Literature DB >> 22085419

The bacteriophage WORiC is the active phage element in wRi of Drosophila simulans and represents a conserved class of WO phages.

Jennifer A Biliske1, Philip D Batista, Chantalle L Grant, Harriet L Harris.   

Abstract

BACKGROUND: The alphaproteobacterium Wolbachia pipientis, the most common endosymbiont in eukaryotes, is found predominantly in insects including many Drosophila species. Although Wolbachia is primarily vertically transmitted, analysis of its genome provides evidence for frequent horizontal transfer, extensive recombination and numerous mobile genetic elements. The genome sequence of Wolbachia in Drosophila simulans Riverside (wRi) is available along with the integrated bacteriophages, enabling a detailed examination of phage genes and the role of these genes in the biology of Wolbachia and its host organisms. Wolbachia is widely known for its ability to modify the reproductive patterns of insects. One particular modification, cytoplasmic incompatibility, has previously been shown to be dependent on Wolbachia density and inversely related to the titer of lytic phage. The wRi genome has four phage regions, two WORiBs, one WORiA and one WORiC.
RESULTS: In this study specific primers were designed to distinguish between these four prophage types in wRi, and quantitative PCR was used to measure the titer of bacteriophages in testes, ovaries, embryos and adult flies. In all tissues tested, WORiA and WORiB were not found to be present in excess of their integrated prophages; WORiC, however, was found to be present extrachromosomally. WORiC is undergoing extrachromosomal replication in wRi. The density of phage particles was found to be consistent in individual larvae in a laboratory population. The WORiC genome is organized in conserved blocks of genes and aligns most closely with other known lytic WO phages, WOVitA and WOCauB.
CONCLUSIONS: The results presented here suggest that WORiC is the lytic form of WO in D. simulans, is undergoing extrachromosomal replication in wRi, and belongs to a conserved family of phages in Wolbachia.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 22085419      PMCID: PMC3235987          DOI: 10.1186/1471-2180-11-251

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Wolbachia pipientis is an obligate bacterial endosymbiont of insects with a wide distribution. It is a member of the order Rickettsiales and is closely related to the insect vectored mammalian pathogens Anaplasma and Ehrlichia. Ten supergroups of Wolbachia have been identified within the species W. pipientis [1]. Supergroups A and B are common insect symbionts which probably diverged from one another 50-60 MYA [2]. The rapid spread of Wolbachia through insect populations is enhanced by symbiont-driven modifications to normal host reproductive patterns which are manifested as cytoplasmic incompatibility (CI), parthenogenesis, male killing and feminization (reviewed in [3]). The possibility of genetically transforming fastidious obligate intracellular bacteria and targeting them to insect vectors of human disease has stimulated renewed interest in Wolbachia's bacteriophage WO. The Wolbachia of Drosophila simulans, wRi, has acquired four prophage elements that are integrated into the bacterial genome as 18- to 77-kb sequences, termed wRi-WO-A, wRi-WO-B (two identical copies) and wRi-WO-C [4]. In contrast wMel, found in Drosophila melanogaster, has one WO-A, one WO-B and a small pyocin-like element. All of these prophage elements are integrated into the Wolbachia chromosome at unique sites. Masui et al [5] were the first to demonstrate the existence of the prophage WO in Wolbachia of the cricket Teleogryllus taiwanemma and later in D. simulans (wCof, wRi), the moths Ephestia kuehniella (wCauB, wCauA, wKue, wSca) and Corcyra cepharonica (wCep) [6] by electron microscopy and PCR. The WO prophages from Wolbachia infecting D. simulans, D. melanogaster, Culex pipiens, T. taiwanemma, Nasonia vitripennis and E. kuehniella have been sequenced [4,6-12]. WO phage genome sequences from wRi, wMel, and wPip are inferred from their respective bacterial chromosome genome sequencing projects. WOcauB2 and WOcauB3 are two strains of WO phages infecting Wolbachia of E. kuehniella that have been sequenced from the lytic phase [9]. WOcauB2 has a genome of 43,016 bp encoding 47 predicted open reading frames (ORFs), whereas WOcauB3 has a genome of 45,078 bp and 46 predicted ORFs. With respect to WO phages, little is known about their gene expression, lytic activity, or influence on the phenotypic properties of their hosts. The nomenclature surrounding the WO phages from different Wolbachia strains varies. Originally, the phage found in wKue was tentatively named WO [5], irrespective of how many types of integrated prophages were present. When wMel was sequenced [10], the two prophage inserts were named WO-A and WO-B respective to the origin of replication. Two phage types in wRi, WO-A and WO-B, were named based on sequence homology to the wMel phages, with the addition of one more phage type, WO-C [4]. WOPip is present as five integrated copies in the Wolbachia of C. pipiens and these are designated WOPip1 through 5 [7]. They have been reported to be more closely related to WO-B of wMel than WO-A of wMel [7]. Bacteriophages are believed to be the mobile genetic elements responsible for the high level of genetic diversity in Wolbachia [[10,13] and [14]] through lateral transfer between co-infecting strains. As in other prokaryotes, prophage integration and transformation in Wolbachia appear to be major sources of lateral gene acquisition [15]. A group of genes present in the wRi and wMel prophage WO-B genome is most similar to genes found in Rickettsia [14], suggesting that interspecies horizontal transfer mediated by phages has also occurred in an insect harboring both bacteria. Bacteriophages can influence the level of virulence of bacterial pathogens [16] and can change the phenotypic properties of closely related strains of bacteria. In Wolbachia-infected Drosophila, Culex, Nasonia and other insects, WO prophages appear to be temperate, that is, they have an integrated prophage form and can also generate virions which result in bacterial lysis [6,11,15,17] and [18]. In the parasitoid wasp, N. vitripennis, Bordenstein et al used a quantitative PCR assay to demonstrate that Wolbachia titer, which correlates with CI intensity, is inversely related to copy number of temperate WOVitA [15]. This relationship, known as the Phage Density Model, predicts that low CI strains of Wolbachia will have a high number of phage particles, and, conversely, high CI strains of Wolbachia will have low titers of phage particles [15,19]. In Drosophila, however, it is not known which of the diverse prophage elements give rise to lytic viruses, how their lytic properties are regulated, or the effect of lysis on host phenotype. Although most tailed bacteriophages have evolved a temperate lifestyle, it is not yet known if the prophage elements in wRi are functional, defective, satellite phages, or agents of gene transfer [20]. Typically, mature WO phage particles are detected using primers specific to the open reading frame encoding a putative minor capsid protein C (ORF7) [5]. In wRi of D. simulans, however, ORF7 is present in all four prophage insertions [WRi_005560], [WRi_007170], [WRi_010220], and [WRi_012630] and so the presence of ORF7 is not a specific indicator of which phage is active. In this paper we measure the relative copy number of mature, active WORiC phage particles in whole flies and tissues of D. simulans and determine variations in Wolbachia and WO copy number between individual larval hosts by quantitative PCR. A comparison of the genome architecture of known active phages WOVitA1 and WOCauB2 to WORiC identifies modules for head assembly and DNA packaging as well as tail morphogenesis that are conserved in all known active WO phages.

Methods

Strains and media

D. simulans (Riverside) (DSR) stocks were maintained at room temperature on a standard diet of cornmeal, dextrose and yeast. Stocks were stably infected with a single Wolbachia strain (wRi) and have been maintained at the University of Alberta laboratory for approximately 6 years. The presence of Wolbachia was confirmed at regular intervals using 81F and 691R wsp primer pairs [21].

DNA extractions

DNA from whole flies and gonads was extracted from animals that were less than 5 days post eclosion. Newly eclosed flies were separated by sex and allowed to develop to the appropriate age. Gonad DNA samples were obtained from 4 groups of 100-150 testes each and 4 groups of 75-150 ovaries each. Whole fly DNA was taken from 4 groups of 15 flies each. Three groups of 15-minute AEL (after-egg-laying) embryos were obtained by allowing females to oviposit on egg laying dishes made from fruit juice. Embryos were collected and chilled every 15 minutes until approximately 200 μl of packed embryos were obtained per replicate. The eggs were stored at -80C until DNA extractions could be performed. Synchronization of larvae was accomplished by allowing several hundred females to oviposit on egg-laying dishes for one hour. The eggs were collected and seeded onto standard media. From these, third instar (3') larvae were collected and stored at -80C until DNA extraction. DNA was extracted from all tissues and flies with the DNeasy Blood and Tissue Kit (Qiagen) using the manufacturer's protocol with an extended, overnight proteinase K digestion. DNA purity and concentration was determined using a Nanodrop ND1000.

Quantitative PCR for relative copy number

Relative copy numbers of Wolbachia and WO phage in .D. simulans were obtained using the MiniOpticon System (Bio-Rad). The relative Wolbachia infection level was measured by comparing the copy number of the gene for Wolbachia surface protein, wsp, to a single copy gene in the Drosophila genome, CuZn superoxide dismutase (sod). Phage copy numbers were measured by comparing the adenine methyltransferase (wMTase) (WORiB), lyzozyme (WORiA), and tail tube protein (WORiC) genes to wsp in wRi (see table 1 for locus tags and primer sequences).
Table 1

Primer sequences used in this study

ORF ProductLocus TagSpecificitySequence (5'-3')
SuperoxideDsim GD12822D. simulansF - GTCGACGAGAATCGTCACCT
Dismutase (SOD)R - GGAGTCGGTGATGTTGACCT

Surface AntigenWRi 010990WolbachiaF - ATCAGGGTTGATGTTGAAGG
Wsp (Wsp)wRiR - CAGTATCTGGGTTAAATGCTG

Lyzozyme M1WRi 012650WORiAF - GACTTTATGGCAGTATACCGA
(Lyz)R - TGTTCCGTTGAATTTGTTCC

DNAWRi 005640WORiBF - CTTAAATGACCATCAACCACAG
Methyltransferase (MTase)R - GCTTCAATCAGGGAATTTGG

Contractile TailWRi 006970WORiCF- GTTGATGGTAGAGGTTATGCAG
Tube ProteinR - GAATATCCATACCACCAGCTC
Primer sequences used in this study Reactions were performed in low profile 48-well white plates with flat cap strips (Bio-Rad). Ten microliter reactions included 400nM of each forward and reverse primer, 5 μl of 2× Dynamite qPCR mastermix (Molecular Biology Service Unit - University of Alberta) which included SYBR green (Molecular Probes) and Platinum Taq (Invitrogen), and 125ng of DNA. The thermal cycling conditions were 95°C for 2 minutes, 40 cycles of 95°C, 55°C, and 72°C for 30 seconds each, and a final 2 minute 72°C extension. Fluorescent data were acquired after every 72°C extension. A 60-95°C melting curve was performed to confirm the specificity of the products. No template controls were included to account for DNA contamination. All samples were analyzed in technical and biological triplicates. Standard curves were constructed through a dilution series to validate the primer pairs; all primers were found to have efficiencies that were roughly equal, using the equation E = 10(-1/slope) -1, and suitable for relative comparisons, and r2 values >0.99. The primer sequences were designed using PerlPrimer v1.1.14 [http://perlprimer.sourceforge.net] and are described in table 1. All primers were synthesized by Integrated DNA Technologies and were purified by standard desalting. PCR products were sequenced to confirm specificity of the primers and all amplified a single, specific target. Data were analyzed by the Opticon Monitor 3 software (Bio-Rad) which uses the ΔCT method. The average copy number of integrated phage was compared to the expected number based on published sequence data and the difference was statistically analyzed with a two-tailed t-test. The correlation tests between the three WO phages and wRi were performed using the Pearson Product Moment Correlation test. When determining the relative copy number for each of the phage types, it was assumed that integrated prophage sequences would amplify with the same efficiency as sequences from mature virus particles.

Sequence analysis

Annotated genomes of Wolbachia strains wMel [GenBank:NC_002978] [10] and wRi [GenBank:NC_012416] [4], and phage strains WOCauB2 [GenBank:AB478515] [9], and WOVitA [GenBank:HQ906662] [12] were retrieved [22]. The phage regions [WRi_005250-005970] (WORiB) and [WRi_006570-WRi_007250] (WORiC) from the wRi genome were used for whole phage genome alignments. The region [WD0562-WD0646] from the wMel genome was used for WOMelB genome alignments. Whole genome comparisons were performed using the Mauve plug-in v.2.2.0 [20] for Geneious v5.4.4 [23]. The predicted amino acid sequences for the large terminase subunit and baseplate assembly gene W were used for phylogenetic analysis. Proteins were aligned using the ClustalW multiple alignment algorithm implemented in Geneious v5.4.4. [23]. Model selection was performed using Prottest 2.4 [24] with Akaike's information criterion (AIC) used to select for an appropriate evolutionary model for each data set [terminase (JTT+I+Γ+F) and baseplate assembly protein W (JTT+Γ)] prior to analysis. The evolutionary history was inferred for both genes using the maximum likelihood method. Phylogenetic trees generated by PHYML used 1000 bootstrap replicated datasets and estimated gamma distribution and proportion of invariable sites [25].

Results

Presence and activity of WO prophages in Wolbachia of D. simulans

When lytic viruses replicate and lyse host cells, they do so through an enzymatic process involving a two component cell lysis system of a holin and lysozyme [26]. To date, there is no direct evidence that the WO phages of wRi are capable of enzymatic lysis of bacterial hosts. Therefore, the term "lytic" is not used here to describe phage or phage DNA detected in excess of the integrated prophage genomes. Instead, replicating WO is referred to as a mature, extrachromosomal, or active phage. WO phages in wMel and wRi have been classically referred to as WO-A, WO-B, and WO-C [4,10]. However, the less ambiguous nomenclature WORiA, WORiB, and WORiC respectively is used here to describe the prophage types in wRi and WOMelA and WOMelB for prophage types in wMel. Quantitative PCR was used to test whether Wolbachia prophages were replicating extrachromosomally. Specific primers that differentiate between the prophage types in wRi were designed (table 1) and Wolbachia titer was determined by comparing the wsp gene copy number to the Drosophila nuclear sod gene. Integrated and extrachromosomal viral copy numbers were determined using primers specific to Wolbachia genes lysozyme (WORiA), MTase (WORiB), and tail tube protein (WORiC). The amplification of the WO-specific primers was compared to Wolbachia copy number using wsp (wRi-specific primers).Values reported are the combination of integrated plus extrachromosomal phages. WORiA is found once in the wRi genome. The relative copy number of the ORF which encodes a putative lyzozyme [WRi _012650] was measured in young males and females (three replicates of 15 flies each), testes and ovaries, and 15 minute AEL embryos. The relative lyzozyme (WORiA) copy number in these tissues ranged from 0.94 - 1.16 per Wolbachia cell (figure 1A). This is consistent with the single integrated copy in the genome and indicates no extrachromosomal WORiA (all p values > 0.05; two-tailed t-test).
Figure 1

Relative copy number of WO in males, females, testes, ovaries, and early embryos. Relative copy number of ORFs encoding genes for lysozyme, MTase, and tail tube protein were measured by qPCR to determine the amount of extrachromosomal WORiA, WORiB, and WORiC, respectively in males, females, testes, ovaries, and embryos. The black line depicts the expected copy number for each of the phage types; one for A and C, and two for B. Of the three phage types, only WORiC is present in any extrachromosomal copies (p < 0.05). Error bars represent one standard deviation.

Relative copy number of WO in males, females, testes, ovaries, and early embryos. Relative copy number of ORFs encoding genes for lysozyme, MTase, and tail tube protein were measured by qPCR to determine the amount of extrachromosomal WORiA, WORiB, and WORiC, respectively in males, females, testes, ovaries, and embryos. The black line depicts the expected copy number for each of the phage types; one for A and C, and two for B. Of the three phage types, only WORiC is present in any extrachromosomal copies (p < 0.05). Error bars represent one standard deviation. In wRi, there are two integrated copies of the WORiB prophage and each contains one copy of the MTase gene [WRi_005640; WRi_010300] [4]. In DSR males, females, testes, ovaries, and two-hour embryos, the relative MTase copy number ranged from 1.83-2.10 and was not significantly different than two per Wolbachia genome (all p values > 0.05, two-tailed t-test) (figure 1B). There is no evidence of extrachromosomal WORiB phage genomes. The gene encoding the phage tail tube protein is present once in the wRi genome on the WORiC insert. In males, females, testes, ovaries, and 15 minute AEL embryos, the relative tail tube protein copy number was significantly greater than the expected one copy per Wolbachia genome (p < 0.05 in all cases, two- tailed t-test) (figure 1C). Therefore, WORiC is the extrachromosomal phage in wRi. The average density of all samples tested ranged from 1.29 - 1.61 copies of WORiC per wsp copy. Occasionally, a DNA sample showed no evidence of extra-chromosomal WORiC DNA (data not shown). This indicates that DNA extracted from groups of flies may mask variation with respect to the amount of replicating phage per individual. Thus, third instar larvae were synchronized to a 1 hour age difference and wRi, WORiA, WORiB, and WORiC numbers were measured for each individual to determine whether the WO copy number varied between individuals (figure 2). Relative phage densities were also compared to Wolbachia densities to determine whether variations in phage copy numbers were related to the bacterial density as observed by Bordenstein et al [15] in N. vitripennis. Among 16 third instar larvae tested, the Wolbachia densities ranged from 6.67 to 19.21 copies per host sod gene, with the exception of one outlier at 34.88. WORiA relative numbers averaged 0.97 and varied from 0.86 to 1.13 copies per Wolbachia. WORiB densities for the larvae averaged 2.02 copies per wRi and ranged between 1.56 and 2.78. Finally, WORiC copy numbers averaged 1.17 and ranged between 0.91 and 1.50 per wsp. None of the densities of the three phage types correlated significantly with the Wolbachia density (Pearson correlation; p = 0.256, 0.12, and 0.16 for WORiA, WORiB, and WORiC, respectively) among the 16 samples tested. Removing the outlier individual (34.88 Wolbachia per host cell) from the analyses did not change the statistical outcome of the correlation test in WORiC (Pearson correlation; p > 0.7).
Figure 2

Relative copy number of WO in 1hour synchronized 3' larvae individuals. The relative copy numbers of each phage type are plotted against the relative density of Wolbachia in individual one hour synchronized third instar larvae. Each point on the graph represents one larva and the same 16 larvae were used to measure each of WORiA, WORiB, and WORiC. The shaded area represents one standard deviation of the combined 16 WO densities (0.085, 0.286, and 0.181, respectively) and the red line indicates the expected integrated copy number based on the published wRi genome sequence. The relative densities of wRi and each of the WO phages did not show any significant correlation (Pearson; p > 0.05)

Relative copy number of WO in 1hour synchronized 3' larvae individuals. The relative copy numbers of each phage type are plotted against the relative density of Wolbachia in individual one hour synchronized third instar larvae. Each point on the graph represents one larva and the same 16 larvae were used to measure each of WORiA, WORiB, and WORiC. The shaded area represents one standard deviation of the combined 16 WO densities (0.085, 0.286, and 0.181, respectively) and the red line indicates the expected integrated copy number based on the published wRi genome sequence. The relative densities of wRi and each of the WO phages did not show any significant correlation (Pearson; p > 0.05)

Comparative genomics and phylogenetic analysis

The genome of the WORiC prophage is predicted to be 77,261 bp containing 56 ORFs [WRi _006570 to WRi_007250]. The core genome containing a DNA packaging and head assembly module and a tail morphogenesis module is shown in table 2 and is 24.2 kbp [WRi_006910 to WRi_007210]. The 35% GC content is identical to the GC content of the wRi genome indicating a long period of co-evolution between prophage and bacteria.
Table 2

the conserved core tail morphogenesis and DNA packaging and head assembly regions of WORiC

Locus TagOpen Reading FrameRegion
WRi 006910tail protein D, putative CDS

WRi 006920tail protein X, putative CDS

WRi 006930tail protein U, putative CDS

WRi 006940tail tape measure protein CDS

WRi 006950hypothetical protein CDS

WRi 006960hypothetical protein CDS

WRi 006970contractile tail tube protein CDS

WRi 006930tail protein U, putative CDS

WRi 006940tail tape measure protein CDS

WRi 006950hypothetical protein CDS

WRi 006960hypothetical protein CDS

WRi 006970contractile tail tube protein CDS

WRi 006980phage tail sheath protein CDSTail Morphogenesis

WRi 006990hypothetical protein CDS

WRi 007000hypothetical protein CDS

WRi 007010hypothetical protein CDS

WRi 007020VrlC.2 CDS

WRi 07030(a)VrlC.1 CDS

WRi 007040transposase, IS5 family CDS

WRi 07030(b)VrlC.1 CDS

WRi 007060hypothetical protein CDS

WRi 007070Tail protein I, putative CDS

WRi 007080baseplate assembly protein J, putative CDS

WRi 007090baseplate assembly protein W, putative CDS

WRi 007100hypothetical protein CDS

WRi 007110baseplate assembly protein V CDS

WRi 007120hypothetical protein CDS

WRi 007130minor tail protein Z, putative CDS

WRi 007140hypothetical protein CDS

WRi 007150hypothetical protein CDS

WRi 007160hypothetical protein CDS

WRi 007170minor capsid protein C, putative CDSDNA packaging and head assembly

WRi 007180portal protein, lambda family CDS

WRi 007190phage uncharacterized protein CDS

WRi 007200hypothetical protein CDS

WRi 007210terminase large subunit, putative CDS
the conserved core tail morphogenesis and DNA packaging and head assembly regions of WORiC The only confirmed WO mature virus particles that have been sequenced belong to Wolbachia of Cadra cautella, WOCauB2 and WOCauB3 [9,12]. More recently, Kent et al [12] used microarrays to capture the sequences of WOVitA and WOVitB which are the active phages in wVitA and wVitB respectively, infecting N. vitripennis. In this study, genomes from active phages were compared to WORi phage genomes to determine whether conserved regions are present in all active phages. Figure 3 shows the overall gene synteny between the WO phages. The heights of the colored peaks represent the degree of nucleotide similarity between collinear genomes. Pairwise alignments were performed between WORiC and WOCauB2 (figure 3a), WORiC and WOVitA1 (figure 3b), WORiC and WORiB (figure 3c) and WOMelB (figure 3d). Detailed lists of ORF alignments are included in the Additional file 1, Table S1, Additional file 2, Table S2, Additional file 3, Table S3, Additional file 4, Table S4, respectively. The WOMelB sequence used for comparisons included the upstream adjacent pyocin region identified by Wu et al [10]. These comparisons revealed conserved regions of homologous sequence and identified rearrangements and inversions between the genomes. The genes encoding putative structural and packaging proteins are present in two adjacent and conserved regions in WORiC, WOVitA1 and WOCauB2. WORiA and WOMelA did not align with other WO phage genomes (data not shown).
Figure 3

Whole genome comparisons between WORiC, WOCauB2, WOVitA1, WOMelB, and WORiB. Genomes of WORiC to A) WOCauB2 B) WOVitA1 C) WOMelB and D) WORiB are compared. Degree of sequence similarity is represented by the color intensity within each block. Areas of white within blocks indicate dissimilarity including gene insertions or deletions (see text). Each colored block represents a conserved region of homologous sequence between genomes. The placement of a block below the center axis indicates inverted regions.

Whole genome comparisons between WORiC, WOCauB2, WOVitA1, WOMelB, and WORiB. Genomes of WORiC to A) WOCauB2 B) WOVitA1 C) WOMelB and D) WORiB are compared. Degree of sequence similarity is represented by the color intensity within each block. Areas of white within blocks indicate dissimilarity including gene insertions or deletions (see text). Each colored block represents a conserved region of homologous sequence between genomes. The placement of a block below the center axis indicates inverted regions. Comparisons between WORiC and WOCauB2 reveal a single block of homologous sequences spanning the structural and packaging regions (figure 3a). There are three separate areas of dissimilarity between WORiC and WOCauB2. These include two transposable elements and an uncharacterized phage protein [WRi_007190]. Notable areas of dissimilarity between WOVitA1 and WORiC (white areas; figure 3b) include two transposable elements [WRi_006820] interrupting an ankyrin repeat protein gene [WRi_006810, WRi_p06840]. Genome alignments were also used to assign possible functions to previously annotated hypothetical ORFs. A hypothetical gene, [WRi_p07030], shares 74.7% pairwise identity to the virulence protein gene VrlC.1 of WOVitA1 and is pseudonized by the transposon insertion [WRi_007040]. The annotated hypothetical protein [WRi _007070] is homologous to tail protein I from WOVitA1 (96%, 3e-143). The major region of dissimilarity between WOVitA1 and WORiC could be a result of horizontal gene transfer into WOVitA1 or gene loss in WORiC. These ORFs in WOVitA1 encode MutL and three transcriptional regulators [ADW80184.1, ADW80182.1 to ADW80179.1]. Although WOVitA1 and WORiC share 36 homologs compared to 33 shared between WORiC and WOCauB2, WORiC is more similar to WOCauB2 (92.4%). The WORiB genome shares only the ORFs found within the packaging region [WRi_005460 to WRi_005610] with WORiC (figure 3c). However, when the pyocin sequences, containing the viral structural genes, are included in the WOMelB genome and aligned with WORiC, the structural and packaging regions are conserved, but rearranged in WOMelB compared to WORiC (figure 3d). The evolutionary relationships of the tail morphogenesis module and head assembly and DNA packaging module were examined by phylogenetic analysis. Phylogenetic trees based on baseplate assembly protein W and the large terminase subunit showed different evolutionary relationships for related phages, with the exception of the WOMelB, WORiB1 and WORiB2 clade (figure 4). WORiC shows the greatest phylogenetic relatedness to WOCauB2 and WOCauB3 for baseplate assembly protein W (figure 4a), which is reflected by the degree of nucleotide similarity in the alignment (figure 3a). In contrast, the large terminase subunit of WORiC is most closely related to the wMel and wRi B-type phages (figure 4b).
Figure 4

Phylogeny of terminase and baseplate assembly protein W amino acid sequences. Maximum-likelihood phylogeny based on translated amino-acid sequences of A) baseplate assembly gene W (tail morphogenesis module) and B) large terminase subunit gene (DNA packaging and head assembly module) of Wolbachia WO phages from published genomes. Bootstrap values for each node are based on 1000 resamplings.

Phylogeny of terminase and baseplate assembly protein W amino acid sequences. Maximum-likelihood phylogeny based on translated amino-acid sequences of A) baseplate assembly gene W (tail morphogenesis module) and B) large terminase subunit gene (DNA packaging and head assembly module) of Wolbachia WO phages from published genomes. Bootstrap values for each node are based on 1000 resamplings.

Discussion

WORiC is the active phage in wRi

When temperate bacteriophages infect sensitive bacteria their viral genomes direct DNA replication of the phage, cell lysis and the release of progeny, or, if the lytic state is suppressed, they integrate into the bacterial chromosome in the form of a prophage, in what is known as the lysogenic state. In Escherichia coli, lambdoid prophages are stably integrated into the host chromosome and do not undergo lytic induction until the bacterial SOS response is activated [27]. Gavotte et al [17] used a filtration-based purification method accompanied by TEM and ORF7-specific PCR to show that mature phage particles form in Wolbachia-infected tissues in both D. simulans and D. melanogaster, but the specific identity of these virus particles and the regulation of their induction was not addressed. In this study, the activity of the three distinct prophages found in wRi infecting D. simulans was measured using quantitative PCR. Phage type-specific primers were used to determine how many copies of the phage genomes were present in addition to the integrated forms. The only phage chromosome to appear in excess of the integrated copy number was WORiC. The average number of copies of WORiC in all tissues tested ranged from 1.29 - 1.61 copies per Wolbachia, consistently above the one copy integrated into the wRi genome. Thus, WORiC appears to be the only actively replicating phage in D. simulans. wRi is considered to be a high CI strain of Wolbachia in D. simulans; embryonic lethality resulting from crosses between infected males and uninfected females is typically between 90 - 100% [28,29]. In N. vitripennis infected with wVitB, which is also a high CI-inducing strain of Wolbachia, Bordenstein et al [15] reported an average WOVitB copy number of 1.6 ± 0.12 per Wolbachia. In the present study, a similar relative density of WORiC suggests that this phage is the active virus observed in past TEM micrographs of Drosophila tissues [5,17]. WORiC genes have been reported as actively transcribed in previous literature. Specifically, the ankyrin related genes in WORiC are expressed in males, females, ovaries, testes, early (2 hour AEL) and late (overnight) embryos [4].

WORiB and WORiA are non-functional phage remnants

WORiA and WORiB did not show any evidence of extrachromosomal DNA beyond the one and two copies, respectively, found within the wRi genome. Alignments to WOCauB and WOVitA1 show that both WORiA and WORiB lack the core structural components necessary for virion assembly. The persistence of WORiA and WORiB within the wRi genome suggests that there may be selective pressures maintaining these two prophages. There is evidence that WORiB is actively transcribing at least one ORF located within the prophage genome [30] and so this region may be necessary for another, unrelated, aspect of Wolbachia biology.

Phage density remains consistent among time-synchronized cohorts and does not correlate with Wolbachia density in larvae

The average density of WORiC was derived from pooled samples of multiple individuals and tissues. When 16 third instar larvae were individually measured for phage density, WORiA and WORiB did not significantly deviate from the expected means of one and two copies, respectively. Individual larva, however, had a much wider distribution of WORiC copy numbers, ranging from individuals that appeared to have no extrachromosomal viruses to individuals having more than 1.5 WORiC per Wolbachia. This indicates that not every individual within the larval population is experiencing viral replication, although most are. Currently, the signals which induce viral replication within the confines of an endosymbiotic bacterium are unknown. Along with the WO density in individual third instar larvae, the relative Wolbachia wRi density per D. simulans host cell was also measured. The wRi density did not significantly correlate with WORiA, WORiB, or WORiC relative densities. However, the WORiC density trends toward a slight inverse association with wRi density. It is possible that with a larger sample population, more statistical significance would emerge. This lack of correlation does not refute the phage density model postulated by Bordenstein et al [15], whereby the Wolbachia copy number and CI in N. vitripennis was found to be inversely related to phage activity. Rather, it raises the notion that phage density is a population and strain-specific factor. Low levels of replicating phage, as seen here for WORiC, may not significantly impact Wolbachia wRi density and the strength of CI in Drosophila. The effect of phage copy number on CI level in D. simulans has yet to be examined.

Comparative Genomics and phylogenetics of Wolbachia bacteriophages

Since WORiC in this study was the only wRi prophage capable of extrachromosomal replication, a comparative genomic approach was taken to identify the core genome conserved between WORiC and two known temperate bacteriophages WOVitA1 and WOCauB2. This approach identified essential regions required for phage generation. The genomes of WORiC, WOVitA1, and WOCauB2 show considerable sequence homology which supports the view that WORiC is the active form of phage in wRi. In contrast, the WORiB genome and the WOMelB genome lacking the upstream pyocin region share few homologous sequences with WORiC. Genes with sequence homology in WORiB, WOMelB, and WORiC belong to the DNA packaging and head assembly region. However, the core structural/tail region of WORiC aligns with WOMelB once the pyocin region is included in the analysis. WORiB lacks the pyocin-like region and is therefore deficient in most tail morphogenesis genes. The chimeric nature of WO phages was initially described by Masui et al [6], who identified the large terminase subunit, portal protein and minor capsid protein of the packaging region in WOKue as lambda-like, and the baseplate assembly proteins of the structural region as P2-like. This hybridization of lambda and P2 sequences is not exclusive to WO phages, since chimeric phages have been described in other systems; for example Xylella fastidiosa phages XfP1 and XfP2 are also lambda/P2 chimeras [16]. Due to recombination and genetic mosaicism, different parts of a bacteriophage genome can have different evolutionary histories [31]. In the chimeric WO phages (figure 4), the large terminase subunit sequence from the DNA packaging and head assembly regions shows a different phylogenetic relationship than the baseplate assembly protein W sequence from the tail morphogenesis regions. This modular nature of WO phages has been described previously [19]. The two conserved modules shared by WORiC and the temperate phages WOCauB2 and WOVitA1 include the DNA packaging and head assembly region and the tail morphogenesis region. The genome encoding the DNA packaging and head assembly module includes ORFs that putatively code for a portal protein, a minor capsid protein and the large subunit of the terminase protein. This large terminase subunit contains a DNA-dependent ATPase domain and site-specific nuclease domain which are both involved in DNA translocation during packaging. In double stranded DNA phages, terminases are generally accompanied by a small subunit involved in DNA binding [32,33]. However, no homolog of this small subunit has been identified in any WO genome. The portal protein of tailed bacteriophages forms a complex with the terminase proteins which translocates phage DNA into the prohead during phage replication [33]. The conservation of these packaging genes suggests that DNA packaging in WO phages is driven by an ATP-dependent DNA translocation motor similar to other tailed bacteriophages. Similarly, the organization of the tail morphogenesis module is conserved among WOVitA, WOCauB, and WORiC. Genes involved in tail assembly include the tail proteins, tail tape measure protein, the tail sheath protein, the contractile tail tube protein and baseplate assembly proteins J,W, and V. Tail morphogenesis in the subfamily Myoviridae, which have long contractile tails, is the most complex of all tailed bacteriophages. In the Myoviridae T4, P2 or Mu, baseplate assembly occurs first and is required for sheath and tail polymerization. It is from the baseplate that the tube polymerizes to a length determined by the tail-tape measure protein and this is followed by the tail sheath which extends the length of the tail [34]. The presence of the tail sheath gene in active WO genomes suggests that, with respect to tail structure and assembly, these phages are more similar to Myoviridae than to the subfamily Siphoviridae, which includes lambda and lacks contractile tails. The phage tail mediates genome delivery into host cells, and is required for the generation of infectious phages. The absence of this region in the WORiB genome may contribute to the inability of WORiB to form infectious particles. Unlike WORiC, where the packaging region is located adjacent to the structural proteins, in WOMelB the structural proteins are divided in the genome and separated from the packaging region by approximately 18kbp [35]. One region of structural genes found in WOMelB was initially characterized as a pyocin-like region. Therefore, active phage generation in D. melanogaster wMel could result from the coordinate replication of both packaging and structural regions. Despite much previous interest in Wolbachia's ankyrin containing genes [35,36], and the suggestion that they may influence phage function, the ORFs encoding ankyrin-containing motifs are outside the core conserved regions of WORiC, WOVitA1 and WOCauB3. The role of ankyrin coding genes in the WO-Wolbachia-host relationship remains elusive [37,38]. Our results suggest that Wolbachia phages WORiC and known active phages WOCauB and WOVitA1 represent a conserved class of Wolbachia phages. Interest in the conserved genetic modules of the lambda-like DNA packaging and head assembly genes and P2-like tail morphogenesis genes led to the investigation of the relatedness of the Wolbachia phages. Phylogenetic analysis shows similarity between WORiC and WO-B's found in wMel and wRi (based on large terminase subunit phylogeny) and similarity between WORiC and WOCauB2 and WOCauB3 (based on the baseplate assembly protein W phylogeny). These divergent topologies are indicative of the horizontal transfer events occurring between phage genomes. Similarity of genomes of active WO phages may be due to the fact that they have a common, recent origin, or because active WO phages are operating within a limited framework of endosymbiotic bacteria, where opportunities for incorporating novel gene sequences by recombination are limited. Given the present level of knowledge of active WO bacteriophages, we cannot distinguish between these and other possible evolutionary scenarios.

Conclusions

The genome of WORiC shares two main regions of similarity to WO phages infecting wCau and wVit. These two regions encode DNA packaging and head assembly proteins and tail morphogenesis and structural proteins. The conserved structural and packaging regions appear to be necessary for generation of mature virus particles; all active WO phages characterized to date contain these homologous components. The obligate intracellular nature of Wolbachia makes detailed examination of WO and its temperate lifestyle a challenge. Here, a phage-specific quantitative PCR approach was employed to determine that WORiC is the active prophage element in wRi. On an organismal and tissue-specific level, WORiC is present in very low densities; this low density is expected in wRi's high CI environment and is consistent with the phage density model developed in Nasonia [15]. On an individual basis, however, no correlation was found between wRi and WO phage density in synchronized third instar larvae. This study provides an integrated computational and molecular approach to investigate the complex biology of the host insect, Wolbachia endosymbiont, and WO bacteriophage.

Authors' contributions

JAB and CLG performed the qPCR experiments, PDB carried out the alignments and in silico analysis, JAB, PDB, and HLH conceived all experiments and analyzed the data and all authors wrote the manuscript. All authors have read and approved the final manuscript.

Additional file 1

ORFs included in the whole genome alignment of WORiC and WOCauB2. Highlighted regions match colours indicated in Figure 3a and represent regions of sequence similarity. Click here for file

Additional file 2

ORFs included in the whole genome alignment of WORiC and WOVitA1. Highlighted regions match colours indicated in Figure 3b and represent regions of sequence similarity. Click here for file

Additional file 3

ORFs included in the whole genome alignment of WORiC and WORiB. Highlighted regions match colours indicated in Figure 3c and represent regions of sequence similarity. Click here for file

Additional file 4

ORFs included in the whole genome alignment of WORiC and WOMelB. Highlighted regions match colours indicated in Figure 3d and represent regions of sequence similarity. Click here for file
  36 in total

1.  Genes for the type IV secretion system in an intracellular symbiont, Wolbachia, a causative agent of various sexual alterations in arthropods.

Authors:  S Masui; T Sasaki; H Ishikawa
Journal:  J Bacteriol       Date:  2000-11       Impact factor: 3.490

2.  How many wolbachia supergroups exist?

Authors:  Nathan Lo; Maurizio Casiraghi; Emanuela Salati; Chiara Bazzocchi; Claudio Bandi
Journal:  Mol Biol Evol       Date:  2002-03       Impact factor: 16.240

3.  Imbroglios of viral taxonomy: genetic exchange and failings of phenetic approaches.

Authors:  Jeffrey G Lawrence; Graham F Hatfull; Roger W Hendrix
Journal:  J Bacteriol       Date:  2002-09       Impact factor: 3.490

Review 4.  Prophages and bacterial genomics: what have we learned so far?

Authors:  Sherwood Casjens
Journal:  Mol Microbiol       Date:  2003-07       Impact factor: 3.501

5.  A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.

Authors:  Stéphane Guindon; Olivier Gascuel
Journal:  Syst Biol       Date:  2003-10       Impact factor: 15.683

6.  Diversity, distribution and specificity of WO phage infection in Wolbachia of four insect species.

Authors:  L Gavotte; F Vavre; H Henri; M Ravallec; R Stouthamer; M Boulétreau
Journal:  Insect Mol Biol       Date:  2004-04       Impact factor: 3.585

Review 7.  Prophage genomics.

Authors:  Carlos Canchaya; Caroline Proux; Ghislain Fournous; Anne Bruttin; Harald Brüssow
Journal:  Microbiol Mol Biol Rev       Date:  2003-06       Impact factor: 11.056

Review 8.  Wolbachia pipientis: microbial manipulator of arthropod reproduction.

Authors:  R Stouthamer; J A Breeuwer; G D Hurst
Journal:  Annu Rev Microbiol       Date:  1999       Impact factor: 15.500

9.  Cytoplasmic incompatibility and sperm cyst infection in different Drosophila-Wolbachia associations.

Authors:  Zoe Veneti; Michael E Clark; Sofia Zabalou; Timothy L Karr; Charalambos Savakis; Kostas Bourtzis
Journal:  Genetics       Date:  2003-06       Impact factor: 4.562

10.  Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements.

Authors:  Martin Wu; Ling V Sun; Jessica Vamathevan; Markus Riegler; Robert Deboy; Jeremy C Brownlie; Elizabeth A McGraw; William Martin; Christian Esser; Nahal Ahmadinejad; Christian Wiegand; Ramana Madupu; Maureen J Beanan; Lauren M Brinkac; Sean C Daugherty; A Scott Durkin; James F Kolonay; William C Nelson; Yasmin Mohamoud; Perris Lee; Kristi Berry; M Brook Young; Teresa Utterback; Janice Weidman; William C Nierman; Ian T Paulsen; Karen E Nelson; Hervé Tettelin; Scott L O'Neill; Jonathan A Eisen
Journal:  PLoS Biol       Date:  2004-03-16       Impact factor: 8.029

View more
  6 in total

1.  The complexity of virus systems: the case of endosymbionts.

Authors:  Jason A Metcalf; Seth R Bordenstein
Journal:  Curr Opin Microbiol       Date:  2012-05-19       Impact factor: 7.934

2.  Widespread phages of endosymbionts: Phage WO genomics and the proposed taxonomic classification of Symbioviridae.

Authors:  Sarah R Bordenstein; Seth R Bordenstein
Journal:  PLoS Genet       Date:  2022-06-06       Impact factor: 6.020

3.  Wolbachia Endosymbiont of the Horn Fly (Haematobia irritans irritans): a Supergroup A Strain with Multiple Horizontally Acquired Cytoplasmic Incompatibility Genes.

Authors:  Mukund Madhav; Rhys Parry; Jess A T Morgan; Peter James; Sassan Asgari
Journal:  Appl Environ Microbiol       Date:  2020-03-02       Impact factor: 4.792

4.  Large proportion of genes in one cryptic WO prophage genome are actively and sex-specifically transcribed in a fig wasp species.

Authors:  Guan-Hong Wang; Li-Ming Niu; Guang-Chang Ma; Jin-Hua Xiao; Da-Wei Huang
Journal:  BMC Genomics       Date:  2014-10-13       Impact factor: 3.969

5.  Stable distinct core eukaryotic viromes in different mosquito species from Guadeloupe, using single mosquito viral metagenomics.

Authors:  Chenyan Shi; Leen Beller; Ward Deboutte; Kwe Claude Yinda; Leen Delang; Anubis Vega-Rúa; Anna-Bella Failloux; Jelle Matthijnssens
Journal:  Microbiome       Date:  2019-08-28       Impact factor: 14.650

6.  Distribution and Evolution of the Bacteriophage WO and Its Antagonism With Wolbachia.

Authors:  Yun-Heng Miao; Jin-Hua Xiao; Da-Wei Huang
Journal:  Front Microbiol       Date:  2020-11-13       Impact factor: 5.640

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.