequence variation between Trichuris from the human and pig hosts and from different geographical origins needs to be evaluated further, because there is virtually no published data on the magnitude of within-species variation in mt protein sequences for members of the genus Trichuris.

Genetic variation between human- and pig-Trichuris was also detected here in the two mt ribosomal RNA gene subunits (rrnL and rrnS). These subunits are usually more conserved in sequence than the protein genes [45], which is also supported by the present data. Comparison of the complete mt genomic data set between the two Trichuris individuals (Ttr2 and TsCS1) displayed less sequence variation in rrnS and rrnL (24.6% and 25.1%) compared with most protein genes (25.4–47.4%) and the non-coding regions (36.6%) (Table 5). A region (∼430 bp) in the conserved rrnL gene was used to examine the magnitude of genetic variation in Trichuris between the two different host species. A comparison of the partial rrnL sequences among 16 Trichuris individuals revealed 89 (20.7%) variable positions between human-Trichuris and pig-Trichuris, which is comparable with previous findings of a significant genetic difference (17%) in nuclear ITS between the two operational taxonomic units (OTUs) in Spain [14]. Taken together, the molecular evidence presented here supports the hypothesis that the gene pools of human-Trichuris and pig-Trichuris have been isolated for a substantial period of time and that they represent distinct species. In spite of the genetic distinctiveness recorded here between them, host affiliation is not strict [47]. Cross-infection of Trichuris between humans and pigs (both directions) has been described, but infection in the heterologous host is usually abbreviated [47].

In spite of the compelling evidence of genetic distinctiveness between Trichuris specimens from human and pig hosts, interpretation from this study needs to be somewhat guarded until detailed population genetic investigations have been conducted. Future studies could (i) explore, in detail, nucleotide variation in ribosomal and mt DNAs within and among Trichuris populations from humans and pigs from a range of different countries employing, for example, mutation scanning-coupled sequencing [27], (ii) establish, using accurate molecular tools, whether there is a particular affiliation between Trichuris and host in endemic regions and whether cross-host species infection is common or not, and (iii) attempt to establish an experimental infection of Trichuris of human origin in pigs, in order to be able to investigate the genetic and reproductive relationships between human-Trichuris and pig-Trichuris. Moreover, given the advent of high throughput genomic sequencing technologies, and the recent success in sequencing the nuclear genomes of the parasitic nematodes, B. malayi [48] and Ascaris suum [49], it is conceivable that the genomes of human-Trichuris and pig-Trichuris will be characterized in the near future. The transcriptome, and inferred proteome, characterised recently [50] will assist in future efforts to decode these genomes. Such work will pave the way for future fundamental molecular explorations and the design of new methods for the treatment and control of one of the world's socio-economically important nematodes [3]. This focus is important, given the impact of Trichuris and other soil-transmitted helminths (STHs), which affect billions of people and animals world-wide. Although Trichuris species are seriously neglected, genomics and related approaches provide new opportunities for the discovery of novel intervention strategies, with major implications for improving animal and human health and well being globally. In addition, the implications of genomic studies could also be highly relevant in relation to finding new treatments for immune-pathological diseases of humans [50]. Interestingly, various studies [51]–[55] have indicated that iatrogenic infections of human patients suffering from immunological disorders (such as inflammatory bowel disease, IBD) with nematodes, such as pig-Trichuris eggs can significantly suppress clinical symptoms. Although the mechanisms by which Trichuris modulates the human immune system are still unclear [52], [56], [57], studies have proposed that a modified CD4+ T helper 2 (Th2)-immune response and the production of anti-inflammatory cytokines, such the interleukins (IL-) IL-4 and IL-10, contribute to the inhibition of effector mechanisms [56], [58], [59]. Therefore, detailed investigations of pig-Trichuris at the molecular level could provide enormous scope for studying immuno-molecular mechanisms that take place between the parasite and humans affected by autoimmune or other immune diseases. The mt genetic markers defined in the present study should be useful to verify the specific identity of Trichuris employed in such studies.