Literature DB >> 22046386

Evaluation of type-specific real-time PCR assays using the LightCycler and J.B.A.I.D.S. for detection of adenoviruses in species HAdV-C.

Morris S Jones1, Nolan Ryan Hudson, Carl Gibbins, Stephen L Fischer.   

Abstract

Sporadically, HAdVs from species HAdV-C are detected in acute respiratory disease outbreaks. To rapidly type these viruses, we designed real-time PCR assays that detect and discriminate between adenovirus types HAdV-C1, -C2, -C5, and -C6. Sixteen clinical isolates from the California Department of Public Health were used to validate the new assays. Type-specific TaqMan real-time PCR assays were designed and used independently to successfully identify 16 representative specimens. The lower limit of detection for our LightCycler singleplex real-time PCR assays were calculated to be 100, 100, 100, and 50 genomic copies per reaction for HAdV-C1, HAdV-C2, HAdV-C5 and HAdV-C6, respectively. The results for the singleplex J.B.A.I.D.S. assays were similar. Our assays did not cross-react with other adenoviruses outside of species HAdV-C, respiratory syncytial virus, influenza, or respiratory disease causing bacteria. These assays have the potential to be useful as diagnostic tools for species HAdV-C infection.

Entities:  

Mesh:

Year:  2011        PMID: 22046386      PMCID: PMC3203158          DOI: 10.1371/journal.pone.0026862

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Human adenoviruses (HAdVs) were the first respiratory viruses to be isolated and characterized. Epidemiological studies show that adenoviruses are a common cause of epidemic respiratory illness in crowded adult populations [1], [2]. Human adenoviruses are members of the genus Mastadenovirus and are grouped into seven species (A–G), based on their nucleic acid characteristics, penton, hexon, and fiber protein characteristics, biological properties and phylogenetic analysis [3], [4], [5], [6], [7]. They are associated with a broad range of symptoms, including acute respiratory disease (ARD), gastroenteritis, keratoconjunctivitis, and genitourinary infections [1], [2]. Viruses in species HAdV-C are weakly pathogenic in adult populations [8]. In contrast, when they infect children under 2 years of age, the clinical outcome can lead to acute respiratory disease, intussusception [9], [10], pneumonia, or myocarditis in infants under age 1 [11]–[12]. Moreover, an association between prenatal species HAdV-C infection and development of childhood acute leukemia was recently reported [13]. In the previous century, HAdVs were detected by tissue culture and discriminated by type-specific serum neutralization methods [14]. However, traditional (probeless) PCR assays have since replaced these methods owing to their greater speed, significantly lower cost, and to the decline in availability of type-specific antisera [15]. A variety of reliable PCR assays have been developed and used, including species-specific [16] and type-specific [17] tests. Universal PCR assays paired with sequence analysis has been used to provide a truly comprehensive detection and discrimination method for all HAdV types [18]. Real-time (probe-based) PCR platforms now offer even greater efficiency, improved sensitivity and specificity, and the added information value resulting from quantitative analysis of viral titers [19], [20], [21]. In this study we developed a series of real-time PCR assays for both the LightCycler and the military Joint Biological Agent Identification Detection System (J.B.A.I.D.S.) platforms which can detect and discriminate between HAdVs in species HAdV-C. Combined, these tools offer a rapid, high-throughput method for detection and discrimination of viruses in species HAdV-C. These assays will allow for much more rapid outbreak assessment, and, if validated as in-house diagnostic assays, more rapid individual and public health responses.

Results

LightCycler and J.B.A.I.D.S. TaqMan real-time PCR assays

The detection of Human adenoviruses C1 (HAdV-C1), -C2, -C5, and –C6 by real-time PCR from cultured isolates is summarized in Table 1. All samples were tested on the LightCycler 2.0 and the J.B.A.I.D.S platforms. All positive samples were correctly identified (Table 1).
Table 1

Summary of Human adenovirus (HAdV) detection by real-time PCR using the LightCycler 2.0 and J.B.A.I.D.S. in cultured isolates from the CDPH.

SamplesLightCycler 2.0 real-time PCRJ.B.A.I.D.S. real-time PCR
PositiveNegativePositiveNegative
HAdV-C16060
HAdV-C24040
HAdV-C55050
HAdV-C61010

Lower limit of detection for singleplex assays

Standard curves were created using different dilutions of genomic DNA ranging from 50 to 107 genome copies per assay from each HAdV (Fig. 1). Using the LightCycler 2.0, the lower limit of detection (LLOD) for our singleplex assays was 100, 100, 100, and 50 genomic copies per reaction for HAdV-C1, -C2, -C5, and –C6, respectively (Table 2). Using the J.B.A.I.D.S. the LLOD for our singleplex assays was 50, 50, 100, and 100 genomic copies per reaction for HAdV-C1, -C2, -C5, and –C6, respectively (Table 2). We defined the LLOD as the last dilution before the crossing points stopped increasing. The singleplex assay results for HAdV-C1, -C2, -C5, and –C6 were similar on the J.B.A.I.D.S. system (Table 2). Linear regression of the CP values and the quantity of genomic DNA revealed negative linearity for all curves (Fig. 1), corresponding to 100, 97, 93, and 99% PCR efficiency for HAdV-C1, -C2, -C5, and –C6 singleplex assays, respectively. The dynamic range for the HAdV-C2 and –C6 assays was 50 to 1.0×107 DNA genomic copies per PCR reaction and 102 to 1.0×106 DNA genomic copies per PCR reaction for HAdV-C1 and HAdV-C5. These experiments were repeated twice with similar results.
Figure 1

Standard curves for amplification of HAdV-C1, -C2, -C5, and -C6.

Detection by real-time LightCycler PCR in a series of dilutions of genomic HAdV-C1, -C2, -C5, and -C6 DNA. Linear regression of the standard curves for (A) HAdV- C1, (B) HAdV-C2, (C) HAdV-C5, and (D) HAdV-C6. We defined the LLOD as the last dilution before the crossing points ceased to increase.

Table 2

LLOD for HAdV singleplex reactions (genome copies/reaction).

LLOD LightCycler 2.0LLOD J.B.A.I.D.S.
HAdV-C110050
HAdV-C210050
HAdV-C5100100
HAdV-C650100

Standard curves for amplification of HAdV-C1, -C2, -C5, and -C6.

Detection by real-time LightCycler PCR in a series of dilutions of genomic HAdV-C1, -C2, -C5, and -C6 DNA. Linear regression of the standard curves for (A) HAdV- C1, (B) HAdV-C2, (C) HAdV-C5, and (D) HAdV-C6. We defined the LLOD as the last dilution before the crossing points ceased to increase.

Specificity of Real-Time PCR assays

Because adenoviruses in species HAdV-C are well conserved in the hexon and fiber genes, we wanted to determine if our assays were specific to the target HAdV types. Analytical specificity data is shown in Table 3. Assays that detect HAdV-C2, -C5, and –C6 showed low level amplification with HAdV-C1, -C2, and –C5, respectively after 35 cycles. However, our assays did not react with HAdV-B3, -E4, -B7, -B11, -B14, or –B21. In addition, our real-time PCR assays did not generate false positive results when challenged with genomic DNA extracted from other agents which cause respiratory disease such as Haemophilus influenza, Influenza A virus, Human rhinovirus, Human parainfluenza virus, Human respiratory syncytial virus, Chlamydophila pneumonia, Escherichia Coli, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycoplasma pneumonia, and Legionella Pneumophila.
Table 3

Specificity table of each HAdV assay.

PathogenHAdV-C1HAdV-C2HAdV-C5HAdV-C6
HAdV-C1+a
HAdV-C2+b
HAdV-C5+c
HAdV-C6+
HAdV-B3
HAdV-E4
HAdV-B7
HAdV-B11
HAdV-B14
HAdV-B21
Haemophilus influenzae
Influenza A virus
Human rhinovirus
Human parainfluenza virus
Human respiratory syncytial virus
Chlamydophila pneumoniae
Escherichia Coli
Klebsiella pneumonia
Pseudomonas aeruginosa
Mycoplasma pneumoniae
Legionella Pneumophila

a – Low levels of HAdV-C1 was detected with the HAdV-C2 primers and probes after 35 cycles.

b – Low levels of HAdV-C2 was detected with the HAdV-C5 primers and probes after 35 cycles.

c – Low levels of HAdV-C5 was detected with the HAdV-C6 primers and probes after 35 cycles.

a – Low levels of HAdV-C1 was detected with the HAdV-C2 primers and probes after 35 cycles. b – Low levels of HAdV-C2 was detected with the HAdV-C5 primers and probes after 35 cycles. c – Low levels of HAdV-C5 was detected with the HAdV-C6 primers and probes after 35 cycles.

Discussion

There has been a need for a rapid, accurate diagnostic type specific assays which are able to differentiate HAdVs. Currently there are type specific real-time PCR assays for species HAdV-B and HAdV-E [20], [21], but not for species HAdV-C. Since viruses in species HAdV-C cause morbidity in people who are immunosupressed and/or immunocompromised [22], [23], it is critical to be able to detect and discriminate between all common respiratory HAdV types. We describe the first series of real-time PCR assays which can discriminate between the four viruses which are known in species HAdV-C. Since it is not possible to predict outbreaks, for example the HAdV-B14 outbreak in 2006 [24], [25], it is important to have high-quality assays readily available that can determine which adenovirus is present. Although the described singleplex assays can be used to determine whether or not nucleic acid from a virus in species HAdV-C is present in less than two hours, which is faster than conventional PCR, we recommend that these assays be used on isolates that are untypeable via PCR assays that have been validated for clinical samples [21]. In terms of cost, the described real-time PCR assays are less labor intensive which directly decreases the cost of testing each sample. Moreover, the cost of the primers and probes is less than a dollar per test. Thus, our assays are rapid and inexpensive. One limitation to the described assays is that they target the hexon gene which has been shown to be incomplete when typing HAdVs [3]. If a HAdV which has the fiber of HAdV-C1 and the hexon of HAdV-C5, using the singleplex assays described in this study, the virus would be incorrectly typed as HAdV-C5. However, if these assays are used on a sample that contains two viruses from species HAdV-C, both viruses will be detected in separate capillaries. The described singleplex assays were able to accurately detect the four known viruses in species HAdV-C. Unfortunately, after 35 cycles the primer/probe pairs for HAdV-C2, -C5, and –C6 amplified low levels of HAdV-C1, -C2, and –C5, respectively. This may be due to the fact that the viruses in species HAdV-C are genetically similar [26]. However, this was surprising in light of the genetic diversity that is present in the hexon genes of the viruses in species HAdV-C (Fig. 2). This was the region we used to design all primer/probe pairs. This demonstrates the complexity of designing type-specific assays using real-time PCR.
Figure 2

Primer design for type specific primer/probe pairs in species HAdV-C hexon.

Conclusions

We generated single real-time PCR assays that are sensitive and specific and provide accurate quantitation of HAdV in species HAdV-C. These assays have the potential to be useful as routine diagnostic tools for the rapid detection of clinical samples on already existing platforms which are positive for HAdV-C1, -C2, -C5, and –C6.

Materials and Methods

Ethics Statement

The work reported herein was approved by the Institutional Review Board at the David Grant USAF Medical Center. Informed Consent was not required, because we did not use clinical samples.

Viral Isolates

Samples collected at CDPH were clinical isolates cultured in A549 cells, and subsequently frozen at −80°C and transported on dry ice for testing. Aliquots used in this study were subjected to one freeze/thaw cycle in the process of aliquotting upon receipt at CDPH, and one further freeze/thaw cycle when aliquotted for shipment to the David Grant Medical Center. The A549 cells used in this study were used in a previous study [5], [20] and are a common cell line used for adenovirus research.

Processing of cultured viruses for PCR

Cultured isolates were processed as follows. Nucleic acid was extracted from 175 µL aliquots using the MagNA Pure LC DNA Isolation Kit I (Roche, Indianapolis, IN, USA) according to the manufacturers' recommendations for the MagNA Pure LC automated nucleic acid extraction system. Adenovirus strains HAdV-B14 (VR-15), -B3 (VR-3), -E4 (VR-1572), -B7 (VR-7), -B11 (VR-12), -B21 (VR-256), Haemophilus influenza, Influenza A virus (ATCC VR-96), Human rhinovirus 14 (ATCC VR-284), Human parainfluenza virus 2 (ATCC VR-92), Human respiratory syncytial virus (ATCC VR-26), Chlamydophila pneumonia (ATCC 53592), Escherichia Coli, Klebsiella pneumonia (ATCC 13883), Pseudomonas aeruginosa (ATCC 97), Mycoplasma pneumonia, and Legionella Pneumophila (ATCC 33152) were acquired from the American Type Culture Collection (ATCC; Manassas, VA, USA). Genomic DNA from each adenovirus strain was quanitated by calculating the number of genomes based on the A260 reading on the NanaDrop 8000 (Thermo Scientific, Wilmington).

Optimization of assays

First, we performed experiments to determine the appropriate annealing temperature for each series of primers via conventional PCR. Reaction conditions were as follows: initial denaturation at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing temperature gradient ranged from 48°C to 65°C for 30 s, and extension at 72°C for 30 s. Each singleplex assay was optimized for MgCl2 concentration as well as extension and annealing times. To optimize the MgCl2 concentration, we used 0, 1, 2, 3, 4, 5 and 6 mM MgCl2 as the final concentration of the PCR reaction. We also amplified a fixed amount of genomic DNA with different annealing (25, 20, and 15s) and extension times (20, 15, 10, and 5s). The FastStart High Fidelity PCR System kit was used for all conventional PCR (Roche).

Quantitative real-time PCR

The primers used to detect the different viruses in species HAdV-C are listed in Table 4. Experiments were performed on a Joint Biological Agent Identification and Diagnostic System (J.B.A.I.D.S) and the LightCycler 2.0 (Roche). All J.B.A.I.D.S. experiments were performed using the same primers, probes, and conditions as the LightCycler 2.0. The J.B.A.I.D.S. thermocycler was conceived and developed to rapidly identify biological warfare agents and other pathogens of concern for the U.S. Military. For real-time J.B.A.I.D.S. PCR, cycling was carried out in a J.B.A.I.D.S. real-time thermocycler (Idaho Technologies, UT, USA) using 1 µl of extracted DNA in 2 µls of LC FastStart DNA Master HybProbe mix (Roche, Indianapolis, IN, USA) (Roche), containing 5 mM MgCl2 and 400 nM forward and reverse primers. Reaction conditions were as follows: initial denaturation at 95°C for 15 min, followed by 45 cycles of denaturation at 95°C for 1 s, annealing at 60°C for 15 s, and extension at 72°C for 5 s. The progress of real-time fluorescent PCR was monitored at 530 nm. To establish external standard curves for the quantification of each HAdV, genomic DNA from each strain was diluted in a 10-fold series (102 to 107 copies per reaction) and analyzed with the new assay. The samples that defined the standard curve were performed in triplicate and repeated twice.
Table 4

Primers for real-time PCR amplification of adenovirus. The accession numbers for the viral genome sequences are HAdV-C1 (AF534906), HAdV-C2 (AC_000007), HAdV-C5 (AC_000008), HAdV-C6 (FJ349096).

VirusPrimer/probeGenePosition in genomePrimer sequenceAmplicon (bp)
HAdV-C1prHAdV-C1-Fhexon19285 AGGAAATGGCTGAAGAACT 159
prHAdV-C1-R19443 TTTGTAAGCCATTGGCGG
prbHAdV-C119382FAM-GACTCATGTATATGCTCAGGCTCCT-TAMRA
HAdV-C2prHAdV-C2-440Fhexon19277 AGGATGAAGAAGAGGAAGAT 181
prHAdV-C2-620R19457 GCGTATACAGGTTTAGCTTG
prb-HAdV-C2-56319402FAM- AAAGCGGGCTACAAATAGGAT-TAMRA
HAdV-C5prHAdV-C5.HEX.19261Fhexon19261 GCTCTTGAAATAAACCTAGAAGAA 273
prHAdV-C5.HEX.19533R19533 TTTCATTGGGGTAGTCTTT
prbHAdV-C5.419312FAM-GACGAGCAAGCTGAGCAGC-TAMRA
HAdV-C6prHAdV-C6-Fhexon19259 CTGCACAAGTGGATGCT 162
prHAdV-C6-R19420 CGTCGGCAGTTCCTATTT
prbHAdV-C619343FAM-AAACCCATGTATATGCCCAGG-TAMRA
  26 in total

1.  PCR analysis of egyptian respiratory adenovirus isolates, including identification of species, serotypes, and coinfections.

Authors:  David Metzgar; Miguel Osuna; Samuel Yingst; Magda Rakha; Kenneth Earhart; Diaa Elyan; Hala Esmat; Magdi D Saad; Adriana Kajon; Jianguo Wu; Gregory C Gray; Margaret A K Ryan; Kevin L Russell
Journal:  J Clin Microbiol       Date:  2005-11       Impact factor: 5.948

2.  Evidence of frequent recombination among human adenoviruses.

Authors:  Alexander N Lukashev; Olga E Ivanova; Tatiana P Eremeeva; Richard D Iggo
Journal:  J Gen Virol       Date:  2008-02       Impact factor: 3.891

3.  Abrupt emergence of diverse species B adenoviruses at US military recruit training centers.

Authors:  David Metzgar; Miguel Osuna; Adriana E Kajon; Anthony W Hawksworth; Marina Irvine; Kevin L Russell
Journal:  J Infect Dis       Date:  2007-10-31       Impact factor: 5.226

4.  Outbreak of severe respiratory disease associated with emergent human adenovirus serotype 14 at a US air force training facility in 2007.

Authors:  Jacqueline E Tate; Michel L Bunning; Lisa Lott; Xiaoyan Lu; John Su; David Metzgar; Lorie Brosch; Catherine A Panozzo; Vincent C Marconi; Dennis J Faix; Mila Prill; Brian Johnson; Dean D Erdman; Vincent Fonseca; Larry J Anderson; Marc-Alain Widdowson
Journal:  J Infect Dis       Date:  2009-05-15       Impact factor: 5.226

5.  Acute myocarditis. Rapid diagnosis by PCR in children.

Authors:  A B Martin; S Webber; F J Fricker; R Jaffe; G Demmler; D Kearney; Y H Zhang; J Bodurtha; B Gelb; J Ni
Journal:  Circulation       Date:  1994-07       Impact factor: 29.690

6.  New adenovirus species found in a patient presenting with gastroenteritis.

Authors:  Morris Saffold Jones; Balázs Harrach; Robert D Ganac; Mary M A Gozum; Wilfred P Dela Cruz; Brian Riedel; Chao Pan; Eric L Delwart; David P Schnurr
Journal:  J Virol       Date:  2007-03-14       Impact factor: 5.103

7.  Increasing incidence of adenovirus disease in bone marrow transplant recipients.

Authors:  P Flomenberg; J Babbitt; W R Drobyski; R C Ash; D R Carrigan; G V Sedmak; T McAuliffe; B Camitta; M M Horowitz; N Bunin
Journal:  J Infect Dis       Date:  1994-04       Impact factor: 5.226

Review 8.  Advances in real-time PCR: application to clinical laboratory diagnostics.

Authors:  Bernhard Kaltenboeck; Chengming Wang
Journal:  Adv Clin Chem       Date:  2005       Impact factor: 5.394

9.  Evidence of molecular evolution driven by recombination events influencing tropism in a novel human adenovirus that causes epidemic keratoconjunctivitis.

Authors:  Michael P Walsh; Ashish Chintakuntlawar; Christopher M Robinson; Ijad Madisch; Balázs Harrach; Nolan R Hudson; David Schnurr; Albert Heim; James Chodosh; Donald Seto; Morris S Jones
Journal:  PLoS One       Date:  2009-06-03       Impact factor: 3.240

10.  Adenovirus DNA is detected at increased frequency in Guthrie cards from children who develop acute lymphoblastic leukaemia.

Authors:  B Gustafsson; W Huang; G Bogdanovic; F Gauffin; A Nordgren; G Talekar; D A Ornelles; L R Gooding
Journal:  Br J Cancer       Date:  2007-09-18       Impact factor: 7.640

View more
  2 in total

1.  A cost effective real-time PCR for the detection of adenovirus from viral swabs.

Authors:  Turkiya Al-Siyabi; Khalifa Binkhamis; Melanie Wilcox; Sallene Wong; Kanti Pabbaraju; Raymond Tellier; Todd F Hatchette; Jason J LeBlanc
Journal:  Virol J       Date:  2013-06-07       Impact factor: 4.099

2.  Quantitative real-time PCR assays for detection and type-specific identification of the endemic species C human adenoviruses.

Authors:  Xiaoyan Lu; Dean D Erdman
Journal:  J Virol Methods       Date:  2016-06-27       Impact factor: 2.014

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.