Understanding the nature of renal erythropoietin-producing cells (REPs) remains a central challenge for elucidating the mechanisms involved in hypoxia and/or anemia-induced erythropoietin (Epo) production in adult mammals. Previous studies have shown that REPs are renal peritubular cells, but further details are lacking. Here, we describe an approach to isolate and characterize REPs. We bred mice bearing an Epo gene allele to which green fluorescent protein (GFP) reporter cDNA was knocked-in (Epo(GFP)) with mice bearing an Epo gene allele lacking the 3' enhancer (Epo(Δ3'E)). Mice harboring the mutant Epo(GFP/Δ3'E) gene exhibited anemia (average Hematocrit 18% at 4 to 6 days after birth), and this perinatal anemia enabled us to identify and purify REPs based on GFP expression from the kidney. Light and confocal microscopy revealed that GFP immunostaining was confined to fibroblastic cells that reside in the peritubular interstitial space, confirming our previous observation in Epo-GFP transgenic reporter assays. Flow cytometry analyses revealed that the GFP fraction constitutes approximately 0.2% of the whole kidney cells and 63% of GFP-positive cells co-express CD73 (a marker for cortical fibroblasts and Epo-expressing cells in the kidney). Quantitative RT-PCR analyses confirmed that Epo expression was increased by approximately 100-fold in the purified population of REPs compared with that of the unsorted cells or CD73-positive fraction. Gene expression analyses showed enrichment of Hif2α and Hif3α mRNA in the purified population of REPs. The genetic approach described here provides a means to isolate a pure population of REPs, allowing the analysis of gene expression of a defined population of cells essential for Epo production in the kidney. This has provided evidence that positive regulation by HIF2α and negative regulation by HIF3α might be necessary for correct renal Epo induction.
Understanding the nature of renal erythropoietin-producing cells (REPs) remains a central challenge for elucidating the mechanisms involved in hypoxia and/or anemia-induced erythropoietin (Epo) production in adult mammals. Previous studies have shown that REPs are renal peritubular cells, but further details are lacking. Here, we describe an approach to isolate and characterize REPs. We bred mice bearing an Epo gene allele to which green fluorescent protein (GFP) reporter cDNA was knocked-in (Epo(GFP)) with mice bearing an Epo gene allele lacking the 3' enhancer (Epo(Δ3'E)). Mice harboring the mutant Epo(GFP/Δ3'E) gene exhibited anemia (average Hematocrit 18% at 4 to 6 days after birth), and this perinatal anemia enabled us to identify and purify REPs based on GFP expression from the kidney. Light and confocal microscopy revealed that GFP immunostaining was confined to fibroblastic cells that reside in the peritubular interstitial space, confirming our previous observation in Epo-GFP transgenic reporter assays. Flow cytometry analyses revealed that the GFP fraction constitutes approximately 0.2% of the whole kidney cells and 63% of GFP-positive cells co-express CD73 (a marker for cortical fibroblasts and Epo-expressing cells in the kidney). Quantitative RT-PCR analyses confirmed that Epo expression was increased by approximately 100-fold in the purified population of REPs compared with that of the unsorted cells or CD73-positive fraction. Gene expression analyses showed enrichment of Hif2α and Hif3α mRNA in the purified population of REPs. The genetic approach described here provides a means to isolate a pure population of REPs, allowing the analysis of gene expression of a defined population of cells essential for Epo production in the kidney. This has provided evidence that positive regulation by HIF2α and negative regulation by HIF3α might be necessary for correct renal Epo induction.
Erythropoietin (Epo) governs mammalian erythropoiesis. Epo is a glycoprotein hormone mainly produced in the kidney and liver in response to changes in tissue oxygen tension. Epo regulates erythropoiesis by supporting the survival of erythroid progenitors and stimulating their differentiation and proliferation in bone marrow, hence increasing the oxygen-carrying capacity of blood [1]. Lack of Epo during mouse development leads to lethality at embryonic day 13.5 (E13.5) due to severe anemia [2] and over- or under-production of Epo results in polycythemia or anemia clinically [1]. Epo production is considered to be controlled primarily at the level of gene transcription and Epo gene expression is strictly regulated in a tissue/cell-specific and hypoxia/anemia-induced manner [3]–[7].Several tissues have been reported to express the Epo gene; but the ability to produce substantial amounts of Epo during hypoxia/anemia is restricted to the fetal liver and adult kidney [4]–[8]. The kidney plays a major role in oxygen sensing and contributes ∼90% of plasma Epo in adult animals [9]. However, difficulties in identification and purification of the renal Epo-producing cells (REPs) have limited the understanding of the mechanism for controlling Epo production in kidney. REPs are frequently reported to be peritubular fibroblast-like cells in kidney [6], [10], [11]; and a hypoxia-dependent Epo-producing cell line derived from humanrenal cancer was also described recently to exhibit fibroblast-like phenotype [12]. However, further details remain to be elucidated [5], [7], [13].Current knowledge of the molecular mechanisms of oxygen-sensing and renal Epo gene expression has been extrapolated mostly from in vitro studies in hepatoma cell lines [14]–[16]. These studies have suggested that hypoxia responsiveness of the Epo gene depends on an enhancer containing hypoxia-responsive elements (HREs) located in the 3′ flanking region of the gene (3′ enhancer), to which the hypoxia-inducible transcription factor (HIF) 1 binds. HIF1 is composed of two subunits, HIF1α and HIF1β. HIF1β is constitutively expressed, but HIF1α expression, almost absent in normoxia, is increased during hypoxia. Under normoxic conditions, HIF1α is hydroxylated at two proline residues by specific prolyl-4-hydroxylases (PHD1–3) that allow the E3 ubiquitin ligase von Hippel-Lindau (pVHL) to bind to HIF1α and mark it for proteasomal degradation. In addition, HIF1α is regulated by the aspargine hydroxylase factor inhibiting HIF1 (FIH1), which inhibits p300/CBP (CREB-Binding Protein) binding to HIF1α. The activities of PHD and FIH1 are basically dependent on cellular oxygen concentration and thus qualify as cellular oxygen sensors. Low oxygen tension causes inactivation of PHDs and FIH1, allows HIFα to accumulate, forms active transcription factor-complex HIF with HIF1β, recruits transcriptional cofactors, and initiates the transcription of hypoxia responsive genes including the Epo gene. Thus the PHD/pVHL/HIF system likes to be the oxygen-sensing pathway regulating Epo gene transcription [17].However, recent clinical and in vivo studies have suggested a new layer of complexity to the mechanisms involved in the cellular response to hypoxia/anemia. Evidence from mouse models and hereditary erythrocytosis in humans has revealed that HIF2α rather than HIF1α plays a vital role in oxygen-regulated erythropoiesis and renal Epo production is probably regulated by PHD2/pVHL/HIF2α pathway [13], [18], [19]. There are three HIFα family members: HIF1α, HIF2α, and HIF3α, which share a number of similarities e.g. DNA-binding sequence, oxygen-dependent hydroxylation. Unlike ubiquitously expressed HIF1α, expression of HIF2α and HIF3α is limited to several tissues [20]. Both HIF1α and HIF2α activate transcription, while HIF3α negatively regulates HIF1α and HIF2α activity [20]–[22]. There is no literature on HIF3α's role in hematopoiesis thus far.In order to clarify the whole picture of Epo gene regulation, we have generated a panel of mouse lines. First, we genetically deleted the 3′ enhancer (referred to as the Epo) and showed that this enhancer is necessary for hepatic Epo expression during the perinatal period {E17–postnatal day 13 (P13)} but dispensable for renal Epo expression after birth. Mice homozygous for the targeted allele (Epo) are viable and fertile, but exhibit anemia during late-embryonic and newborn stages [23]. Then, using a 180-kb Epo transgene with a green fluorescent protein (GFP) reporter (Epo-GFP), we recapitulated tissue-specific, hypoxia-inducible GFP expression in kidney and liver tissue of mouse. Mutation studies on the transgene indicated that GATA factors are required for suppression of ectopic expression of the gene, but not essential for the Epo gene induction in REPs [6]. Also, we developed GFP knock-in mice (Epo) by homologous recombination in mouse embryonic stem cells (NS and MY, unpublished data). By examining these mouse lines, we identified GFP-labeled REPs as a population of peritubular interstitial cells in the kidney after birth.Taken together, all these data in vivo strongly imply novel mechanism(s) and necessitate detailed studies on REPs to explore a specific oxygen-sensing pathway underlying the hypoxia-induced Epo production in the kidney.Fluorescence activated cell sorting (FACS) of GFP expressing cells has been widely used for the isolation of hematopoietic stem cells in our laboratory [24], [25]. To make the link between the molecular and cellular mechanisms of hypoxia-induced Epo expression, in this paper, we have addressed controversial issues in REPs using cell-sorting techniques. Our Epo-GFP transgenic mice are a source of REPs isolation, but a pretreatment to induce anemia is not always successful for stable GFP expression in the kidney [6]. We therefore generated Epomice, in which REPs were labeled with GFP as a result of neonatal anemia caused by genetic modifications. Taking advantage of the strong GFP expression in anemic newborns carrying the 3′ enhancer deletion, we have purified by FACS a cell population responsible for anemia/hypoxia induced Epo expression in the kidney.
Results
Generation of Epo Mice
We first tried to define REPs by GFP fluorescence, which truthfully reflects endogenous Epo expression. We have established Epomice by homologous recombination. In our Epomice, the Epo locus was targeted by replacing the 3′ part of exon 2 through exon 4 with GFP (Figure 1A, middle panel). The mice homozygous for Epo, which lacked a functional Epo gene, died around E13.5 from anemia, corresponding with the previous report on a Epo gene knockout mouse [2]. The heterozygous animals (Epo) were healthy and fertile; and distinct GFP expression, mimicking the endogenous Epo expression pattern, was observed in the kidney and liver under hypoxia/anemia conditions (NS and MY, unpublished data).
Figure 1
Generation of Epo mouse.
A Diagram shows structures of the wild type (wt, upper), Epo (middle) and Epo (lower), respectively. IRES, internal ribosomal entry site. B,C An Epo heterozygote and an Epo homozygote were bred to obtain the compound Epo genotype. Epo mice exhibited transient anemia during the perinatal stage: B at P5 looked pale; C presented a decreased Hct value even lower than that of Epo at P4–P6 stage. The Epo littermates were used as a normal control. *p<0.05.
Generation of Epo mouse.
A Diagram shows structures of the wild type (wt, upper), Epo (middle) and Epo (lower), respectively. IRES, internal ribosomal entry site. B,C An Epo heterozygote and an Epo homozygote were bred to obtain the compound Epo genotype. Epomice exhibited transient anemia during the perinatal stage: B at P5 looked pale; C presented a decreased Hct value even lower than that of Epo at P4–P6 stage. The Epo littermates were used as a normal control. *p<0.05.For steady Epo induction, we set out to genetically produce an anemia model by taking advantage of our established Epomice (Figure 1A, lower panel). As we previously reported in Epomice, deletion of the 3′ enhancer provokes transient anemia at late embryonic and neonatal stages due to defect in hepatic Epo production and erythropoiesis. This anemic phenotype is recovered in 2 weeks after birth when major Epo production site switches from the liver to kidney [23]. Crossing an Epo heterozygote with a mouse homozygous for Epo allele, we generated Epo compound offspring. The compound mice basically showed a similar phenotype to that of their Epo parents: anemia persisting after birth and recovered in the juvenile stage. Epo newborns were severely pale compared with Epo littermates (Figure 1B). At P4–6, the Hematocrit (Hct) of the Epo and Epo newborns were 22.7±5.3 and 18.0±2.0 (%), respectively (Figure 1C). At the same stage, the Hct of the Epo control was 32.0±4.1%; this value is comparable with that of wild type (data not shown). Increased Epo mRNA could be detected in the kidney of the Epo newborns by quantitative (q) RT-PCR (see below).
Cellular distribution of GFP expression in anemic neonatal kidneys
We then examined newborn (P4–6) kidneys to see GFP expression by immunostaining studies. In microscopic observation of the kidney section with anti-GFP immunostaining, fluorescence was minimal in control kidney samples from P4–6 Epo littermates, but was prominent in the kidneys from the Epomice (Figure 2A,B). GFP fluorescence was also directly detected in fixed Epo kidney slices by confocal microscopy (data not shown). GFP signals were confined to the cortex-medulla junction and focally distributed along the curve of the kidney at P4–6 (Figure 2B). GFP-expressing cells were stellate-shaped, nesting around proximal tubules in the deep cortical labyrinth and outer strip area of the kidney (Figure 2C,D). These findings are consistent with previous descriptions [5], [6], [26], [27] and indicate that the GFP expression reflects the endogenous expression of the Epo gene in kidneys of anemic Epo newborns.
Figure 2
GFP expression in the anemic kidney of Epo mouse.
Representative photos of P5 neonates: kidney slices A from a nonanemic Epo littermate as a negative control; B–D from Epo newborns. Light and confocal microscopy revealing the GFP signal concentrated in the deep-cortex∼outer-medulla region (B), where the Epo-producing peritubular interstitial cells are localized (C,D). Anti-GFP signals: green (Alexa 488), and dark-brown (diaminobenzidine). Scale bars: 25 µm. The sketch at the bottom illustrates peritubular localization of the GFP-expressing cells in the kidney.
GFP expression in the anemic kidney of Epo mouse.
Representative photos of P5 neonates: kidney slices A from a nonanemic Epo littermate as a negative control; B–D from Epo newborns. Light and confocal microscopy revealing the GFP signal concentrated in the deep-cortex∼outer-medulla region (B), where the Epo-producing peritubular interstitial cells are localized (C,D). Anti-GFP signals: green (Alexa 488), and dark-brown (diaminobenzidine). Scale bars: 25 µm. The sketch at the bottom illustrates peritubular localization of the GFP-expressing cells in the kidney.
Cell type of the GFP-expressing kidney cells in Epo newborns
Kidney interstitium contains mainly fibroblastic, dendritic cells [28], and vascular endothelial as well as tubular cells have also been identified as the site of Epo gene expression in the kidney [5]. We therefore carried out marker studies on GFP-expressing kidney cells of P4–6 anemic newborns by dual immunostaining under confocal microscopy and FACS detection (Table 1). Expression of platelet-derived growth factor receptor β (PDGFRβ) (Figure 3C) and Ecto-5′-nucleotidase/CD73 (Figure 4), but not CD31 (Figure 3A), major histocompatibility complex class II (MHCII) (Figure 3B), or E-cadherin (Movie S1), indicated that REPs are cortical fibroblast-like, but not tubular, endothelial, or dendritic cells. Our three-dimensional (3D) movie reveals that REPs are tightly packed around tubules, but not tubular cells themselves (Movie S1). We also examined the expression of alpha-smooth muscle actin (α-SMA), a marker for the subtype of renal interstitial fibroblasts [28]. Staining with α-SMA antibody was observed in the medullar and cortical cells near the capsule, but did not overlap with GFP-positive cells (Figure 3D). Taken together, most neonatal REPs at P4–6 stage, are CD73-, PDGFRβ-positive, α-SMA-negative peritubular fibroblasts (Table 1). Thus, neonatal REPs have the typical characteristics of adult cortical fibroblasts previously reported in healthy rat kidney [29].
Table 1
Expression of cellular markers in REPs by multiple immunostaining methods.
Surface marker
Specificity in renal cells
Expression
Methods
E-cadherin
Tubule
-
CM*, FACS
CD31
Endothelium
-
CM, FACS
MHCII
Dendritic cell
-
CM, FACS
CD73
Interstitial fibroblast
+ (63%)
CM, FACS
α-SMA
Myofibroblast
-
CM
PDGFRβ (CD140b)
Interstitial fibroblast
+ (50%)
CM, FACS
*CM: Confocal Microscopy.
Figure 3
Cellular marker characterization of the GFP+ kidney cells of Epo mouse.
Dual immunostaining combined with confocal microscopy indicating GFP-expressing cells are not endothelial (CD31, A), dendritic (MHCII, B), and tubular cells (E-cadherin,
). GFP-positive interstitial cells express fibroblast-like markers (PDGFRβ, C), but not myofibroblast marker (α-SMA, D). Kidney slices from P5 Epo mice were stained with GFP (green) and the indicated antibodies directly labeled with phycoerythrin (PE, red) or indirectly labeled with Alexa 594 (red) respectively. Merged images of the same kidney section are shown. DAPI: blue/nucleus; Scale bars: 25 µm.
Figure 4
Co-localization of GFP and CD73 in the peritubular interstitial cells of the Epo kidneys.
A–C Representitive images of confocal microscopy of kidney sections from P5 Epo mice. B A high-power view, demonstrated that GFP and CD73 were mostly co-localized in peritubular fibroblast cells (merged in yellow). Global merged view of the kidney sections from P5 Epo neonates (C), and Epo littermates (D). D Under normal conditions CD73 showed a wide expression spectrum in a variety of cellular types including a few interstitial fibroblasts in the kidney. C During anemia note that CD73+ cells appeared to be increased mainly in the peritubular fibroblast population. GFP: green; CD73: red; DAPI: blue/nucleus; merged: yellow. Scale bars: 20 µm.
Cellular marker characterization of the GFP+ kidney cells of Epo mouse.
Dual immunostaining combined with confocal microscopy indicating GFP-expressing cells are not endothelial (CD31, A), dendritic (MHCII, B), and tubular cells (E-cadherin,
). GFP-positive interstitial cells express fibroblast-like markers (PDGFRβ, C), but not myofibroblast marker (α-SMA, D). Kidney slices from P5 Epomice were stained with GFP (green) and the indicated antibodies directly labeled with phycoerythrin (PE, red) or indirectly labeled with Alexa 594 (red) respectively. Merged images of the same kidney section are shown. DAPI: blue/nucleus; Scale bars: 25 µm.
Co-localization of GFP and CD73 in the peritubular interstitial cells of the Epo kidneys.
A–C Representitive images of confocal microscopy of kidney sections from P5 Epomice. B A high-power view, demonstrated that GFP and CD73 were mostly co-localized in peritubular fibroblast cells (merged in yellow). Global merged view of the kidney sections from P5 Epo neonates (C), and Epo littermates (D). D Under normal conditions CD73 showed a wide expression spectrum in a variety of cellular types including a few interstitial fibroblasts in the kidney. C During anemia note that CD73+ cells appeared to be increased mainly in the peritubular fibroblast population. GFP: green; CD73: red; DAPI: blue/nucleus; merged: yellow. Scale bars: 20 µm.*CM: Confocal Microscopy.CD73 is considered to be a reliable marker for identification of renal cortical fibroblasts [27], and Epo-expressing cells [6], [11], [12], [28], [30]. In the kidney sections of P4–6 Epo newborns, roughly 60%, but not all of GFP-positive cells, expressed CD73. Therefore, GFP-positive cells were divided into CD73+ and CD73− populations (Figure 4A–C). Both CD73+ and CD73− GFP-expressing cortical interstitial cells were remarkably increased in Epo neonates (Figure 4C) compared with in Epo littermates (Figure 4D). In Epo non-anemic kidney, only a few GFP-expressing cells constituting both CD73+ and CD73− were observed and located in the juxtamedullary layer of the cortex (Figure 4D).Unlike GFP signals, which were restricted to peritubular interstitium, CD73 stains were widely spread in the renal cortex. Besides fibroblasts, proximal tubule (brush boarder), glomeruli (mesangial cells) and the cells in the medullar rays were also observed to express CD73 in sections. The proportion of CD73 expressing cells and their staining intensity in non-fibroblast cells were similar in both anemic and non-anemic kidney sections (Figure 4C, D), i.e. among various types of CD73-expressing kidney cells, only cortical fibroblasts showed a hypoxia/anemia-responsive tendency.
FACS sorting of GFP+ cells and Epo mRNA expression in the isolated cells
We isolated GFP+ cells from the kidneys of P4–6 Epo neonates by flow cytometry. Kidney cells from Epo littermates were used as negative controls (Figure 5B, upper-left panel). The GFP+ population was present grossly with a low to intermediate GFP intensity and constituted up to 0.2% of the total fresh kidney cells (Figure 5B, upper-right panel). This yielded several thousands viable GFP+ cells per Epomouse at P4–6 newborn stage, with a purity of greater than 75%. We also assessed the association of GFP-expressing cells with CD73. As shown in Figure 5B, lower-right panel, of GFP+ cells from P4–6 anemic kidneys, 63% were CD73+ and 37% were CD73−. A confocal microscopic image of the sorted GFP+ cells is shown with anti-GFP immunostaining (Figure 5C).
Figure 5
Isolation of REPs from the P4–6 Epo anemic kidneys.
A Cell purification protocol for a rare population of REPs from kidney. B, upper panel Representative FACS scatter plot of kidney cells from pooled P4–6 Epo neonates demonstrating GFP+ cells above the gate (set using Epo control cells). B, lower panel Assessment by FACS of percentage of GFP+ and CD73+ fractions in the kidney cells from P4–6 anemic Epo neonates. Pooled results were from three independent experiments. Note CD73 expression divides GFP+ cells into two parts: CD73+ and CD73−. C Representative confocal microscopy of the FACS-sorted GFP+ cells (REPs) with anti-GFP immunostaining. Scale bar: 5 µm. D Analysis of relative Epo mRNA levels by qRT-PCR (Hprt as a loading control) in FACS-purified GFP+ or the remaining GFP− kidney cells from P4–6 Epo mice; CD73+ vs. CD73− fractionated cells were also evaluated. The data shown are from four experiments, each performed in duplicate. nd: not detectable; *p<0.05.
Isolation of REPs from the P4–6 Epo anemic kidneys.
A Cell purification protocol for a rare population of REPs from kidney. B, upper panel Representative FACS scatter plot of kidney cells from pooled P4–6 Epo neonates demonstrating GFP+ cells above the gate (set using Epo control cells). B, lower panel Assessment by FACS of percentage of GFP+ and CD73+ fractions in the kidney cells from P4–6 anemic Epo neonates. Pooled results were from three independent experiments. Note CD73 expression divides GFP+ cells into two parts: CD73+ and CD73−. C Representative confocal microscopy of the FACS-sorted GFP+ cells (REPs) with anti-GFP immunostaining. Scale bar: 5 µm. D Analysis of relative Epo mRNA levels by qRT-PCR (Hprt as a loading control) in FACS-purified GFP+ or the remaining GFP− kidney cells from P4–6 Epomice; CD73+ vs. CD73− fractionated cells were also evaluated. The data shown are from four experiments, each performed in duplicate. nd: not detectable; *p<0.05.Subsequently, we evaluated the expression of Epo mRNA in each sorted fraction from P4–6 Epo kidneys, and in unsorted kidney cells of P4–6 Epo and Epo newborns as well. The hypoxanthine-phosphoribosyl-transferase (Hprt) gene was used as a loading control, because expression of HPRT is less affected by hypoxia/anemia [31]. As shown in Figure 5D, qRT–PCR revealed high Epo mRNA expression exclusively in samples from Epo animals including unsorted kidney cells, CD73−, CD73+ and GFP+ subsets. In Epomice, compared with the unsorted kidney, Epo mRNA levels were ∼100 fold enriched in the GFP+ fraction, but not in the CD73+ fraction. Epo mRNA expression was low but detectable in Epo kidney cells at P4–6, but not in the GFP-negative fraction of Epo kidney cells (Figure 5D). We have reported that neuronal markers are expressed by Epo-producing cells in the adult kidney [6]. Consistently, transcripts for microtubule-associated protein 2 (MAP2) and neurofilament light polypeptide (NFL) were detected in the GFP+ fraction from P4–6 Epo kidneys (data not shown). These results demonstrate our system for isolation of REPs is reliable and efficient.
Gene expression profile of oxygen-sensing and HIFs of the isolated REPs
We examined the expression of molecules, known to be involved in oxygen tension-dependent regulation [19], by qRT-PCR analysis. Compared to GFP-negative kidney cells, no enrichment of mRNA expression of oxygen sensor genes, Phd1–3 and Fih1 genes was found in the REPs fraction (Figure 6A). Hif2α but not Hif1α (Figure 6B, upper panel) mRNA expression was up-regulated in the REPs. In this line, no enrichment of HIF1α target genes [4], Pgk1 and Phd2, Phd3 were found in the REPs. These are consisted with recent reports on the relationship of HIF2α to renal Epo production [12], [29], [32], [33].
Figure 6
Expression profile of cellular oxygen-sensing and hypoxia-inducible molecules in the isolated REPs.
qRT-PCR analysis of the genes related to hypoxia response using RNA extracted from the sorted GFP− and GFP+ renal cells from P4–6 Epo mice. Hprt as a loading control *p<0.05. Data are for three experiments performed in duplicate. A Four genes related to cellular oxygen-sensing; B three Hifα isoforms. Also note that HIF1α targets: Pgk1, Phd2 are not enriched in the GFP+ fraction (REPs). C Three transcript variants of Hif3α in the purified GFP+ fraction (REPs), using a method for exponential PCR amplification at a fixed threshold (see also
).
Expression profile of cellular oxygen-sensing and hypoxia-inducible molecules in the isolated REPs.
qRT-PCR analysis of the genes related to hypoxia response using RNA extracted from the sorted GFP− and GFP+ renal cells from P4–6 Epomice. Hprt as a loading control *p<0.05. Data are for three experiments performed in duplicate. A Four genes related to cellular oxygen-sensing; B three Hifα isoforms. Also note that HIF1α targets: Pgk1, Phd2 are not enriched in the GFP+ fraction (REPs). C Three transcript variants of Hif3α in the purified GFP+ fraction (REPs), using a method for exponential PCR amplification at a fixed threshold (see also
).Hif3α mRNA expression was also enriched in the REPs ((Figure 6B, upper right panel). In the three alternatively spliced variants of Hif3α mRNA: Ipas, Nepas and Hif3α, Nepas is expressed during infantile and newborn stages, while Ipas is seen in adults. In accordance with a reported method [34], [35], we examined the expression of these splice variants in REPs, and detected all three variant mRNAs in the fraction of REPs at P4–6 stage. Nepas mRNA expression was the highest, suggesting Nepas might be a dominant form among the three splicing variants of the Hif3α at P4–6 infantile stage (Figure 6C).
Discussion
By generating Epomice, we isolated a specific type of renal cells namely REPs, which are responsible for Epo production after birth. REPs 1) are fibroblast-like interstitial cells residing in the tubulo-interstitial compartment of the kidney in anemic hosts (Hct 18%); 2) constitute up to 0.2% of whole kidney cells. About 63% of REPs also express CD73, a marker for cortical fibroblasts and Epo-expressing cells in kidney [6], [10], [28], [30]; 3) highly express Hif2α, Hif3α, but not Hif1α mRNAs; 4) are efficiently isolated from naive kidney tissues as GFP-expressing cells in our mutant.
Isolation system of REPs
Previously, difficulties in the isolation of REPs prevented better understanding of the mechanisms of Epo regulation in response to hypoxia. We developed an isolation system that phenotypically labeled REPs in the kidney, by way of a GFP knock-in (Epo) combined with a 3′ enhancer (Epo). This enabled us to purify REPs, a rare cell population, from kidney by FACS-sorting.Our GFP knock-in strategy facilitates the capacity to express GFP based on endogeneous Epo gene expression confined to a rare population, without worries about aberrant or ectopic transgene expression. As a result, we identified REPs as peritubular fibroblast-like interstitial cells concentrated at the cortico-medullary junction, corresponding to our previous finding from the Epo-GFP transgenicmouse studies [5], [6].In the history of Epo research, in situ hybridization is a classic method to localize Epo mRNA; but extensive studies lead to confusion of REPs' whereabouts: peritubular interstitium, or a tubular site [5]. Transgenic mice, created by integrating a marker gene with regulatory sequences of the Epo gene, have provided a powerful tool for accurate localization of REPs in the kidney [6], [8], [11]. In mice bearing an Epo/SV40 T antigen transgene, REPs were successfully identified but attempts to isolate REPs in vitro failed [8], [11]. Importantly, later transgenicmouse studies suggested that a much wider (20-kb∼) flanking region of the Epo gene was needed for adequate levels of transgene expression in kidney [5], [6], [36].To induce Epo gene expression, pre-treatment to induce hypoxia/anemia is usually required. These procedures, such as bleeding or phenylhydrazine injection, are not always successful in inducing stable anemia. For instance, we have tried isolation of REPs using our Epo-GFP transgenicmouse [6]. The GFP+ population of the kidney cells from the transgenicmouse were not distinct under FACS detection, despite that severe anemia was induced by phlebotomy. Epomice provide a handy and important source: lacking the 3′ enhancer demonstrated impaired hepatic Epo expression and profound anemia (Hct value was about 18% in newborn stage P4–6) and allowed us to directly sort REPs by FACS, which are constantly and stably labeled with GFP fluorescence in newborn kidneys. Moreover, considering the loose connections of renal tissues and the decreased interstitial volume of the cortex, renal tissues from newborns promised to be a better source of this rare cell population than adult kidney [37]. What is important that newborn REPs are fully functional with regard to Epo secretion, soon after birth [9], [23]. Indeed, newborn REPs (P4–6) displayed adult REPs phenotypes: fibroblast-like (CD73+/α-SMA−) [28], [29] with neuronal marker expression (MAP2+/NFL+) [6].
Cellular characters of the GFP-labeled REPs
GFP coupled with marker molecule analyses revealed that REPs are localized in the deep renal cortex, form a network around tubules and adjacent capillaries with their processes, and express fibroblast markers CD73, PDGFRβ and soluble guanylyl cyclase (sGC) (data not shown) but not other cell markers CD31, MHCII or E-cadherin. Surface expression of these molecules on REPs was verified by both confocal microscopy and flow cytometry. Therefore, all of these data support a widely accepted notion that REPs are peritubular fibroblast-like interstitial cells [6], [10], and resolves earlier conflicts on the cell identity in the literature [5].Fibroblasts are considered to be an easy cell type to cultivate. However our attempts to culture REPs were not successful. It is interesting to consider that REPs are a type of fibroblasts in a resting state, and when induced to proliferate (signified by α-SMA expression), they lose their ability to produce Epo [38], [39], such as the case for renal fibrosis and renal anemia. Concurring with our previous finding that adult REPs express neuronal markers [6], we confirmed Map2 and Nfl mRNA expression in FACS-sorted REPs from P4–6 newborns. These observations further support the notion that REPs are unique fibroblast-like cells.
Association with CD73 during anemia
Our histological and flow-cytometrical examinations revealed that REPs constitute grossly 0.2% of total kidney cells, with 63% co-expressing CD73 in the case of our Epomice (Hct 18% at P4–6 newborn stage). In the non-anemic kidneys, only a few REPs, composed of both CD73+ and CD73−, can be observed in the juxtamedullary layer of the cortex. These cells probably represent a basal level of Epo production under normal conditions, which is required for daily production of red blood cells in normal individuals. In anemic kidneys both CD73+ and CD73− REPs are robustly increased in a pattern that spreads outward from the deep cortex toward the capsule and the inner medullar.qRT-PCR revealed a 100-fold enrichment of Epo mRNA in the GFP+ fraction, but no enrichment in the CD73+ fraction, compared with the unsorted total kidney cells. CD73 has a wide expression profile in renal cortex, occupying roughly 3% of the total kidney cells at P4–6 newborn stage based on our FACS study. In addition to the interstitial cells, such as fibroblasts, T-, B-lymphocytes, many parenchymal cells e.g. glomorular mesangial, proximate tubular (brush board), collecting duct cells etc. also express CD73 [28]. Comparing the pattern of CD73 staining in the anemic kidney section with the non-anemic one, it seems that anemia increases the number of CD73+ cortical interstitial fibroblasts but not other types of CD73+ cells. Because cortical fibroblasts are rare population, among all of the CD73+ cells, the percentage of CD73 fraction did not change much in anemic kidneys compared with non-anemic kidneys. The heterogeneity of CD73 expression in REPs may reflect different functional or matured stages during anemia [39]]. Recently, it has been reported that loss-of-CD73 does not affect the expression of Epo [40]. Our data that only a part of REPs express CD73 in anemic kidneys seem to conform this finding that the loss of CD73 has not impact on renal erythropoietin induction under hypoxia.
Expression profile of oxygen sensor molecules and transcriptional determinants in REPs
Clinically, congenital defects of the oxygen-sensing pathway have been reported including VHL, PHD2 and HIF2A mutations that cause secondary erythrocytosis through the EPO gene over-expression [1], [7]. PHD2 inactivation is sufficient to induce near max. renal Epo production [41], [42]; and recent RNAi-based studies confirmed the major role of PHD2 in Epo regulation in vitro as well as in vivo
[43]. Human and ratPHD2 mRNA are hypoxically induced by HIFs for negative feedback regulation [44], [45]. In the carbon monoxide exposed rat, PHD3 protein was detected and co-localized with HIF2α in cortical interstitial cells of the kidneys [46]. Phd2, 3 are the targets of HIF1α [4]. In this study, we examined four genes encoding oxygen-sensor molecules (PHD1–3 and FIH1) and did not observe any enrichment in REPs compared with other cells of the anemic kidneys in our gene expression profiling. This may be because all of these four genes are ubiquitously expressed in kidney, with respect to various cell types of the kidney.As described above, Hif2α, rather than Hif1α shows highly REPs-specific expression patterns at the mRNA level. Interestingly, Hif2α mRNA levels are particularly high in tissues that are important for the systemic delivery of oxygen, for example the lung, heart, endothelium and the carotid body [47]–[49]. Quite recently, HIF2α protein expression has been shown in the peritubular fibroblasts that express Epo and CD73 in rat kidneys [30]. Preferential binding of HIF2α protein to the HRE within the native Epo gene 3′ enhancer has been also confirmed in hepatocytes [50]. As renal Epo expression does not depend on the Epo gene 3′ enhancer [23], the existence of a possible renal enhancer with a different HRE awaits investigation.Enrichment of Hif3a mRNA was also observed in the REPs. Transcripts of all of the three splicing variants (Nepas, Ipas and Hif3a) of Hif3a could be detected in newborn REPs (P4–6), where Nepas seems to be the dominant form of the three. Nepas and Ipas have been demonstrated to be hypoxia-induced factors due to the presence of functional HREs upstream of Exon1a, and act as negative regulators of the HIF pathway. Both Ipas and Nepas show a cell-, and stage-specific expression pattern [21], [22]. IPAS (inhibitory PAS protein) has already been reported to work as a negative feedback factor in a hypoxic condition in the cornea [21], [51], but there is no literature on its roles in hematopoiesis so far. Our targeted Hif3a knockout mice (Hif3a) show an impaired cardiovascular formation around birth. This phenotype is possibly caused by over-expressed Endothelin-1 in pulmonary endothelium. HIF3α (Nepas) was suggested to suppress HIF2α-driven transcription of Endothelin-1 according to the localization and reporter assays [22].We were curious to see if a similar mechanism exists in Epo gene regulation. We are starting to explore the function of HIF3α in erythropoiesis by examination of our established Hif3amice [22]. Hif3amice were viable and fertile without abnormalities under normal conditions. Based upon our preliminary data in mousehypoxia experiments, it appeared that Epo transcript showed up-regulated tendency in Hif3a kidneys, in contrast to the wild type counterparts. In a recent review, McIntosh et al. also mentioned an erythropoietic phenotype in their independent Hif3amice [52]. We, therefore, hypothesized HIF3α-related negative regulation is also necessary in renal Epo production during hypoxia/anemia. By this, homeostasis of red blood cell mass might be maintained to prevent erythrocytosis and thrombosis occurring in animals and human beings. HIF response to hypoxia is complex. A recent report has demonstrated that humanHIF3A gene expression is induced by hypoxia through activation of HIF1α but not HIF2α [53]. It raises the possibility that in REPs, Hif3a mRNA expression might be up-regulated by HIF2α, because REPs preferentially express Hif2a rather than Hif1a.Recently a renal cell line producing Epo with a hypoxia-dependent manner has been successfully established from a patient suffering from renal cancer [12]. Here, we report for the first time on isolation or purification of REPs in vivo. Our mouse enables the purification of a rare cell population specific for renal Epo expression during anemia and a detailed examination of the hypoxia-dependent aspect of the cells. Finally, we report the novel finding that Hif2α and Hif3α (but not Hif1α) mRNA are preferentially expressed in REPs. Combined with recent evidence in vivo about the role of HIF2α in erythropoiesis, we propose a hypothesis: positive regulation by HIF2α and negative regulation by HIF3α may be necessary for correct renal Epo induction during hypoxia/anemia.
Materials and Methods
Generation of Epo mice
All mice used were from a C57BL/6 genetic background and were strictly kept in the specific-pathogen-free conditions. All experiments were conducted in accordance with the regulations of The Standards for Human Care and Use of Laboratory Animals of Tohoku University. The protocol was approved by the Committee on the Ethics of Animal Experiments of Tohoku University (Permit Number: 21-Idou-144 and 22-Idou-113).Epomice were generated by mating mice heterozygous for Epo with mice homozygous for deletion of the 3′enhancer (Epo) [23]. Genotyping was performed by polymerase chain reaction (PCR) with the primer sets listed in Table 2. From this mating, half of the offspring would be Epomice. These mice are genetically deficient in Epo gene 3′enhancer activity and had anemia within two weeks after birth.
Table 2
Oligo-nucleotide sequences of primers used in this study.
Use
Sequence (5′-3′)
Genotyping of the EpoGFP allele
ACTCTCGGCATGGACGAGCTG
GTGAGTGTTCGGAGTGGAGCAGG
Genotyping of the EpoΔ3′E allele
ACATGGTCCTGCTGGAGTTC
ACACACTCCCAGCAAATTCC
Genotyping of the Epo gene (3′ enhancer)
CAGGCTCCATTCAAGGC
CCTGCAGTGGACTTTGAAGGC
Genotyping of the endogenous Epo gene
GGCATGGCTCAATGATTAGG
GTGAGTGTTCGGAGTGGAGCAGG
qRT-PCR for Hif1α mRNA
CCTGCACTGAATCAAGAGGTTGC
CCATCAGAAGGACTTGCTGGCT
qRT-PCR for Hif2α mRNA
GGACAGCAAGACTTTCCTGAGC
GGTAGAACTCATAGGCAGAGCG
qRT-PCR for Hif3α mRNA (total)
AAGACGCCCTGACCCCCAGG
CCCTCTGCTGGTGAGCGTGC
qRT-PCR for Ipas mRNA
TCCACGATGGTGCTACTCTG
TGTCCTTCACTCCCTCCTAG
qRT-PCR for Nepas mRNA
CTGCAGCGCGTGAGGTCG
CTTTTTCCACCTGGTTCCAC
qRT-PCR for Hif3α mRNA (variant 1)
ACCAAGACAGGTCGAACACC
TTTTCCACCTGGTTCCACTC
qRT-PCR for Phd1 mRNA
ATGGCTCACGTGGACGCAGTAA
CATTGCCTGGATAACACGCCAC
qRT-PCR for Phd2 mRNA
TAAACGGCCGAACGAAAGC
GGGTTATCAACGTGACGGACA
qRT-PCR for Phd3 mRNA
CTATGTCAAGGAGCGGTCCAA
GTCCACATGGCGAACATAACC
qRT-PCR for Fih1 mRNA
CGAAGTTACAGCTTTCCGACCAG
GTTTGTGTCGGTCAGCACCACT
qRT-PCR for Pgk1 mRNA
GATGCTTTCCGAGCCTCACTGT
ACCAGCCTTCTGTGGCAGATTC
qRT-PCR for Epo mRNA
CATCTGCGACAGTCGAGTTCTG
CACAACCCATCGTGACATTTTC
qRT-PCR for Hprt mRNA
GTTGGATACAGGCCAGACTTTGT
CCACAGGACTAGAACACCTGC
Hematological analysis
Whole blood was collected from the carotid arteries, and hematopoietic indices were measured using an automatic blood cell analyzer (Nihon Koden).
Immunostaining
Kidneys were immersion-fixed in 4% paraformaldehyde (Nakarai Tesque) for 3 hours at 4°C and embedded in OCT compound (Sakura Finetechnical). Frozen sections 20 µm in thickness were incubated with primary antibody for 16 hours at 4°C, and detected by Alexa Fluor 488 (Molecular Probes) or Alexa Fluor 555 (Molecular Probes) conjugated anti-IgG as second antibodies. Color detection was performed using diaminobenzidine as a chromogen (brown color staining). Nuclei were stained with 4′-diamidino-2-phenylindole (DAPI). Fluorescent images were observed using the LSM510 confocal imaging system (Carl Zeiss).All of the primary antibodies were diluted 1∶500 in blocking solution (Dako) as follows: Anti-GFP (MBL); Biotinylated Anti-E-Cadherin (R&D systems); anti-CD31 (BD Pharmingen); phycoerythrin (PE) anti-CD73 antibody (BD Pharmingen); Alexa Fluor 647 Anti-CD73 (Biolegend); anti-α-SMA (Abcam); Allophycocyanin (APC) anti-CD140b (PDGFRβ) (Biolegend); APC anti-MHCII (eBioscience).
FACS analysis and cell sorting
Epo anemic newborns were sacrificed at P4–6. The kidneys were collected in PBS from several litters and teased away from their surrounding tissues. Single cell suspension was prepared using dispase (1.25 mg/mL; Invitrogen) in PBS–15% FCS for 60 min at 37°C followed by washing in DMEM-Ham's F-12–10% FCS and passing through a nylon mesh to remove any clumps. This cell preparation was approximately 85% single viable cells. Whole kidney was analyzed and sorted on the flow cytometer (FACSAria, Becton Dickinson). The effectiveness of each FACS separation was assessed by immediately resorting an aliquot of GFP+ and GFP− cells (data not shown). Greater than 75% of the GFP+ population resorted to the same gate used in the initial sort.
qRT-PCR analysis
Total RNA was extracted from FACS-purified cells using Isogen reagent (Nippon Gene), according to the manufacturer's protocol. RNA was then concentrated using RNeasy MinElute columns (Qiagen) and first strand cDNA synthesis was performed using the SuperScript III First Strand Synthesis System for RT-PCR (Invitrogen).Primers for amplifying 100–300 bp of each PCR product were used (Table 2). PCR reactions were SYBR Green programmed and carried out using qRT-PCR Mastermix (Takara). Each sample was analyzed in duplicate or triplicate. The data were normalized by subtracting the difference of the CT values between the target genes of interest (Tgene) and that of Hprt mRNA, thereby obtaining a ΔCT (Tgene CT−HPRT CT). Relative expression (fold induction) was calculated as 2−(SΔC
T
−CΔC
T
) where SΔCT−CΔCT is the difference between the sample ΔCT (GFP+ cells) and the control ΔCT (GFP− cells). Both target gene and Hprt reactions approached 100% efficiency as determined by standard curves. PCR products were analyzed by dissociation curve and on agarose gels to check that a single band was amplified.The molar ratio was calculated as previously described [33], [34]: molar ratio = [L
a×(1+E
a)CTa]/[L
b×(1+E
b)CTb]. L
a and L
b indicate lengths of the amplicon for 1a and 1b transcripts, respectively. E
a and E
b indicate the amplification efficiency of a primer set for 1a and 1b transcripts, respectively. CTa and CTb indicate the numbers of threshold cycles for the 1a and 1b transcripts, respectively.
Statistics
Statistical analysis was performed between samples and controls using t-test (two tailed, unequal variance, p≤0.05 cut-off).
Supporting Information
3D-movie of REPs and their spatial coordination, were made by compiling images collected using a Zeiss LSM 510 confocal microscope. One z-slice of the stack is shown in Movie S1.3D image of REPs by confocal laser-scanning microscopy. Kidney sections from P5 Epo newborn were co-stained with anti-E-cadherin to label the tubular cells. GFP: green; E-cadherin: white; DAPI: blue/nucleus. Scale bar: 20 µm.(MOV)Click here for additional data file.
Authors: Pinelopi P Kapitsinou; Qingdu Liu; Travis L Unger; Jennifer Rha; Olena Davidoff; Brian Keith; Jonathan A Epstein; Sheri L Moores; Connie L Erickson-Miller; Volker H Haase Journal: Blood Date: 2010-07-13 Impact factor: 22.113
Authors: A C Epstein; J M Gleadle; L A McNeill; K S Hewitson; J O'Rourke; D R Mole; M Mukherji; E Metzen; M I Wilson; A Dhanda; Y M Tian; N Masson; D L Hamilton; P Jaakkola; R Barstead; J Hodgkin; P H Maxwell; C W Pugh; C J Schofield; P J Ratcliffe Journal: Cell Date: 2001-10-05 Impact factor: 41.582
Authors: Wibke Bechtel; Scott McGoohan; Elisabeth M Zeisberg; Gerhard A Müller; Hubert Kalbacher; David J Salant; Claudia A Müller; Raghu Kalluri; Michael Zeisberg Journal: Nat Med Date: 2010-04-25 Impact factor: 53.440
Authors: Annika Pasanen; Minna Heikkilä; Kati Rautavuoma; Maija Hirsilä; Kari I Kivirikko; Johanna Myllyharju Journal: Int J Biochem Cell Biol Date: 2010-04-21 Impact factor: 5.085
Authors: Katharina Gerl; Lucile Miquerol; Vladimir T Todorov; Christian P M Hugo; Ralf H Adams; Armin Kurtz; Birgül Kurt Journal: Kidney Int Date: 2015-09-23 Impact factor: 10.612
Authors: Hanako Kobayashi; Qingdu Liu; Thomas C Binns; Andres A Urrutia; Olena Davidoff; Pinelopi P Kapitsinou; Andrew S Pfaff; Hannes Olauson; Annika Wernerson; Agnes B Fogo; Guo-Hua Fong; Kenneth W Gross; Volker H Haase Journal: J Clin Invest Date: 2016-04-18 Impact factor: 14.808
Authors: Henrik Dimke; Matthew A Sparks; Benjamin R Thomson; Sebastian Frische; Thomas M Coffman; Susan E Quaggin Journal: J Am Soc Nephrol Date: 2014-11-10 Impact factor: 10.121