Literature DB >> 22318606

Functional dissection of lysine deacetylases reveals that HDAC1 and p300 regulate AMPK.

Yu-yi Lin1, Samara Kiihl, Yasir Suhail, Shang-Yun Liu, Yi-hsuan Chou, Zheng Kuang, Jin-ying Lu, Chin Ni Khor, Chi-Long Lin, Joel S Bader, Rafael Irizarry, Jef D Boeke.   

Abstract

First identified as histone-modifying proteins, lysine acetyltransferases (KATs) and deacetylases (KDACs) antagonize each other through modification of the side chains of lysine residues in histone proteins. Acetylation of many non-histone proteins involved in chromatin, metabolism or cytoskeleton regulation were further identified in eukaryotic organisms, but the corresponding enzymes and substrate-specific functions of the modifications are unclear. Moreover, mechanisms underlying functional specificity of individual KDACs remain enigmatic, and the substrate spectra of each KDAC lack comprehensive definition. Here we dissect the functional specificity of 12 critical human KDACs using a genome-wide synthetic lethality screen in cultured human cells. The genetic interaction profiles revealed enzyme-substrate relationships between individual KDACs and many important substrates governing a wide array of biological processes including metabolism, development and cell cycle progression. We further confirmed that acetylation and deacetylation of the catalytic subunit of the adenosine monophosphate-activated protein kinase (AMPK), a critical cellular energy-sensing protein kinase complex, is controlled by the opposing catalytic activities of HDAC1 and p300. Deacetylation of AMPK enhances physical interaction with the upstream kinase LKB1, leading to AMPK phosphorylation and activation, and resulting in lipid breakdown in human liver cells. These findings provide new insights into previously underappreciated metabolic regulatory roles of HDAC1 in coordinating nutrient availability and cellular responses upstream of AMPK, and demonstrate the importance of high-throughput genetic interaction profiling to elucidate functional specificity and critical substrates of individual human KDACs potentially valuable for therapeutic applications.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22318606      PMCID: PMC3277212          DOI: 10.1038/nature10804

Source DB:  PubMed          Journal:  Nature        ISSN: 0028-0836            Impact factor:   49.962


To study the functional specificity of individual KDACs, we developed a genome-wide genetic interaction profiling technology in cultured human cells by RNA interference (RNAi) using pooled TRC (The RNAi Consortium) human shRNA library[12] and complexity deconvolution using a half-hairpin microarray (Fig. 1a). Microarray performance was evaluated (Supplementary Fig. 1a–1d), and correlations between technical (Supplementary Fig. 1e) and biological replicates (Supplementary Fig. 1f) confirmed high methodologic reproducibility.
Figure 1

Overview of human KDAC genetic interaction screen

a, Scheme of pooled shRNA-based primary screen. Selectively depleted and enriched shRNA clones in query KDAC knockdown cells indicate synthetic lethal (negative/aggravating) and rescue (positive/alleviating) interactions, respectively. b, Ratio of positive to negative genetic interactions for each query KDAC varies across genome. Blue dashed line indicates average ratio of all KDAC genetic interactions (~1:2.6). c, Functional classification of validated KDAC genetic interaction partner genes based on GO biological process annotations. P-values indicate significant enrichment for genes in corresponding biological processes.

In the screen, we used stable polyclonal HCT116 cells expressing shRNAs targeting firefly luciferase (shLuciferase) as control. We checked the knockdown efficiency of individual shRNAs for twelve human KDACs (HDAC1~4, HDAC6~9, SIRT1~3 and SIRT5) by immunoblotting (Supplementary Fig. 2a) or quantitative PCR (Supplementary Fig. 2b), and generated stable polyclonal query cell lines expressing two shRNAs with the highest knockdown efficiency for each KDAC. The other six KDACs (HDAC5, HDAC10~11, SIRT4 and SIRT6~7) were not tested due to unsatisfactory knockdown efficiency with available shRNAs. After transduction by TRC shRNA lentiviral pools, “benchmark samples” and “end samples” were harvested before and after puromycin selection, respectively. Half-hairpin barcode library of each sample was recovered and hybridized to the microarray (Fig. 1a). Genes for which multiple shRNAs exceeded the threshold in either of two query lines for that KDAC were further validated by a cell viability assay (Supplementary Fig. 3). 878 genetic interactions of human KDACs were validated from 6307 candidates (Supplementary Table 1 and 2). Query KDACs have mostly negative genetic interactions, excepting HDAC6, SIRT3 and SIRT5 (Fig. 1b and Supplementary Table 2), with an average positive to negative ratio ~ 1:2.6, similar to observations in other human genes (1:3.8) and yeast genes (1:5.5)[14]. We arranged query KDAC genes by hierarchical clustering of genetic interaction pattern similarities and observed that KDACs of the same class co-clustered (Supplementary Fig. 4). Consistent with sharing common genetic interactions and biological functions, we also observed frequent aggravating interactions between same-class KDACs (Supplementary Fig. 5), including HDAC1-HDAC2 as previously shown[15], and four newly identified pairs (HDAC3-HDAC8, HDAC4-HDAC5, SIRT1-SIRT2 and SIRT3-SIRT5). On the contrary, alleviating interactions often exist between KATs and KDACs, suggesting that cells need to maintain homeostatic protein acetylation levels for viability, similar to observations in yeast[16]. This finding is also consistent with the alleviating interactions between class I KDACs and ACLY (ATP-citrate lyase), the main source of intracellular acetyl-CoA, which controls KAT activity in human cells[6]. Functional classification by Gene Ontology (GO) annotation analysis revealed that several biological processes including metabolism, cell cycle and development are enriched among 615 genetic interaction partners (Fig. 1c and Supplementary Table 3). We also observed enrichment of corepressors (Supplementary Table 4), consistent with crucial functions of KDACs in transcriptional regulation extending beyond histones. Interestingly, genes with predominantly negative interactions tend to be required for normal cell cycle progression in yeast[17], similar to these findings. Beyond functional redundancy, distinct genetic interaction profiles also reveal functional hierarchies such as specific enzyme-substrate relationships. Consistent with this principle, we observed substantial overlap of the interaction profiles between knockdowns and catalytically-defective (H199F) HDAC1[18] (Supplementary Table 5), and also significant enrichment of coexistent protein-protein interactions between KDACs and their interaction partners (Supplementary Table 6). Using a manually curated dataset of human acetylated proteins[3-5], we observed significant enrichment of acetylation among KDAC genetic interaction partners (Supplementary Table 7), prompting the question “Are these substrates of the corresponding query KDACs?” In vitro and in vivo deacetylation assays confirmed many such enzyme-substrate relationships (28 of 50, 56%, Supplementary Fig. 6 and Supplementary Table 8) but not others (Supplementary Fig. 7–10 and Supplementary Table 8). Most of the validated substrates (22/26 or 84.6%) have metabolic functions in maintaining macromolecular homeostasis. Differentiating HDAC1 from HDAC2 biochemically is challenging due to extensive sequence homology and frequent co-membership in protein complexes[19]. Using a functional genetics approach we efficiently identified HDAC1-specific substrates and functions. Nearly all AMPK subunit isoforms are negative genetic interacting partners of HDAC1 but not HDAC2 (Supplementary Table 2). To further investigate biological significance, we confirmed the negative genetic interaction between PRKAA1 and HDAC1 in HCT116 (Fig. 2a), HepG2 (Supplementary Fig. 11a) and IMR-90 cells (Supplementary Fig. 11b). Two efficient shRNAs each were selected for HDAC1 (Supplementary Fig. 2a and 12a) and PRKAA1 (Supplementary Fig. 12b). Previously identified as an acetylated protein[3], we investigated the in vivo acetylation status of endogenous PRKAA1 in HCT116 cells. Consistent with genetic interaction between PRKAA1 and HDAC1 but not the other KDACs examined, we uncovered a substantial increase of the fraction of endogenous PRKAA1 acetylated only in HDAC1 knockdown (Fig. 2b). A similar approach was applied to identify p300 as the likely major acetyltransferase for PRKAA1 in HCT116 cells (Fig. 2b and Supplementary Fig. 12c). This finding is consistent with alleviating genetic interactions between counteracting p300 and HDAC1 (Supplementary Fig. 5 and Supplementary Table 2). The enzyme-substrate relationships were also conserved in HepG2 cells (Fig. 2c) and IMR-90 cells (Supplementary Fig. 13a). The significant increase of endogenous PRKAA1 acetylation in HepG2 cells treated with class I/II KDAC inhibitor trichostatin A (TSA) but not class III KDAC inhibitor nicotinamide (Supplementary Fig. 13b) is consistent with the specific enzyme-substrate relationship between HDAC1 and PRKAA1.
Figure 2

Negative genetic interactions and enzyme-substrate relationship between HDAC1 and PRKAA1

a, Synthetic lethality was observed in HCT116 cells. Results are presented with error bars indicating ±1 SEM from three biological replicates. Significance was tested by a quasi-Poisson model. Triple asterisk, p < 0.001. b, c, In vivo acetylation assays show that endogenous PRKAA1 protein is deacetylated by HDAC1 and acetylated by p300 in HCT116 (b) and HepG2 (c) cells. d, In vivo acetylation changes in GST-PRKAA1 in response to HDAC1 and p300 knockdown. e, Sequential mutation of three acetylable lysine residues (K40, K42 and K80; or K31, 33 and 71 in another reading frame) to arginine progressively diminished acetylation signal of GST-PRKAA1. 1KR, K80R; 2KR, K40/42R; 3KR, K40/42/80R. f, A conventional HAT activity assay revealed significantly diminished in vitro p300 acetylation of PRKAA1-3KR. g, PRKAA1 is deacetylated in vitro by HDAC1 (activity inhibited by TSA), but not SIRT1.

Three potential acetylation sites in PRKAA1, lysine (K) 40, 42 and 80 had been identified by tandem mass spectrometry[3]. To examine their physiological relevance, we introduced GST-tagged wild-type PRKAA1 into HepG2 cells. The recombinant GST-PRKAA1 co-immunoprecipitated with endogenous AMPK regulatory β (PRKAB1) and γ (PRKAG1) subunits (Supplementary Fig. 14), supporting complex formation in these cells. Acetylation status of GST-PRKAA1 changed in parallel to endogenous PRKAA1 upon knockdown of HDAC1 or p300 (Fig. 2d), and also decreased incrementally as the three lysine residues were sequentially mutated to arginine to mimic constitutive deacetylation (Fig. 2e). In vitro acetylation revealed that p300-dependent acetylation of PRKAA1 from HepG2 cells largely required these three lysine residues (Fig. 2f and Supplementary Fig. 15). Moreover, affinity-purified HDAC1 complex effectively deacetylated purified PRKAA1 in vitro, an activity inhibited by TSA, whereas purified SIRT1 did not (Fig. 2g). The three acetylable lysine residues are completely conserved in human PRKAA2, the other AMPK catalytic subunit homolog. We evaluated the in vivo acetylation of endogenous PRKAA2 in HepG2 cells and discovered similar changes of acetylation upon HDAC1 or p300 knockdown (Supplementary Fig. 16a). In contrast, acetylation status of PRKAG1 and PRKAG2 was unaffected by HDAC1 knockdown (Supplementary Fig. 16b). AMPK is both an important sensor and regulator of energy homeostasis in maintaining the balance of ATP consumption and production in eukaryotic cells[20]. AMPK is activated when intracellular energy status is compromised by metabolic stress that increases AMP/ATP and ADP/ATP ratios[21,22]. In energy-deprived conditions, a crucial threonine residue in the activation loop of the catalytic subunit (T183 of PRKAA1 or T172 of PRKAA2) is phosphorylated by upstream kinases, and the high concentration of AMP and ADP allosterically binds the γ subunit and protects AMPK against dephosphorylation[21-25]. The activated AMPK in turn phosphorylates various downstream effector proteins to switch on catabolic pathways, enhance transcription of stress-response genes and reduce protein synthesis[20,26]. To investigate whether acetylation of AMPK catalytic subunit regulates its activity, we examined the correlation between PRKAA1 acetylation and phosphorylation of the critical threonine residue by immunoblotting. Consistent with previous findings, PRKAA1 phosphorylation increased upon energy deprivation by lowering glucose concentration or by adding the AMP analog, 5-aminoimidazole-4-carboxamide riboside (AICAR) (Fig. 3a). PRKAA1 acetylation and phosphorylation were oppositely regulated, suggesting acetylation might be negatively correlated with AMPK activity (Fig. 3a). Moreover, decrease of the endogenous PRKAA1 acetylation upon glucose deprivation is largely reverted in HDAC1 knockdown (Fig. 3b). Basal levels of endogenous PRKAA1 phosphorylation in 5 mM glucose increased and diminished dramatically upon knockdown of p300 and HDAC1, respectively, whereas enhancement of phosphorylation reactive to AICAR treatment was greatly damped in both knockdowns (Fig. 3c). The changes of basal and AICAR-reactive phosphorylation discovered in acetylation (3KQ) and deacetylation (3KR) mimics of FLAG-tagged PRKAA1 in HepG2 cells were similar to those seen in response to HDAC1 and p300 knockdown, respectively (Fig. 3d), suggesting that acetylation of these three lysine residues critically modulates enzyme activation by phosphorylation.
Figure 3

Deacetylation of PRKAA1 increases phosphorylation and activity

a, Acetylation and phosphorylation signal of endogenous PRKAA1 upon different glucose concentration or AICAR treatment (2 mM) in HepG2 cells. b, Knockdown of HDAC1 preserves acetylation signal of endogenous PRKAA1 upon glucose deprivation. c, Knockdown of p300 or HDAC1 changes basal and responsive level of phosphorylation of endogenous PRKAA1. d, Deacetylation (3KR) and acetylation (3KQ) mimics of PRKAA1 increase and decrease basal and responsive level of phosphorylation, respectively. e, Consistent with changes of PRKAA1 phosphorylation and activity, perturbations that decrease (p300 knockdown) or increase (HDAC1 knockdown) acetylation cause increase and decrease of ACC phosphorylation, respectively. f, Deacetylation (3KR) and acetylation (3KQ) mimics of PRKAA1 increase and decrease ACC phosphorylation, respectively. g, Acetylation of PRKAA1 regulates intracellular lipid droplet abundance assessed by oil red O staining. Error bars are as in Fig. 2.

AMPK phosphorylates and inactivates acetyl-CoA carboxylase (ACC) to shut down fatty acid synthesis and enhance fatty acid oxidation[20]. Using ACC phosphorylation as an intracellular indicator of AMPK enzymatic activity, the observed increases and decreases of ACC phosphorylation were consistent with the proposed trend of AMPK activity change in response to p300 and HDAC1 knockdown, respectively (Fig. 3e). We further showed that regulation of ACC phosphorylation is also controlled mainly by acetylation of the three critical PRKAA1 lysines (Fig. 3f, Supplementary Fig. 17a and 17b). Consistent with a negative impact of PRKAA1 acetylation on ACC phosphorylation, intracellular lipid droplet content dropped and rose in low and high acetylation conditions, respectively (Fig. 3g). PRKAA1 phosphorylation is reduced and unresponsive to changes of PRKAA1 acetylation in HepG2 cells with knockdown of LKB1 (Fig. 4a and Supplementary Fig. 18a) or in HeLa cells lacking LKB1 expression (Supplementary Fig. 18b), suggesting that the opposite levels of PRKAA1 acetylation and phosphorylation depend on LKB1. A possible mechanism underlying this observation is the direct regulation of physical interaction between PRKAA1 and LKB1 by lysine acetylation. We examined the binding between recombinant or endogenous PRKAA1 and LKB1 by co-immunoprecipitation and observed enhanced and weakened binding in conditions of low (p300 knockdown or PRKAA1-3KR mutant) and high (HDAC1 knockdown or PRKAA1-3KQ mutant) PRKAA1 acetylation, respectively (Fig. 4b and 4c). Consistently, acetylation of purified PRKAA1 also negatively controlled its phosphorylation by LKB1 in vitro (Fig. 4d and Supplementary Fig. 18c), and its own kinase activity (Fig. 4e). These findings suggest acetylation on PRKAA1 leads to inhibition of its physical interaction with LKB1, and subsequent phosphorylation and activation of itself and downstream effector proteins. Therefore, HDAC1 serves as the critical metabolic regulator to govern deacetylation and subsequent activation of AMPK to adaptively turn on catabolic processes and switch off anabolic pathways in human liver cells upon energy deprivation (Fig. 4f).
Figure 4

Deacetylation of PRKAA1 specifically enhances physical interaction with LKB1 kinase

a, Phosphorylation of endogenous PRKAA1 is reduced and unresponsive to acetylation status upon knockdown of LKB1. b, c, Acetylation of PRKAA1 inhibits physical interaction between LKB1 and recombinant PRKAA1 (b) or endogenous PRKAA1 (c) assessed by co-immunoprecipitation. d, Acetylation of PRKAA1 regulates phosphorylation by LKB1 in vitro. e, Acetylation of PRKAA1 regulates its kinase activity. Error bars are as in Fig. 2. f, Schematic model for crosstalk between acetylation and phosphorylation of AMPK catalytic subunit PRKAA1 governed by counteracting HDAC1 and p300. Nucleocytoplasmic translocation of AMPK may required to approach p300 and HDAC1 in the nucleus and LKB1 in the cytoplasm. Ac, acetylation; Ph, phosphorylation; NE, nuclear envelope. Solid lines indicate the paths implicated in previous and present studies; dashed lines indicate those paths hypothesized as part of this study.

With the increasing use of KDAC inhibitors for treatment of neoplastic and neurodegenerative diseases[27,28] and also generation of induced pluripotent stem cells[29], it becomes critical to understand the molecular mechanisms underlying these effects. Despite the potential limitation in terms of cell line and phenotype specificity, the genome-wide genetic interaction profiling of human KDACs described here helps identify a multitude of specific substrates of individual KDACs. We further report important metabolism-regulating roles of HDAC1 to govern crosstalk between acetylation and phosphorylation of AMPK catalytic subunit by controlling physical interaction with the upstream kinase LKB1 that modulates AMPK activity and thus lipid metabolism in human liver cells. The knowledge of enzyme-substrate relationships of individual KDACs and the “induced essentiality” of genes upon KDAC knockdown, combined with the recent development of selective KDAC inhibitors[30] should pave the way for future molecular targeted therapy through inhibition of specific KDACs.

METHODS SUMMARY

All human cell lines were obtained from ATCC unless mentioned otherwise. Knockdown efficiency of query KDAC shRNAs was assayed using immunoblotting and quantitative PCR; the two shRNAs with maximal knockdown effect for each query were used to generate stable polyclonal query cell lines. The primary screen was performed on a custom half-hairpin microarray as previously described[12] with further optimization. Genetic interactions between target and query genes were identified using normalized log2 ratios of Cy5 to Cy3 signal intensities of the benchmark and final samples. Genes for which multiple shRNAs exceeded the threshold were further validated by a cell viability assay in 96-well format. Enzyme-substrate relationships of genetic interacting partners and their query KDACs were confirmed by in vitro and in vivo deacetylation assays. The effects of (de)acetylation conducted by counteracting HDAC1 and p300 on PRKAA1 phosphorylation and activation were demonstrated using biochemical experiments. The microarray data set reported in this paper were deposited in Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) with accession number GSE29662. For more details on experimental procedures and data analysis see Methods.

METHODS

Mammalian cell culture and treatment

All human cell lines were obtained from ATCC unless mentioned otherwise. HCT116, HEK 293T and HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO) containing 10% fetal bovine serum (FBS, GIBCO), 100 units/mL penicillin and 100 µg/mL streptomycin at 37°C in a humidified atmosphere containing 5% CO2. HepG2 and IMR-90 cells were cultured in minimum essential medium (MEM, GIBCO). The shRNAs (all obtained from TRC shRNA library) targeting GFP, firefly luciferase (both as control) or candidate genetic interaction partner genes of query KDACs were used for transfection of the packaging HEK 293T cells with helper vectors (psPAX2 and pMD2.G, Addgene) using Fugene 6 transfection reagent (Roche) according to the manufacturer’s instructions. Medium containing lentiviral particles was harvested, filtered, aliquoted and stored at −80°C. These viruses were used to transduce 106 cells in the presence of 8 µg/mL polybrene (Sigma-Aldrich). Transduced cells were selected in appropriate medium containing puromycin (Sigma-Aldrich). Knockdown efficiency was assayed using immunoblotting and quantitative PCR. The two shRNAs with the greatest knockdown effect for each query were cloned from pLKO.1 vector into the NdeI-BamHI sites of pLKO.1-hPGK-Neo vector (Sigma-Aldrich), and then packaged into lentivirus to transduce cells followed by selection in appropriate medium containing geneticin (GIBCO) to generate stable polyclonal query cell lines. The TRCN numbers and sequences of the shRNAs used to generate stable cell lines for primary screen and further characterization experiments in this study are: shLuciferase, CGCTGAGTACTTCGAAATGTC; shGFP, TACAACAGCCACAACGTCTAT; shHDAC1#1 (TRCN0000004814), CGTTCTTAACTTTGAACCATA; shHDAC1#5 (TRCN0000004818), GCTGCTCAACTATGGTCTCTA; shHDAC2#1 (TRCN0000004819), CAGTCTCACCAATTTCAGAAA; shHDAC2#3 (TRCN0000004821), GCCTATTATCTCAAAGGTGAT; shHDAC3#2 (TRCN0000004825), CCTTCCACAAATACGGAAATT; shHDAC3#3 (TRCN0000004826), GCACCCAATGAGTTCTATGAT; shHDAC4#1 (TRCN0000004829), CGACTCATCTTGTAGCTTATT; shHDAC4#4 (TRCN0000004832), GCCAAAGATGACTTCCCTCTT; shHDAC6#1 (TRCN0000004839), CATCCCATCCTGAATATCCTT; shHDAC6#5 (TRCN0000004843), CCTCACTGATCAGGCCATATT; shHDAC7#2 (TRCN0000004845), GCCAGCAAGATCCTCATTGTA; shHDAC7#5 (TRCN0000004848), GCTACCATGTTTCTGCCAAAT; shHDAC8#2 (TRCN0000004850), GCATTCTTTGATTGAAGCATA; shHDAC8#3 (TRCN0000004851), GCGTATTCTCTACGTGGATTT; shHDAC9#1 (TRCN0000004854), CCTAGAATCTTTGTGAGGTTT; shHDAC9#5 (TRCN0000004858), GCAAAGATAGAGGACGAGAAA; shSIRT1#1 (TRCN0000018979), GCAAAGCCTTTCTGAATCTAT; shSIRT1#3 (TRCN0000018981), GCGGGAATCCAAAGGATAATT; shSIRT2# (TRCN0000040221), GCCAACCATCTGTCACTACTT; shSIRT2#5 (TRCN0000040222), GCTAAGCTGGATGAAAGAGAA; shSIRT3#1 (TRCN0000038889), CCCAACGTCACTCACTACTTT; shSIRT3#4 (TRCN0000038892), GTGGGTGCTTCAAGTGTTGTT; shSIRT5#2 (TRCN0000018544), GAGTCCAATTTGTCCAGCTTT; shSIRT5#4 (TRCN0000018546), CGTCCACACGAAACCAGATTT; shPRKAA1#1 (TRCN0000000857), GCATAATAAGTCACAGCCAAA; shPRKAA1#2 (TRCN0000000859), CCTGGAAGTCACACAATAGAA; shPRKAA2#1 (TRCN0000002172), GCTGTGTTTATCGCCCAATTT; shp300#1 (TRCN0000009882), CAGACAAGTCTTGGCATGGTA; shp300#2 (TRCN0000039883), CCTCACTTTATGGAAGAGTTA; shLKB1#1 (TRCN0000000407), GAGTGTGCGGTCAATATTTAT; shLKB1#2 (TRCN0000000408), GCCAACGTGAAGAAGGAAATT; shLKB1#3 (TRCN0000000409), GATCCTCAAGAAGAAGAAGTT.

Construction of a customized half-hairpin microarray

A customized microarray was designed to contain replicated probes complementary to the 23-nucleotide target sequence that included the specific 21-nucleotide sense-strand sequence of each shRNA along with one nucleotide immediately flanking both 5’ (a C nucleotide) and 3’ (a G nucleotide) ends. The probes also contained a stretch of 60-nucleotide linker sequence to attach the slide surface, and were randomly distributed across the array. The customized microarray slides were synthesized by Agilent at a density of 4 × 180,000 (4 subarrays containing 180k probes each) and are publicly available with design AMADID 024081.

Large-scale shRNA lentivirus pool transduction and selection (primary screen)

High-titer (> 109 infectious units/mL) TRC human genome-wide shRNA lentivirus pools were acquired from Sigma-Aldrich and from the National RNAi Core Facility at Academia Sinica (AS RNAi core). Large-scale transductions were performed as previously described, with optimization[12]. A stable luciferase shRNA expressing HCT116 cell line was transduced in parallel with the stable query knockdown cells as control. 7.5 × 107 target cells (1000X coverage) for each experiment were resuspended in 24 ml of DMEM containing 0.8 mg/mL geneticin and 8 µg/mL polybrene. The genome-wide lentivirus pool was added in an appropriate volume to achieve a multiplicity of infection (MOI) of 0.3 according to the titer of transducing virus reported by the provider. This cell-virus mixture was then evenly split across one 12-well tissue culture plate for a spin transduction (centrifugation at 930×g for 2 h at 30 °C). After spin transduction, the supernatants were aspirated and replaced by 2 mL fresh medium containing geneticin. The transduced cells were cultured overnight, and then cells of the entire plate were trypsinized and pooled, resuspended in 30 mL of fresh medium containing geneticin and transferred into one T225 flask. At day 3 post transduction, three quarters of the cells were taken from each flask as an initial “benchmark sample”. The rest of each population was selected with puromycin to remove untransduced cells and propagated for an additional 18 doublings before the “end sample” was taken.

Genomic DNA purification and shRNA half-hairpin probe production

Genomic DNA was purified from harvested cells according to the QIAamp Blood Maxi Kit protocol (Qiagen). The shRNA full hairpin coding sequence containing 5’ end of puromycin resistance marker gene was PCR amplified (with the following program: 94°C 5 min, 15 cycles of 94°C 30 sec, 55°C 30 sec, 72°C 1.5 min, and a final step of 72°C 10 min) in a 600 µL solution containing ~ 80 µg of genomic DNA template, 200 µM dNTPs, 1 µM for each PCR primer (sequence, forward: 5’-TTCACCGAGGGCCTATTTCCCATG-3’, reverse: 5’-CGTGAGGAAGAGTTCTTGCAGCTC-3’), 5% DMSO, 1x ExTaq buffer, and 3 µL ExTaq (Takara). PCR products were purified using a MinElute PCR Purification kit Qiagen). For each screen, the shRNA coding regions of the benchmark and end samples were further amplified in a 600 µL solution containing 3 µL of the puromycin marker-enriched amplicon, 200 µM dNTPs, 1x ExTaq buffer, 6 µL ExTaq (Takara), and labeled with Cy5 and Cy3 dyes (PCR primer sequence, forward: 5’-[Cy5/Cy3]-AATGGACTATCATATGCTTACCGTAACTTGAA-3’, reverse: 5’-TGTGGATGAATACTGCCATTTGTCTCGAGGTC-3’), respectively, with the following PCR program: 95°C 5 min, 35 cycles of 94°C 30 sec, 50°C 30 sec, 72°C 1 min, and a final step of 72°C 10 min. Immediately after the first round of PCR amplification, reaction volumes were doubled with the addition of PCR mixture without DNA template, and subsequently amplified with the following program: 95°C 7 min, 55°C 2 min, 72°C 60 min. Amplified full-hairpin DNA was further digested overnight into half-hairpins using XhoI, and the resultant half-hairpin probes were gel purified using a QIAquick Gel Purification kit (Qiagen).

Half-hairpin probe microarray hybridizations

A hybridization mixture for each sub-array was prepared as below. 500 ng each of Cy5-and Cy3-labeled, gel-purified half-hairpin probes were mixed together with 16.5 nmol of blocking oligo (blocking oligo sequence: 5’-GTCCTTTCCACAAGATATATAAAGCCAAGAAATCGAAATA-3’). The mixture was denatured by heating to 95°C for 5 min and transferred to ice for 5 min. Hybridization solution was added to the mixture containing a final concentration of 1×hybridization buffer (1 M NaCl, 100 mM Tris-HCl, pH 7.5, 0.5% Triton X-100) in a final volume of 110 µL; 100 µL of this was loaded to each sub-array and hybridized at 44°C in a hybridization oven (Agilent) for 16~20 hours. The microarray was washed once in wash buffer I (6X SSPE: 0.9 M NaCl, 60 mM NaH2PO4, 6 mM EDTA, 0.05% Triton X-100), once in wash buffer II (1X SSPE: 150 mM NaCl, 10 mM NaH2PO4, 1 mM EDTA ), spin dried and scanned using a G2565CA microarray scanner (Agilent).

Statistical analysis of microarray data

Microarray images were processed using Agilent Feature Extraction Software 10.7 (Agilent), and further statistical analysis was performed using customized software written in R. The resultant feature signal intensity datasets were normalized using a loess model without background subtraction to calculate log2(Cy5/Cy3) for the shRNA probes within each array, which represent the relative abundance changes of each shRNA between the initial and end time points. For each array, median and robust variance (mad) of log2(Cy5/Cy3) were computed. The log2 ratio from each shRNA in the array was standardized by subtracting the median and dividing the result by the robust variance of the array. To control for probe effects, we then subtracted the standardized log2 ratio of the control sample from that of the query sample. For each shRNA, the Z-score of the log2 ratio of the normalized Cy5 to Cy3 signal intensities was computed, and Z-score difference was calculated by subtracting the Z-score of the control sample from that of the query sample. Z-score differences larger than 1.5 and less than −1.5 were used as arbitrary thresholds to define candidate negative and positive genetic interactions, respectively. Genes with multiple shRNAs that met or surpassed these criteria were further confirmed by a cell viability assay described below.

96-well platform cell viability assay

750 of control luciferase shRNA cells or stable KDAC knockdown query cells were transduced in triplicate in 96-well plates with lentiviruses of target gene shRNAs or GFP and luciferase shRNA (as control) at an MOI of ~40. Three shRNAs giving the best knockdown efficiency according to the TRC database were selected for each target gene. After transduction, the cells were selected with geneticin and puromycin. On day 7, viable cell number was measured using CellTiter-Glo reagent (Promega) according to manufacturer’s instruction on an Infinite® F500 microplate reader (Tecan), and relative viability of any mutant in each plate was normalized against the viability of luciferase shRNA-transduced cells. Normalized viability ratios were obtained for each target gene (WQT/WT) and GFP control (WQ/WG), respectively. Here WQT is the normalized fitness of query cells with target gene knockdown and represents the effect of double knockdown of both the query and target gene; WT is the normalized fitness of control cells with target gene knockdown and represents the effect of single target gene knockdown; WQ is the normalized fitness of query cells under shGFP treatment and represents the effect of single query gene knockdown; WG is the normalized fitness of control cells under shGFP treatment and normally close to 1. These ratios were log-transformed and fit to a linear model to estimate the mean difference in viability ratios between knockdowns of target genes and GFP control in the query KDAC cell line compared to the control luciferase shRNA cell line. A mean viability ratio difference (epistasis coefficient) greater than 0.12 or smaller than −0.12 with the associated p-value < 0.05 computed with one-way analysis of variance (one-way ANOVA) was assigned to the validated synthetic rescue interaction and synthetic lethality interaction, respectively. The threshold was chosen based on a stringent cutoff used in a recently published large-scale yeast genetic interaction database[17].

Hierarchical clustering analysis

Hierarchical clustering was performed using Cluster 3.0[31] for both queries and targets. Agglomerative hierarchical clustering builds clusters in a bottom-up fashion. We used the Pearson correlation coefficient to quantify similarity between the genetic interaction profiles of two query genes. When two clusters being joined contain m1 and m2 query genes respectively, the similarity score between them could be defined as a function of similarity scores between their individual components. We used the average linkage method, which defined similarity between two clusters as the average of (m1 · m2) pair-wise similarity scores between components of the two clusters.

Gene Ontology enrichment analysis

The functional association of genetic interaction targets of query KDAC genes by Gene Ontology (GO) enrichment analysis in the “biological process” category was assessed using the Protein ANalysis THrough Evolutionary Relationships (PANTHER)[32-33] and Funcassociated 2.0[34].

Statistical analysis of corepressor and acetylation enrichment among validated targets

Statistical significance (i.e. p-values) of corepressor and acetylation enrichment among validated targets was calculated based on Fisher’s exact test.

Statistical analysis of enrichment of co-occurring genetic and physical interactions

Among the total gene set under consideration (the KDAC queries and all tested targets), we assembled a set of known physical interactions by accumulating all physical interactions from BioGRIDz[14] and the Michigan Molecular Interactions databases[35]. This provided us with a set of 94,475 physical interactions. P-values were calculated assuming a random graph model where physical interactions are randomly assigned while keeping the number of physical interactions for each gene the same as those actually observed in our compiled network. Thus, the probability of a physical interaction between two genes i and j is where d and d represent the number of physical interactions observed for the genes and E is the total number of observed physical interactions. If we consider a query KDAC q with the validated set of genetic interaction targets G, the expected number of physical interactions between the query and its genetic interaction targets is . The p-value is calculated with a Poisson model as .

Purification of GST–tagged Proteins

Cells grown in ten 15-cm dishes were transiently transfected with vectors containing the GST-tagged substrate construct and then harvested. Whole-cell extracts (WCEs) were obtained by breaking cells in lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1 mM EDTA, 0.1% v/v Triton X-100, 1 mM DTT, 1 mM PMSF, 5 µM pepstatin A, 1 µM MG-132, and EDTA-free complete protease inhibitor mix (Roche)), and incubated with mL of Glutathione Sepharose beads (GE Healthcare) at 4°C for one hour with head-to-head rotation (~ 10 rpm). After binding, the Glutathione Sepharose beads were washed four times with 10 mL of wash buffer I (500 mM NaCl, 50 mM HEPES, pH 7.0, 1 mM EDTA, 1 mM EGTA, 0.1% Triton X–100) followed by four times of wash with 10 mL of wash buffer II (50 mM NaCl, 50 mM HEPES, pH 7.0, 10% v/v glycerol, 0.1% Triton X–100, 10 mM NaOH). The washed beads were incubated with 3 mL of elute buffer (50 mM NaCl, 50 mM HEPES, pH 7.0, 25% v/v glycerol, 10 mM glutathione, pH 7.0) at for one hour with rotation. The eluate was collected by gravity flow or centrifugation, the eluted protein was concentrated to a final concentration of 0.1~0.5 µg/µL by ultrafiltration with Vivaspin 500 concentration columns (Sartorius). The final protein concentration was determined by a Nanodrop analyzer using the A280.

Immunoprecipitation of FLAG-tagged protein complex

The purification of FLAG-tagged proteins was performed as described[36] with minor adjustment. Protein concentration of the extracts was determined at 280 nm on a Nanodrop analyzer and 2 mg protein was used for immunoprecipitation in IP150 buffer 25 mM Tris pH 7.5, 150 mM NaCl, 1.5 mM DTT, 10% glycerol, 0.5% v/v NP-40) supplemented with protease inhibitors (for HDAC1 purification) as well as KDAC and phosphatase inhibitors (for PRKAA1 and LKB1 purification). An equimolar amount of STRADA expression plasmid was concomitantly transfected with FLAG-tagged LKB1. FLAG-tagged proteins were then captured with M2 anti-FLAG antibody-conjugated agarose (Sigma-Aldrich). The immunoprecipitate was then subjected to immunoblotting to detect the signal of phosphorylation, acetylation and binding proteins. For HDAC1, AMPK or LKB1 complex purification, the immunoprecipitate was eluted with 50 µg/mL FLAG peptide solution. The eluate was spin-concentrated and the final protein concentration was determined by a Nanodrop analyzer based on the A280.

In vivo acetylation assay

To detect acetylation of endogenous proteins, the protein of interest was immunoprecipitated from whole-cell extracts, and the acetylation signal of the immunoprecipitate was assessed by immunoblotting.

In vitro acetylation assay

In vitro HAT reactions were performed for 1 h at 30°C in a 25 µL reaction mixture containing ~5 µg of GST-tagged PRKAA1 protein (WT or 3KR), 0.25 µCi of [3H]-acetyl-CoA (GE healthcare, 250 µCi/ml, 3.4 Ci/mmol), 100 µM TSA, 5 mM nicotinamide, 5 mM PMSF and 5 mM DTT in pCAB buffer (50 mM HEPES/NaOH, pH 7.9, 0.1 mM EDTA, 50 µg/ml BSA), and 1 µg of purified p300 protein (Enzo Life Sciences). The acetylated species were then analyzed by scintillation counting or immunoblotting.

In vitro deacetylation assay

FLAG-tagged HDAC1 was purified as described from HDAC2 knockdown cells to minimize effects of co-purified HDAC2 proteins, and purified SIRT1 was acquired from Enzo Life Sciences. About 5 µg of GST-tagged substrate proteins purified from cells with stable knockdown of the corresponding KDAC gene were subjected to 0.5 to 1 µg purified KDACs at 30°C for 1 h. 1 mM NAD+ was added as a cofactor in the SIRT1 reactions. The residual acetylation signals of the substrate proteins were analyzed by immunoblotting.

In vitro kinase assay

Phosphorylation of AMPK by LKB1 was performed for 30 min at 30°C in a 25 µL reaction mixture containing ~ 5 µg GST-tagged PRKAA1 protein in kinase buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT, 100 µM ATP), and 0.5 µg of purified LKB1 (WT or KD). The phosphorylation signals of the substrate proteins were analyzed by immunoblotting.

AMPK kinase activity assay

AMPK activity was assessed using the CycLex AMPK Kinase Assay Kit (CycLex) according to the manufacturer’s instructions. Briefly, immunoprecipitated FLAG-tagged AMPK was added to a plate precoated with a substrate peptide corresponding to mouse insulin receptor substrate-1 (IRS-1) and incubated for 30 min at 30°C. Kinase activity was measured spectrophotometrically at 450 nm to monitor the level of phosphorylation of serine 789 in IRS-1 peptide.

Immunoblotting

WCEs were denatured in boiling SDS sample buffer, resolved by SDS-PAGE, transferred to nitrocellulose or PVDF membranes and probed with specific primary antibodies: anti-HA (F-7), sc-7392, Santa Cruz; anti-a-tubulin, T5168, Sigma-Aldrich; anti-GST, AB3282, Millipore; anti-FLAG, F3165, Sigma-Aldrich; anti-acetyl-lysine, 05-515, Millipore; anti-acetyl-lysine, ICP0380, Immunechem; anti-HDAC1, ab7028, Abcam; anti-HDAC2, ab7029, Abcam; anti-HDAC3, ab7030, Abcam; anti-HDAC4, SA-404, BioMol, anti-HDAC6, 07-732, Millipore; anti-HDAC7, 07-937, Millipore; anti-HDAC8 (E-5), sc-17778, Santa Cruz, anti-SIRT1 (H300), sc-15404, Santa Cruz; anti-SIRT2, 09-843, Millipore; anti-SIRT3 (C73E3), 2627S, Cell Signaling; anti-PRKAA1, ab32047, Abcam; anti-PRKAA2, GTX103487, GeneTex; anti-PRKAA P-T172, 2535, Cell Signaling; anti-PRKAG1, GTX101661, GeneTex; anti-PRKAG2, GTX114178, GeneTex; anti-ACC, 04-322, Millipore; anti-P-ACC, 07-303, Millipore; anti-p300, 05-257, Millipore; anti-LKB1, ab15095, Abcam.

Real-time polymerase chain reaction (RT-PCR)

Total RNA was extracted from one 10-cm dish of ~95% confluent cells using TRIzol (Invitrogen) according to the manufacturer’s protocol. Complementary DNA (cDNA) was synthesized from 400 ng of DNA-free total RNA using SuperScript™ III reverse transcriptase and random hexamer primers (Invitrogen), and then used for RT-PCR using SYBR® Green with gene-specific primers on a 7900 Real-Time PCR System (Applied Biosystems). The relative mRNA amount of target genes transcribed was quantified by comparing the fluorescence of their PCR products with the fluorescence ACTB as the reference (ΔCT), and the difference between the two ΔΔCT values (ΔCT = ΔCT(WT) – ΔCT(mutant)) was calculated to determine the effect of knockdown on the mRNA level of target genes. All RT-PCR experiments were performed using three biological replicates.

Oil Red O stain

Oil Red O staining of HepG2 cells was performed as previously described with optimization[37]. Cells were washed with ice-cold 1XPBS, fixed with 10% formalin for 60 min, and stained with Oil Red O working solution (1.8 mg/mL of Oil Red O in 6:4 isopropanol:water solution) for 60 min at room temperature. After staining, cells were washed with water to remove any remaining dye. For quantification of Oil Red O staining, the cell-retained dye was extracted by isopropanol and the content was measured spectrophotometrically at 500 nm.

Software

Microarray data were analyzed by R version 2.10.0. Hierarchical clustering results were visualized by Java Treeview version 1.1.0[38]. Networks were created with Cytoscape version 2.4.1. Statistical analysis was performed and plotted using GraphPad Prism 4 (GraphPad, San Diego, CA, USA).
  38 in total

1.  Next generation software for functional trend analysis.

Authors:  Gabriel F Berriz; John E Beaver; Can Cenik; Murat Tasan; Frederick P Roth
Journal:  Bioinformatics       Date:  2009-08-28       Impact factor: 6.937

2.  Lysine acetylation targets protein complexes and co-regulates major cellular functions.

Authors:  Chunaram Choudhary; Chanchal Kumar; Florian Gnad; Michael L Nielsen; Michael Rehman; Tobias C Walther; Jesper V Olsen; Matthias Mann
Journal:  Science       Date:  2009-07-16       Impact factor: 47.728

Review 3.  Therapeutic application of histone deacetylase inhibitors for central nervous system disorders.

Authors:  Aleksey G Kazantsev; Leslie M Thompson
Journal:  Nat Rev Drug Discov       Date:  2008-10       Impact factor: 84.694

4.  Synthetic lethal interaction between oncogenic KRAS dependency and STK33 suppression in human cancer cells.

Authors:  Claudia Scholl; Stefan Fröhling; Ian F Dunn; Anna C Schinzel; David A Barbie; So Young Kim; Serena J Silver; Pablo Tamayo; Raymond C Wadlow; Sridhar Ramaswamy; Konstanze Döhner; Lars Bullinger; Peter Sandy; Jesse S Boehm; David E Root; Tyler Jacks; William C Hahn; D Gary Gilliland
Journal:  Cell       Date:  2009-05-29       Impact factor: 41.582

Review 5.  The many roles of histone deacetylases in development and physiology: implications for disease and therapy.

Authors:  Michael Haberland; Rusty L Montgomery; Eric N Olson
Journal:  Nat Rev Genet       Date:  2009-01       Impact factor: 53.242

6.  Genetic dissection of histone deacetylase requirement in tumor cells.

Authors:  Michael Haberland; Aaron Johnson; Mayssa H Mokalled; Rusty L Montgomery; Eric N Olson
Journal:  Proc Natl Acad Sci U S A       Date:  2009-04-29       Impact factor: 11.205

7.  ATP-citrate lyase links cellular metabolism to histone acetylation.

Authors:  Kathryn E Wellen; Georgia Hatzivassiliou; Uma M Sachdeva; Thi V Bui; Justin R Cross; Craig B Thompson
Journal:  Science       Date:  2009-05-22       Impact factor: 47.728

8.  Protein acetylation microarray reveals that NuA4 controls key metabolic target regulating gluconeogenesis.

Authors:  Yu-yi Lin; Jin-ying Lu; Junmei Zhang; Wendy Walter; Weiwei Dang; Jun Wan; Sheng-Ce Tao; Jiang Qian; Yingming Zhao; Jef D Boeke; Shelley L Berger; Heng Zhu
Journal:  Cell       Date:  2009-03-20       Impact factor: 41.582

9.  A genome-wide RNAi screen identifies multiple synthetic lethal interactions with the Ras oncogene.

Authors:  Ji Luo; Michael J Emanuele; Danan Li; Chad J Creighton; Michael R Schlabach; Thomas F Westbrook; Kwok-Kin Wong; Stephen J Elledge
Journal:  Cell       Date:  2009-05-29       Impact factor: 41.582

10.  Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1.

Authors:  David A Barbie; Pablo Tamayo; Jesse S Boehm; So Young Kim; Susan E Moody; Ian F Dunn; Anna C Schinzel; Peter Sandy; Etienne Meylan; Claudia Scholl; Stefan Fröhling; Edmond M Chan; Martin L Sos; Kathrin Michel; Craig Mermel; Serena J Silver; Barbara A Weir; Jan H Reiling; Qing Sheng; Piyush B Gupta; Raymond C Wadlow; Hanh Le; Sebastian Hoersch; Ben S Wittner; Sridhar Ramaswamy; David M Livingston; David M Sabatini; Matthew Meyerson; Roman K Thomas; Eric S Lander; Jill P Mesirov; David E Root; D Gary Gilliland; Tyler Jacks; William C Hahn
Journal:  Nature       Date:  2009-10-21       Impact factor: 49.962

View more
  45 in total

Review 1.  AMP-activated protein kinase regulation and biological actions in the heart.

Authors:  Vlad G Zaha; Lawrence H Young
Journal:  Circ Res       Date:  2012-08-31       Impact factor: 17.367

2.  Interfacing protein lysine acetylation and protein phosphorylation: ancient modifications meet on ancient proteins.

Authors:  Hue T Tran; R Glen Uhrig; Mhairi Nimick; Greg B Moorhead
Journal:  Plant Signal Behav       Date:  2012-07-25

3.  Mapping genetic interactions in human cancer cells with RNAi and multiparametric phenotyping.

Authors:  Christina Laufer; Bernd Fischer; Maximilian Billmann; Wolfgang Huber; Michael Boutros
Journal:  Nat Methods       Date:  2013-04-07       Impact factor: 28.547

Review 4.  Erasers of histone acetylation: the histone deacetylase enzymes.

Authors:  Edward Seto; Minoru Yoshida
Journal:  Cold Spring Harb Perspect Biol       Date:  2014-04-01       Impact factor: 10.005

Review 5.  Metabolic regulation by SIRT3: implications for tumorigenesis.

Authors:  Lydia W S Finley; Marcia C Haigis
Journal:  Trends Mol Med       Date:  2012-06-27       Impact factor: 11.951

Review 6.  Lysine deacetylase (KDAC) regulatory pathways: an alternative approach to selective modulation.

Authors:  Michael W Van Dyke
Journal:  ChemMedChem       Date:  2014-01-21       Impact factor: 3.466

Review 7.  Metabolic reprogramming by class I and II histone deacetylases.

Authors:  Maria M Mihaylova; Reuben J Shaw
Journal:  Trends Endocrinol Metab       Date:  2012-10-09       Impact factor: 12.015

Review 8.  Resveratrol as a calorie restriction mimetic: therapeutic implications.

Authors:  Jay H Chung; Vincent Manganiello; Jason R B Dyck
Journal:  Trends Cell Biol       Date:  2012-08-10       Impact factor: 20.808

Review 9.  High-resolution network biology: connecting sequence with function.

Authors:  Colm J Ryan; Peter Cimermančič; Zachary A Szpiech; Andrej Sali; Ryan D Hernandez; Nevan J Krogan
Journal:  Nat Rev Genet       Date:  2013-11-07       Impact factor: 53.242

Review 10.  SIRT3: as simple as it seems?

Authors:  David B Lombard; Bernadette M M Zwaans
Journal:  Gerontology       Date:  2013-10-25       Impact factor: 5.140

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.