Seán P Barry1, Samir Ounzain2, James McCormick2, Tiziano M Scarabelli3, Carol Chen-Scarabelli3, Louis I I Saravolatz3, Giuseppe Faggian4, Alessandro Mazzucco4, Hisanori Suzuki5, Christoph Thiemermann6, Richard A Knight2, David S Latchman2, Anastasis Stephanou7. 1. Institute of Molecular Medicine, St. James's Hospital, Trinity College Dublin, Dublin 8, Ireland. 2. Medical Molecular Biology Unit, Institute of Child Health, University College London, 30 Guilford Street, London, WC1N 1EH, UK. 3. Center for Heart and Vessel Preclinical Studies, St. John Hospital and Medical Center, Wayne State University School of Medicine, 22201 Moross Road, Detroit, USA. 4. Division of Cardiac Surgery, University of Verona, Verona, Italy. 5. Sezione di Chimica Biologica, Dipartimento di Scienze Morfologico-Biomediche, Università di Verona, Strada Le Grazie, 8, I-37134 Verona, Italy. 6. Centre for Translational Medicine and Therapeutics, William Harvey Research Institute, St Bartholomew's and The Royal London School of Medicine and Dentistry, Queen Mary University of London, London, UK. 7. Medical Molecular Biology Unit, Institute of Child Health, University College London, 30 Guilford Street, London, WC1N 1EH, UK. Electronic address: a.stephanou@ich.ucl.ac.uk.
Abstract
BACKGROUND: IL-17A and IL-17F are pro-inflammatory cytokines which induce the expression of several cytokines, chemokines and matrix metalloproteinases (MMPs) in target cells. IL-17 cytokines have recently attracted huge interest due to their pathogenic role in diseases such as arthritis and inflammatory bowel disease although a role for IL-17 cytokines in myocardial infarction (MI) has not previously been described. METHODS: In vivo MI was performed by coronary artery occlusion in the absence or presence of a neutralizing IL-17 antibody for blocking IL-17 actions in vivo. IL-17 signaling was also assessed in isolated primary cardiomyocytes by Western blot, mRNA expression and immunostaining. RESULTS: Expression of IL-17A, IL-17F and the IL-17 receptor (IL-17RA) were all increased following MI. Expression of several IL-17 target genes, including Cxcl1, Cxcl2, IL-1β, iNOS and IL-6 was also upregulated following MI. In addition, IL-17A promoted the expression of Cxcl1 and IL-6 in isolated cardiomyocytes in a MAPK and PI(3)K-dependent manner. IL-17A and ischaemia/reperfusion (I/R) injury were found to have an additive effect on Cxcl1 expression, suggesting that IL-17 may enhance myocardial neutrophil recruitment during MI. Moreover, protein levels of both IL-17R and IL-17A were enhanced following in vivo MI. Finally, blocking IL-17 signaling in vivo reduced the levels of apoptotic cell death markers following in vivo MI. CONCLUSIONS: These data imply that the expression of IL-17 cytokines and their receptor are elevated during myocardial I/R injury and may play a fundamental role in post infarct inflammatory and apoptotic responses.
BACKGROUND:IL-17A and IL-17F are pro-inflammatory cytokines which induce the expression of several cytokines, chemokines and matrix metalloproteinases (MMPs) in target cells. IL-17 cytokines have recently attracted huge interest due to their pathogenic role in diseases such as arthritis and inflammatory bowel disease although a role for IL-17 cytokines in myocardial infarction (MI) has not previously been described. METHODS: In vivo MI was performed by coronary artery occlusion in the absence or presence of a neutralizing IL-17 antibody for blocking IL-17 actions in vivo. IL-17 signaling was also assessed in isolated primary cardiomyocytes by Western blot, mRNA expression and immunostaining. RESULTS: Expression of IL-17A, IL-17F and the IL-17 receptor (IL-17RA) were all increased following MI. Expression of several IL-17 target genes, including Cxcl1, Cxcl2, IL-1β, iNOS and IL-6 was also upregulated following MI. In addition, IL-17A promoted the expression of Cxcl1 and IL-6 in isolated cardiomyocytes in a MAPK and PI(3)K-dependent manner. IL-17A and ischaemia/reperfusion (I/R) injury were found to have an additive effect on Cxcl1 expression, suggesting that IL-17 may enhance myocardial neutrophil recruitment during MI. Moreover, protein levels of both IL-17R and IL-17A were enhanced following in vivo MI. Finally, blocking IL-17 signaling in vivo reduced the levels of apoptotic cell death markers following in vivo MI. CONCLUSIONS: These data imply that the expression of IL-17 cytokines and their receptor are elevated during myocardial I/R injury and may play a fundamental role in post infarct inflammatory and apoptotic responses.
Following the onset of myocardial ischaemia/reperfusion (I/R) injury, local release of cytokines and chemokines leads to neutrophil and macrophage recruitment into the infarct area to facilitate clearance of dead cells and matrix debris. Within two weeks of the initial MI, the inflammation eventually resolves, dead cardiac myocytes are replaced by granulation tissue, wound healing ensues and fibroblasts and endothelial cells are recruited to aid in scar formation and ventricular remodeling [1]. Thus inflammation following I/R is initially beneficial, although, if prolonged, it can lead to significant cardiac damage. Therefore, anti-inflammatory therapies represent an attractive target for prevention of MI related pathology. However, initial clinical anti-inflammatory strategies for MI have so far proved disappointing, and thus a greater understanding of how the inflammatory process is coordinated during MI is needed [2].The IL-17 cytokine family consists of 6 members (IL-17A-F). IL-17A and IL-17F share the greatest similarity, with 55% homology at the amino acid level. The Il17a and Il17f genes are adjacent on human chromosome 6 and mouse chromosome 1 and may undergo co-ordinate regulation [3]. IL-17A and IL-17F can be secreted as both disulfide-linked homodimeric and heterodimeric glycoproteins and have been shown to be produced by T cells, activated monocytes, fibroblasts and neutrophils [4]. IL-17A and IL-17F promote the release of the cytokines IL-6, TNF-α and IL-1β, and the chemokines Cxcl1 (KC/Groα), MCP-1 (Ccl2) and IL-8 from fibroblasts, endothelial cells and leukocytes and thus are considered to be pro-inflammatory [5-7]. In addition IL-17A and IL-17F have been shown to synergise with other cytokines such as IL-1β, IFN-γ and TNF-α to enhance proinflammatory responses [8].IL-17A and IL-17F are produced by the Th17 lineage of CD4+ effector T cells, and Th17 cells, and by inference IL-17A and IL-17F, are involved in inflammatory arthritis, Crohn's disease, psoriasis and multiple sclerosis [9-11]. Little is known about IL-17 regulation in the cardiovascular system, although IL-17A appears to be necessary for the onset of fibrosis, remodelling and progression to dilated cardiomyopathy in a mouse model of myocarditis [12]. IL-17 has also been implicated in renal I/R injury [13], although the mechanisms by which IL-17 contributes to these myocardial and non-myocardial ischaemic pathologies have not been studied. Therefore, we have studied expression of IL-17 and its consequences in both in vitro and in vivo models of myocardial I/R, and show that expression of both IL-17 and its receptors, together with downstream IL-17 targets, is increased by I/R, and that IL-17 neutralisation reduces myocardial cell death.
Materials and methods
This study was performed in accordance with the United Kingdom Home Office Animals (Scientific Procedures) Act 1986. All reagents were obtained from Sigma-Aldrich (Poole Dorset, UK) unless otherwise stated. Recombinant IL-17 was from Peprotech. Neutralizing IL-17 (AF-421-NA) was from R & D Systems.
In vivo ischemia/reperfusion injury in the rat
The method of coronary artery occlusion and reperfusion in the anaesthetised rat was performed as previously described [14]. Briefly, male Wister rats (255–285 g) were anaesthetised with thiopentone sodium (Intraval® 120 mg/kg i.p.). Anesthesia was maintained by supplementary injections of thiopentone sodium as required. The trachea was cannulated and the animals were ventilated with a Harvard ventilator (inspiratory oxygen concentration: 30%; 70 strokes/min, tidal volume: 8–10 ml/kg). Body temperature was maintained at 37 ± 1 °C and the right carotid artery was cannulated and connected to a pressure transducer (Senso-Nor 840, Senso-Nor, Horten, Norway). The right jugular vein was then cannulated for the administration of drugs. A para-sternal thoracotomy was then performed, using an electrosurgery device to cauterize the intercostal arteries before cutting through three ribs. The chest was retracted and pericardium dissected from the heart. The left anterior descending (LAD) coronary artery was isolated and a snare occluder was placed around the LAD. The retractor was then removed and the animal allowed to stabilise for 15 min. The occluder was tightened at time 0. After 25 min of LAD-occlusion, the occluder was released to allow reperfusion for 2 h. At the end of the reperfusion period, the LAD was re-occluded and 1 ml of Evans Blue dye (2% w/v) was injected into the animal via the jugular vein. Evans Blue dye stains the tissue through which it is able to circulate, so that the non-perfused vascular (occluded) tissue remains uncoloured. Each animal was sacrificed with an over-dose of anaesthetic, the heart excised, and washed thoroughly in PBS. The heart was then sectioned into slices of 3–4 mm, the right ventricle wall was removed, and the risk area (the non-perfused and, hence, non-stained myocardium) was separated from the non-ischaemic (blue) tissue before being immediately snap-frozen in liquid nitrogen or fixed in formaldehyde 4% for up to 48 h.
In vivo neutralization of IL-17A
In a different set of experiments rats were treated with 200 μg of anti-IL-17A polyclonal antibody intraperitoneally (R & D Systems, AF-421-NA) or PBS 2 h before undergoing in vivo ischemia/reperfusion injury.
Assay of creatine phosphokinase
1 ml of blood was collected from the tail vein of sham operated rats, after thoracotomy, as well as control ischaemia/reperfusion and treated rats, at the end of the reperfusion time. CPK levels were evaluated spectrophotometrically, as previously described [15].
Neonatal rat ventricular cardiac myocyte culture
Neonatal rat ventricular cardiac myocytes (NRVM) were isolated from the hearts of 1–3 day old Sprague Dawley rats. Hearts were removed and placed in oxygenated ADS buffer (116 mM NaCl, 5.4 mM KCl, 20 mM HEPES, 0.8 mM NaH2PO4, 405.7 μM MgSO4, 5.5 mM glucose, pH 7.35). Heart tissue was digested in 10 ml oxygenated ADS buffer supplemented with 0.1% collagenase and 0.025% pancreatin for 15 min. Liberated cells were pelleted at 300 g for 5 min and resuspended in FBS. This digestion procedure was repeated 7 times after which cells were plated at 37 °C for 1 h to allow adherence of fibroblasts. Myocytes were plated at a density of 2.5 × 105/ml in DMEM with 40 units/ml penicillin (Gibco), 40 μg/ml streptomycin and 15% FBS. Cells were allowed to attach overnight and the media was replaced with DMEM 1% FBS. For ischaemia/reperfusion experiments, cells were incubated for 4 h in ischaemic buffer (137 mM NaCl, 12 mM KCL, 0.49 mM MgCl2, 0.9 mM CaCl2, 4 mM HEPES, 20 mM sodium lactate, 10 mM deoxyglucose, pH 6.2) in a 37 °C hypoxic chamber with 5% CO2, 95% argon. Following hypoxia, medium was replaced with DMEM 1% FBS and cells were reoxygenated in 5% CO2 in a 37 °C incubator for 4 h. For experimental controls, cells were incubated for four hours in control buffer (137 mM NaCl, 3.8 mM KCl, 0.49 mM MgCl2, 0.9 mM CaCl2, 4 mM HEPES, 10 mM glucose, pH 7.4) then in DMEM 1% FBS.
Adenoviral infections
The STAT3C adenovirus was a kind gift from Prof. Michitaka Ozaki, Okayama University, Japan and the GFP adenovirus was a kind gift from Prof. Brian Foxwell, Imperial College London, UK. Recombinant viruses were propagated using human embryonic kidney 293 cells and purified through a cesium chloride gradient and PD-10 column (GE Healthcare). Viral titre was determined by plaque assay in 293 cells. Viral transduction was carried out by incubating cells at the indicated multiplicity of infection (MOI) of 100 in serum free medium; after 2 h cells were washed and fresh media added.
Affymetrix microarray analysis
RNA was extracted from the area at risk of the left ventricle using Trizol (Invitrogen). Biotinylated cRNA targets were prepared using the Ambion Message Amp II protocol. 15 μg fragmented cRNA probes were added to 50 pM of control oligonucleotides (bioB, bioC, bioD and Cre), 30 μg herring sperm DNA, 150 μg BSA, 30 μl DMSO and 150 μl hybridisation buffer to a final volume of 300 μl, which was then heated to 99 °C for 5 min then 45 °C for 5 min. 200 μl hybridisation mix was added to prehybridised Affymetrix rat expression 230A microarrays and rotated overnight at 60 rpm for 16 h at 45 °C. Arrays were stained and washed on an Affymetrix GeneChip Fluidics Station 450 using the standard Affymetrix EukGE-WS2v4 script and were scanned using an Affymetrix GeneChip scanner. Scanned images were obtained using Affymetrix GeneChip Operating Software (GCOS) and all microarrays passed quality control standards which included present calls ≥ 40%, scaling factor < 2, GAPDH 3′/5′ ratios < 3 and RNA degradation plots which showed equivalent slopes between microarrays. Downstream analysis was conducted using the Bioconductor R 2.8 programmes AffylmGUI [16] and OneChannelGUI [17]. Background correction, normalisation and summarisation of the probe-level data into probe-set expression values were carried out using GC-Robust Multi-array Analysis (GC-RMA) from imported Affymetrix image (CEL) files. Differential expression was calculated based on the Linear Models for Microarray (limma) statistics package in Bioconductor R and multiple testing was corrected by using the Benjaminini and Hochberg false discovery rate (FDR) [18]. Genes were considered to be differentially expressed where there was a fold change ≥ 2 with an FDR-adjusted P value ≤ 0.05. Each transcript was annotated based on the gene identifiers present in the Affymetrix NetAffx database. Microarray data has been deposited at the EMBL-EBI ArrayExpress repository (http://www.ebi.ac.uk/microarray-as/ae/, accession number E-MEXP-2098) and some data has been previously reported [31].
Quantitative Real-Time PCR (qPCR)
RNA was extracted using Trizol reagent according to the manufacturer's instructions (Invitrogen, Paisley, UK) and cDNA was prepared using Superscript II (Invitrogen). qPCR was carried out using Platinum SYBR Green (Invitrogen) on the DNA Engine Opticon system (MJ Research, Waltham, MA). For PCR reactions, 5 μl SYBR Green was added to 5 μl cDNA with 500 nM primers in a 20 μl reaction and the PCR conditions were 95 °C for 3 min, followed by 45 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s. A melt-curve was performed from 65 °C to 95 °C, reading every 0.3 °C with a 1 s hold between reads. Specific primers were designed with the aid of CloneWorks and the Ensembl database and are listed in Table 1. Where possible, primers were intron-spanning; for single-exon genes, a control cDNA reaction without reverse transcriptase was included to confirm the absence of genomic DNA and all PCR reactions were visualised on agarose gels to ensure the presence of a single product. HPRT, β-Actin and β2-microglobulin were used together as normalising genes for each experiment. Both target and normalising gene PCR efficiency was firstly determined to ensure normalizing genes were acceptable; to test primer efficiency, qPCR was carried out on a 2-fold dilution series from a pooled set of cDNA and the threshold Ct value was plotted against the log cDNA dilution. Efficiency was then calculated using the equation m = (− 1 / logE), where m is the slope of the line and E is the efficiency, and primer pairs were used only if the PCR efficiency of the normalising and control genes were found to be within 10% of each other [19]. Expression changes were calculated using the 2− ΔΔCt method and expressed as fold change over control [20].
Table 1
Primers sequences used for qPCR analysis.
Gene
Forward
Reverse
Accession number
IL-1β
TTCAGGCAGGCAGTATCACT
CAGCATCTCGACAAGAGCTT
NM_031512
inos
AGCGGCTCCATGACTCTCA
TGCACCCAAACACCAAGGT
NM_012611
Cxcl1
TCGCCAATGAGCTGCGCTGT
GGGACACCCTTTAGCATCTT
NM_030845.1
Mmp9
GAAGACGACATAAAAGGCATCC
TCAGAAGGACCAGCAGTAG
NM_031055
IL-6
ACTGCCTTCCCTACTTCACA
GCTCTGAATGACTCTGGCTT
NM_012589
Socs3
TGGTCACCCACAGCAAGTTT
ACCAGCTTGAGTACACAGTC
NM_053565.1
IL-17A
AGGCCCTCAGACTACCTCA
TCTCAGGCTCCCTCTTCAG
NM_001106897.1
IL-17RA
GGGTGTATGGCCTCATCAC
ACAGGCAGTGATCAGGAACT
NM_001107883.2
IL-17 F
GGAGGATAACAGTGTGAGAG
ATTTCTTGCTGGATGGGGAC
NM_001015011.1
MCP-1
TGCAGTTAATGCCCCACTCA
TCTCACTTGGTTCTGGTCCA
NM_031530.1
β2-microglobulin
GTCTTTCTGGTGCTTGTCTCA
GTGAGCCAGGATATAGAAAGA
NM_012512
Hprt
CTCATGGACTGATTATGGACAGGAC
GCAGGTCAGCAAAGAACTTATAGCC
NM_012583
β-actin
AGATGACCCAGATCATGTTTGAG
AGGTCCAGACGCAGGATG
NM_031144
Preparation and staining of sections
Serial 5-mm myocardial sections were cut from paraffin blocks and, after dewaxing and heat-mediated antigen retrieval, were stained with TUNEL reagents and propidium iodide, as previously described [15]. Data are expressed as the means of 12–15 high power fields ± SD.
Western blot
Cells were lysed in RIPA buffer (0.75 M NaCl, 5% (v/v) NP40, 2.5% (w/v) deoxycholate, 0.5% (w/v) SDS, 0.25 M Tris–HCl pH 8.0, 10 mM DTT containing protease inhibitor cocktail) and centrifuged at 13,000 ×g to pellet cell debris. Protein concentration from the supernatant was determined using the BCA protein assay kit (Pierce, Rockford, USA). 20 μg of protein was electrophoresed on 10% polyacrylamide gels, transferred to Hybond-C nitrocellulose membranes (Amersham Biosciences, Bucks, UK) and blocked for 30 min in 4% non-fat dry milk in TBS. Following protein transfer, nitrocellulose membranes were incubated overnight with the following antibodies: STAT3, IL-17 and IL-17 receptor, pERKY204 and ERK were from Santa Cruz, GAPDH was from Chemicon and pJNKT183/T185, JNK, pp38T180/Y182, p38, pAKTS473, AKT active caspase 3 were from Cell Signaling. Secondary antibodies were from DAKO.
Statistical analysis
Statistical analysis was carried out using a Student's t-test or a one way ANOVA with Dunnet's post test, p-values of less than 0.05 were considered significant. Error bars represent mean ± SEM.
Results
Il-17 cytokines and their downstream effectors are upregulated in a myocardial infarction model
To identify novel regulators of myocardial I/R injury, we carried out microarray analysis of differentially expressed genes following in vivo myocardial infarction in the rat. This model consisted of 25 min ischaemia and 2 h reperfusion resulting in an average infarct size of 56.0 ± 2.0%. Microarray analysis was performed on left ventricular tissue isolated from the area at risk. Examination of differentially expressed genes showed that the IL-17 receptor (IL-17RA) was upregulated 7.0 ± 1.1 fold and this was verified by qPCR (Fig. 1a). We also examined the expression of IL-17A and IL-17 F by qPCR and found that their expression was also upregulated 8.3 ± 3.2 fold and 4.3 ± 1.3 fold respectively following I/R. In addition we examined the protein levels of IL-17RA and IL-17A and found a significant increase in both (Fig. 1b). We were also interested in whether downstream mediators of IL-17 might be induced by I/R injury, and a manual search of the microarray dataset revealed a number of known IL-17 targets which were upregulated by I/R injury, including genes involved in cell migration, inflammation and tissue remodeling (Table 2). The expression of several of these, including IL-1β, iNOS, IL-6 and MMP-9, was verified by PCR (Fig. 1c), although it must be stressed that, while these are indeed downstream targets of IL-17 signalling, they can be induced by multiple stimuli in the ischaemic heart.
Fig. 1
IL-17A, IL-17F, IL-17 receptor and IL-17 target genes are transcriptionally upregulated following in vivo I/R injury. RNA and protein was extracted from the left ventricles of rats undergoing sham operation or 25 min ischaemia and 2 h reperfusion (I/R). (A) IL-17RA, IL-17A and IL-17F expression was measured by qPCR. (B) IL-17A and IL-17RA protein levels were assessed by western blot, GAPDH was used as a loading control. (C) Expression of the IL-17 target genes IL-6, IL-1, iNOS and MMP-9 was measured by qPCR.
Table 2
Modulation of mRNA genes in the intact heart following in vivo I/R. Details of the Affymetyrix microarray analysis is described in the Materials and methods section.
AffyID
Symbol
Gene title
FC
P value
Cell migration
1387316_at
Cxcl1
Chemokine (C-X-C motif) ligand 1 (KC)
5.00
4.6E−03
1368760_at
Cxcl2
Chemokine (C-X-C motif) ligand 2 (MIP2a)
27.68
2.5E−03
1370634_x_at
Cxcl3
Chemokine (C-X-C motif) ligand 2 (MIP2b)
4.14
5.2E−03
1367973_at
Ccl2
Chemokine (C-C motif) ligand 2 (MCP-1)
5.08
2.4E−04
1370083_at
Ccr1
Chemokine (C-C motif) receptor 1
7.21
1.7E−03
1387202_at
Icam1
Intercellular adhesion molecule 1
4.30
1.3E−02
Inflammatory mediators
1398256_at
Il1b
Interleukin 1 beta
12.83
1.4E−03
1387667_at
Nos2
Nitric oxide synthase 2, inducible
11.79
1.3E−02
1369191_at
Il6
Interleukin 6
9.39
2.9E−03
1387011_at
Lcn2
Lipocalin 2
3.95
2.5E−02
1368527_at
Ptgs2
Prostaglandin-endoperoxide synthase 2 (Cox-2)
2.70
1.5E−02
1368494_at
S100a8
S100 calcium binding protein A8
8.51
2.7E−03
1387125_at
S100a9
S100 calcium binding protein A9
8.00
1.8E−04
Tissue remodelling
1398275_at
Mmp9
Matrix metallopeptidase 9
10.22
3.2E−03
1367712_at
Timp1
TIMP metallopeptidase inhibitor 1
6.36
2.2E−04
Other
1388596_at
Cotl1
Coactosin-like 1
3.24
4.5E−03
1373554_at
Spsb1
splA and SOCS box containing 1
3.10
6.9E−04
IL-17 enhances I/R dependent Cxcl1 expression in cardiac myocytes
We next examined the expression of particular IL-17 targets in cardiac myocytes in more detail. The chemokine Cxcl1 (KC) and its receptor CXCR2 play a significant role in neutrophil infiltration into inflamed tissue [3]. We found that Cxcl1 was rapidly induced (within 1 h) in response to IL-17A and stayed elevated over a 24 h period, albeit with a decline between 6 h and 12 h (Fig. 2a). IL-6 also displayed a biphasic regulation in response to IL-17A, with slightly increased levels at 1 h, returning to baseline by 2 h and then increasing again from 6 h on (Fig. 2b). IL-17A has previously been shown to induce robust MCP-1 (CCL2) expression in fibroblasts, macrophages, epithelium, mesangial cells, astrocytes and glial cells [21-23]. However we found that IL-17 did not affect MCP-1 levels in cardiac myocytes suggesting that cardiac myocytes respond to IL-17 in a cell type specific manner (Fig. 2c). Since both IL-17 and IL-6 induce STAT3 activity, we also examined the expression of the STAT3 target gene Socs3. The expression pattern of Socs3 was found to closely parallel that of IL-6 suggesting that changes in Socs3 expression may be secondary to IL-6 production (Fig. 2d).
Fig. 2
IL-17 induces Cxcl1, IL-6 and Socs3 expression in cardiac myocytes. Neonatal rat ventricular myocytes were treated with 10 ng/ml IL-17 for the indicated times and the levels of (A) Cxcl1, (B) IL-6, (C) MCP-1 and (D) Socs3 were measured by qPCR. Experiments were repeated in duplicate, statistical analysis was carried out using a one-way ANOVA followed by Dunnett's post test, *p < 0.05, **p < 0.01, ***p < 0.001. (E) I/R injury and IL-17 have additive effects on Cxcl1 expression. NRVMs were subjected to 4 h ischaemia and 6 h reperfusion with or without 10 ng/ml IL-17 which was added at the time of reperfusion. The expression of Cxcl1 was analysed by qPCR. Statistical analysis was carried out using student's t-test. **p < 0.01, **p < 0.001.
We next examined the effect of co-administration of IL-17 on I/R-induced Cxcl1 expression. Both I/R injury and IL-17A increased Cxcl1 levels, and treating myocytes with IL-17 at the time of reperfusion resulted in an additive effect on I/R induced Cxcl1 expression (Fig. 2e). This suggests that IL-17 production during I/R injury leads to augmented expression of Cxcl1 which may enhance recruitment of inflammatory cells into the heart.
IL-17A induces Cxcl1 and IL-6 expression in cardiac mycoytes in a ERK1/2, p38 and PI(3)K dependent manner
Since IL-17A has been shown to regulate MAPKs in other cell types, we examined the kinetics of MAPK activity in NRVMs following IL-17A treatment, and found that IL-17A had differing kinetic effects on each MAPK tested (Fig. 3a). ERK1/2 phosphorylation was induced within 15 min of IL-17A stimulation and remained elevated up to 16 h. In contrast, JNK was rapidly phosphorylated which returned to baseline by 1 h. p38 phosphorylation increased slightly upon IL-17A treamtment and then was dephosphorylated from 1 h onwards. We also examined Akt activity and found a similar kinetic profile to JNK, with rapid induction within the first hour followed by dephosphorylation. Thus the kinetics of cardiac myocyte MAPK activation in response to IL-17 are highly dynamic.
Fig. 3
IL-17 mediated upregulation of Cxcl1 and IL-6 in cardiac myocytes is MAPK dependent. (A) NRVMs were treated with 10 ng/ml IL-17 for the indicated times and cell lysates were analysed by Western blot using the indicated antibodies. (B) NRVMs were pre-treated for 30 min with the indicated inhibitors followed by IL-17 stimulation for 6 h. The expression of Cxcl1 and IL-6 was measured by qPCR. Statistical analysis was carried out using a student's t-test. *p < 0.05, **p < 0.01, **p < 0.001.
Next we examined what contribution IL-17-mediated activation of MAPKs and PI(3)K/Akt had on IL-17-dependent regulation of Cxcl1 and IL-6 expression. Cardiac myocytes were pre-treated for 30 min with various inhibitors. IL-17 was then added to the culture medium for 6 h and the expression of Cxcl1 and IL-6 assessed by qPCR. Inhibition of ERK1/2, p38 or PI(3)K all significantly reduced IL-17-mediated Cxcl1expression, although only U0126 abolished expression completely; inhibition of JNK or JAK2 had no effect (Fig. 3b). Likewise, IL-17 mediated IL-6 expression was found to be dependent on ERK1/2, p38 and PI (3) K while inhibition of JAK2 with AG490 slightly increased IL-6 expression but this did not reach statistical significance (Fig. 3b). Interestingly, inhibition of JNK with SP600125 increased the expression of IL-6, suggesting that JNK may actually inhibit IL-17 dependent IL-6 expression, although it must be noted that SP600125 has documented off-target effects [24]. These data show that in cardiac myocytes, activation of ERK1/2, p38 and PI(3)K are necessary for maximum induction of IL-17 dependent targets.
IL-17F and IL-17RA mRNA and protein levels are upregulated in primary cardiac myocytes and also in the in vivo heart following ischemia/reperfusion injury
In order to examine IL-17 regulation in cardiac cells, we subjected neonatal cardiac myocytes (NRVMs) to simulated I/R injury in vitro and measured the expression of IL-17RA, IL-17A and IL-17F by qPCR. The mRNA expression of IL-17RA was time-dependently increased during I/R injury in NRVMs, reaching a maximum of 2.3 ± 0.4 fold increase over baseline by 4 h (Fig. 4a). The mRNA expression of IL-17F was increased during ischaemia and reached a maximum of 32.3 ± 4.4 fold by 4 h reperfusion and remained elevated up to 24 h (Fig. 4a). Thus, in agreement with data from the whole heart, both IL-17RA and IL-17F show increased expression in isolated cardiac myocytes shortly after the onset of reperfusion. We verified these results by subjecting the rat myobast cell line H9c2 to I/R injury. As in the NRVMs, we saw upregulation of IL-17F mRNA levels by 4 h reperfusion (Fig. 4b). The expression of the IL-17 target gene Cxcl1 was also upregulated by 4 h reperfusion, although in contrast to NRVMs, IL-17RA levels did not increase upon reperfusion in H9c2 cells. Since oxidative stress represents a significant component of I/R injury, we also examined the expression of IL-17F and IL-17RA following H2O2 treatment of NRVMs. Oxidative stress resulted in increased expression of IL-17F and Cxcl1 did not affect levels of the IL-17 receptor (Fig. 4c). Taken together, these data show that IL-17 signalling is augmented in cardiac myocytes during I/R injury and suggests that these changes are, at least in part, consequent on oxidative stress.
Fig. 4
IL-17 receptor and IL-17F are transcriptionally upregulated in cardiac myocytes. (A) NRVM were subjected to 4 h in vitro ischaemia and up to 24 h reperfusion in normal media after which the levels of IL-17 receptor and IL-17F were assessed by qPCR. (B) H9c2 cells were subjected to in vitro I/R for the indicated times and the levels of IL-17F and Cxcl1 were measured by qPCR. (C) NRVMs were treated with 200 μM H2O2 for 6 h and the expression of the indicated genes was measured by qPCR. (D) NRMVs were transduced with STAT3C adenovirus at MOI = 100. After 48 h, increased expression of STAT3 was confirmed by Western blot and IL-17F expression was measured by qPCR. *p < 0.05, **p < 0.01, ***p < 0.001, student's t-test, n = 3 per group, repeated in duplicate.
IL-17F mRNA expression is induced by STAT3 in cardiac myocytes
We have previously shown that the STAT3 transcription factor is induced within 1 h of reperfusion in cardiac myocytes [25]. We noted that I/R mediated expression of IL-17F displayed a similar kinetic profile to that of the STAT3 target gene SOCS3, with maximal expression between 2 and 4 h, returning to lower levels by 24 h [25]. STAT3 has been shown to bind to both the IL-17A and IL-17F promoters in CD4+ T cells, and STAT3 deficient T cells produce substantially less IL-17A and IL-17F under TGFβ + IL-6 polarizing conditions [26]. This suggests that induction of STAT3 during I/R injury could be responsible for upregulation of IL-17F mRNA levels in cardiac myocytes. To address this, we transduced NRVMs with an adenovirus expressing a constitutively active form of STAT3 (STAT3C) or a control GFP adenovirus. Transduction of myocytes with STAT3C resulted in robust induction of STAT3 protein and IL-17F mRNA, showing that IL-17F is indeed a target of STAT3 in cardiac myocytes, and thus I/R dependent induction of IL-17 genes may be STAT3 dependent (Fig. 4D).
Blocking IL-17 signaling reduces myocyte necrosis and apoptosis in the rat heart exposed to in vivo ischaemia/reperfusion
Since IL-17 has been reported to be a target for therapeutic intervention in immune and inflammatory diseases [11] and also in the progression of dilated cardiomyopathy [12] we addressed whether blocking IL-17 signaling is beneficial in the intact heart following I/R. As shown in Fig. 5A, I/R injury resulted in greatly elevated levels of circulating CPK (971 + 64 mU/min/GWW) which were reduced by over 50% in response to IL-17 inhibition, demonstrating significantly reduced myocardial necrosis. Moreover, animals injected intra-peritoneally (i.p) with an IL-17 neutralizing antibody were found to have significantly reduced myocardial apoptosis as assessed by TUNEL positivity (Fig. 5B) and by reduced levels of cleaved caspase-3 in response to I/R (Fig. 5C). Overall, these data suggest that the enhanced IL-17 signaling following I/R injury may promote myocardial damage.
Fig. 5
Blocking IL-17 signalling with a specific anti-IL-17 neutralizing antibody reduced creatine phosphokinase and apoptotic cell death in the myocardium following in vivo I/R injury. Plasma concentration of CPK (A) and apoptosis assessed by the TUNEL assay (B) in sham-operated (control) or rats exposed to in vivo I/R injury (I/R) or I/R plus treatment with IL-17 neutralizing antibody (IL-17 Bo Ab). Immunofluorescence data (left panel) (Data are mean of ± 6 rats **P < 0.001). Anti-IL-17 neutralizing antibody also reduced the increase in cleaved/active caspase-3 expression following in vivo I/R injury (C). Western blot analysis was performed on tissue lysates prepared as in Fig. 3A above and immunoblotted with a specific antibody against the cleaved and active form of caspase-3 and GAPDH.
Discussion
In this study, we show that I/R injury in the heart enhances expression of IL-17RA and its cognate ligands, IL-17A and IL-17F. Moreover, this enhanced IL-17 signalling results in increased expression of downstream pro-inflammatory targets, such as Cxcl1 and IL-6, which is mediated by activation of a number of MAPKs. In the intact heart in vivo, IL-17 neutralisation results in reduced necrotic and apoptotic myocyte death, suggesting that inhibition of the IL-17 pathway may be of therapeutic benefit in human MI.IL-17 is a proinflammatory cytokine which is involved in the clearance of extracellular pathogens and has been implicated as a driving force in many inflammatory diseases. IL-17 has been demonstrated to be instrumental in the progression to dilated cardiomyopathy in autoimmune myocarditis [12], although the precise role of the IL-17 family in the myocardium remains poorly defined. Elevated expression of the receptor IL-17RA has previously been detected in diseased tissue, for example in the joints of arthriticpatients and in the CNS of mice during autoimmune encephalomyelitis [27].The IL-17-induced chemokine, Cxcl1, was originally isolated from a cDNA screen of PDGF inducible genes and, like all CXC chemokines, is strongly chemotactic for neutrophils due to the tripeptide ELR (Gln-Leu-Arg) motif located between the N terminus and the first cysteine [7,8]. We found that IL-17A increased Cxcl1 expression in cardiac myocytes and I/R injury augmented this response. The co-operativity between reperfusion injury and IL-17A may be explained by the increased levels of IL-17RA which are seen early in I/R injury. Thus the heart responds to I/R injury by upregulating the IL-17 receptor and this then primes the heart for further signals mediated by the increased levels of IL-17A and IL-17F, thereby facilitating increased production of chemokines. Another possible explanation lies in the fact that IL-17A cooperates with cytokines such as TNF-α to stabilize mRNA transcripts [28]. Since TNF-α is known to be produced by cardiac myocytes in response to I/R injury, IL-17 may work in partnership with TNF-α to stabilize Cxcl1 mRNA levels in the infarcted heart. We therefore suggest that increases in IL-17 dependent signalling may serve as an important regulator of neutrophil migration into the myocardium.We found that isolated cardiac myocytes express very low mRNA levels of IL-17A. However IL-17A has been shown to be produced by cardiac fibroblasts, and thus the increased expression seen in the whole heart following MI may be of fibroblast origin [28]. In contrast, I/R injury or oxidative stress led to a robust induction of IL-17F mRNA in NRVMs, suggesting that cardiac myocytes may exclusively express this form of IL-17. While IL-17A and IL-17F can have both complementary and distinct functions, they also associate to form an IL-17A/F heterodimer which possesses intermediate levels of activity compared to homodimers [3]. Therefore, cardiac myocyte derived IL-17F may associate with IL-17A from other cellular sources within the heart.STAT3 has been shown to be necessary for both the differentiation and stabilization of Th17 cells via transactivation of the Th17 specific transcription factors, retinoic acid receptor-related orphan receptor gamma (RORγ) and alpha (RORα) [29]. Moreover, STAT3 is necessary for the subsequent production of IL-17A and IL-17F which mediate Th17 cells' biological effects. We have shown that the expression of IL-17F during I/R injury in cardiac myocytes closely paralleled that of STAT3 activity and that overexpression of STAT3 alone was sufficient to drive expression of IL-17F. The JAK/STAT pathway is a major determinant of myocardial viability following I/R injury [30] and our results suggest that it may also drive cardiac inflammation through induction of IL-17F in cardiac myocytes.Taken together, these data show that I/R injury is associated with activation of the IL-17 pathway and its downstream targets in the heart, and that this contributes to the necrotic and apoptotic loss of end-stage cardiomyocytes. Elevated IL-17 signalling in turn promotes Cxcl1 production in cardiac myocytes and thus may represent a major mediator of neutrophil infiltration into the heart following MI. Our present data also show that blocking IL-17 reduced the levels of apoptotic cell death in the heart following I/R and suggests that targeting IL-17 cytokines may be an effective strategy for MI. Further investigation into the clinical efficacy of inhibiting IL-17 signalling in the heart as a treatment option for early reperfusion injury is warranted
Authors: Richard A Knight; Carol Chen-Scarabelli; Zhaokan Yuan; Roy B McCauley; J Di Rezze; Gabriele M Scarabelli; Paul A Townsend; David Latchman; Louis Saravolatz; Giuseppe Faggian; Alessandro Mazzucco; Hardial S Chowdrey; Anastasis Stephanou; Tiziano M Scarabelli Journal: FEBS Lett Date: 2008-02-22 Impact factor: 4.124
Authors: Douglas L Mann; John J V McMurray; Milton Packer; Karl Swedberg; Jeffrey S Borer; Wilson S Colucci; Jacques Djian; Helmut Drexler; Arthur Feldman; Lars Kober; Henry Krum; Peter Liu; Markku Nieminen; Luigi Tavazzi; Dirk Jan van Veldhuisen; Anders Waldenstrom; Marshelle Warren; Arne Westheim; Faiez Zannad; Thomas Fleming Journal: Circulation Date: 2004-03-15 Impact factor: 29.690
Authors: Li Li; Liping Huang; Amy L Vergis; Hong Ye; Amandeep Bajwa; Vivek Narayan; Robert M Strieter; Diane L Rosin; Mark D Okusa Journal: J Clin Invest Date: 2009-12-14 Impact factor: 14.808
Authors: Seán P Barry; Paul A Townsend; James McCormick; Richard A Knight; Tiziano M Scarabelli; David S Latchman; Anastasis Stephanou Journal: Biochem Biophys Res Commun Date: 2009-05-18 Impact factor: 3.575
Authors: Jayasri Das Sarma; Bogoljub Ciric; Ryan Marek; Sanjoy Sadhukhan; Michael L Caruso; Jasmine Shafagh; Denise C Fitzgerald; Kenneth S Shindler; Am Rostami Journal: J Neuroinflammation Date: 2009-04-28 Impact factor: 8.322
Authors: Mayya Geha; Maria G Tsokos; Robin E Bosse; Tatyana Sannikova; Yoichiro Iwakura; Jurandir J Dalle Lucca; Rene De Waal Malefyt; George C Tsokos Journal: J Immunol Date: 2017-09-06 Impact factor: 5.422